| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Research Communications |
Departamento de Inmunología y Oncología, Centro Nacional de Biotecnología, CSIC, Universidad Autónoma de Madrid, Campus de Cantoblanco, E-28049 Madrid, Spain
2Correspondence: Department Immunology and Oncology, Centro Nacional de Biotecnología, UAM/CSIC, Campus de Cantoblanco, E-28049 Madrid, Spain. E-mail abras{at}cnb.uam.es
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Key Words: caspases • cell cycle • PARP
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
2)
. It is now clear that cell death via
apoptosis plays an important role in shaping the immune repertoire of
both T and B cells. In the last few years, many of the molecules have
been identified that participate in this biochemical pathway mediating
apoptotic cell death. At the heart of this pathway is a family of
cysteine proteases, the caspases, which are related to mammalian
interleukin 1ß-converting enzyme
(ICE3/caspase-1) and CED-3, a gene product
required for the activation of the apoptotic pathway in cells of the
nematode Caenorhabditis elegans (3
4
5)
. Caspases can be
divided into three distinct groups: group I (caspases 1, 4, and 5),
which display ICE-like activity; group II (caspases 2, 3, and 7), with
CPP32-like activity; and group III (caspases 6, 8, and 9) (reviewed in
ref 3
). In humans, at least seven of the ten currently known family
members participate in one of two distinct signaling pathways:
activation of proinflammatory cytokines or promotion of apoptotic cell
death. Caspases are not the only enzymes that participate in apoptosis,
since nucleases and protein kinases also take part, but they are
absolutely required for the precise proteolytic events that
characterize this type of programmed cell death. Nagata's group
recently demonstrated that activation of the caspase-activated
deoxyribonuclease (CAD) downstream of the caspase cascade is
responsible for internucleosomal DNA degradation during apoptosis.
Moreover, caspase 3 cleaves the CAD inhibitor, ICAD, allowing CAD
translocation to the nucleus (6,
7)
.
Cell death by necrosis is presumably dangerous, and the apoptotic
response is thus a mechanism to dismantle cells for disposal in a way
that does not compromise the rest of the organism. The biological
relevance of caspases is illustrated by the observation that death
induced by expression of the proapoptotic factor Bax in cells in which
caspase activity was completely inhibited was not apoptotic, but more
reminiscent of necrosis (8)
. The role of caspases in apoptosis is to
disable critical homeostatic and repair processes, as well as to cleave
key structural components, resulting in the systematic and orderly
disassembly of the dying cell. It therefore becomes important to
determine whether the caspase-mediated cleavages observed are a vital
part of the apoptotic program or are bystander events.
During lymphocyte development in the bone marrow, a large number of B
cells are generated, expressing a broad array of surface immunoglobulin
M (IgM) receptors. This repertoire of developing B cells allows the
immune system to recognize a universe of structures, including
self-antigens (2,
9
10
11)
. To avoid autoimmune manifestations, two
regulatory mechanisms are known to operate in developing B cells:
physical elimination of self-reactive B cells (clonal deletion) and
functional inactivation of potentially autoreactive B cells by cell
growth inhibition (clonal anergy) (9,
10)
. Although both processes can
operate in vivo, it is thought that deletion of
self-reactive B cells plays a major role in normal B cell development.
Elimination of self-reactive B cells occurs at the immature B cell
stage of development and depends on the interaction of the surface IgM
receptor with self-antigens (2,
10,
12,
13)
. Mature B lymphocytes also
die in response to B cell receptor (BCR) stimulation in the absence of
proper T cell help, provided mostly by CD40L-CD40 interaction. This was
clearly demonstrated by the use of transgenic mice bearing B cell
receptors specific for defined antigens, showing that the elimination
of self-reactive mature B lymphocytes occurs after exposure to
membrane-bound antigens (2,
12)
.
Although many early signal transduction events through the BCR have now been elucidated, biochemical events leading to apoptosis are not entirely clear. sIgM cross-linking induces growth arrest and apoptosis. In this study, we investigated whether caspase activation was implicated in apoptosis by BCR cross-linking. The immature B cell lymphoma WEHI-231 was used as a model for B cell tolerance based on its phenotype (sIgMhigh, sIgDlow), which parallels that of immature B cells. A molecular dissection of the mechanisms and biochemical pathways involved in these changes showed the induction of CPP32-like activity mediated by caspase-7/Mch3 prior to induction of apoptosis. Growth arrest, however, was not dependent on caspase activation. Furthermore, Bcl-2 overexpression, and costimulation of CD40 with CD40L inhibited caspase-7/Mch3 activation as well as apoptosis, but only ligation of CD40 impeded growth arrest, which correlated with a delay in retinoblastoma (Rb) dephosphorylation and sustained cyclin A levels. Our results suggest that caspase-7/Mch3 plays an important role in apoptosis of immature B lymphocytes triggered by antigen receptor cross-linking and that both processes, apoptosis and growth arrest, are regulated differently.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
(a gift of Dr. P. Lane,
Basel, Switzerland) were maintained in supplemented RPMI 1640
containing 2 mg/ml geneticin (Calbiochem, San Diego, Calif.). For
production of CD40L-containing supernatants, cells were cultured at
106/ml for 24 h without selection agent and
the cell-free supernatants were harvested, sterile filtered, and stored
at -70°C until used.
Antibodies and reagents
Goat anti-mouse IgM, µ chain-specific (10 µg/ml,
Jackson ImmunoResearch, Inc., West Grove, Pa.), was used to induce cell
death. The following antibodies were used for Western blot assays:
polyclonal rabbit anti-murine Nedd2 (caspase-2), anti-mouse cyclin A,
goat polyclonal anti-human Caspase-7/Mch3 (cross-reacts with mouse)
(Santa Cruz Biotechnology, Inc., Santa Cruz, Calif.), mouse monoclonal
anti-human Bcl-2 (Dako, Glostrup, Denmark), and anti-human
poly(ADP-ribose) polymerase (PARP) and anti-human Rb (both cross-react
with mouse) (Pharmingen, San Diego, Calif.). Polyclonal rabbit
anti-mouse FLICE/caspase-8 and CPP32/caspase-3 were the kind gift of
Drs. Tak Mak and R. Hakem (Ontario Cancer Inst., Toronto, Canada) and
polyclonal rabbit anti-murine ICE was the kind gift of Dr. J. Tschopp
(Univ. of Lausanne, Switzerland). All antibodies were developed using
peroxidase (PO) -conjugated anti-rabbit, anti-mouse, or anti-goat Ig
antisera (Dako). For in vivo assays, 100 µM of the
tetrapeptide protease inhibitors
acetyl-Tyr-Val-Ala-Asp-chloromethylketone (Ac-YVAD-cmk) and
acetyl-Asp-Glu-Val-aspartic acid aldehyde (Ac-DEVD-CHO) and the
tripeptide z-Val-Ala-DL-Asp-fluoromethylketone (z-VAD-fmk) (Bachem,
Bubendorf, Switzerland) were added to cultures 1 h before anti-µ
treatment.
Enzyme assay for caspase activity
Cells were collected, washed with ice-cold phosphate-buffered
saline (PBS), and resuspended in extraction buffer (50 mM Tris-HCl, pH
7.6, 150 mM NaCl, 0.5 mM EDTA, 10 mM
NaH2PO4, 10 mM
Na2HPO4, 1% Nonidet P-40,
0.4 mM Na3VO4, 1 mM PMSF,
10 µg/ml aprotinin, and 10 µg/ml leupeptin). After 30 min
incubation on ice, the cell lysate was centrifuged (20,000
g, 30 min) and the supernatant was used as cytosolic
extract. Five micrograms of cytosolic proteins, estimated by the
bicinchoninic acid method (15)
, were diluted fivefold in assay buffer
(25 mM HEPES, pH 7.5, 0.1% CHAPS, 10% sucrose, 10 mM DTT, and 0.1
mg/ml ovalbumin) and incubated with 10 µM each of the fluorescent
substrates acetyl-Tyr-Val-Ala-Asp-7-amino-4-methylcoumarin,
acetyl-Asp-Glu-Val-Asp-7-amino-4-methylcoumarin, or
acetyl-Val-Glu-Ile-Asp-7-amino-4-methylcoumarin to measure ICE-,
CPP32-, and Mch2-like activity, respectively. The reaction was
terminated by addition of high-performance liquid chromatography (HPLC)
buffer (water/acetonitrile (75/25), 0.1% trifluoroacetic acid).
Cleaved substrate fluorescence was determined by
C18 reverse phase HPLC using fluorescence
detection (338 nm excitation and 455 nm emission). Control experiments
confirmed linearity with time and protein concentration of substrate
release; substrate specificity cleavage was confirmed using 20 µM of
Ac-YVAD-cmk or Ac-DEVD-CHO as ICE- or CPP32-like inhibitors,
respectively (data not shown).
Assessment of apoptotic cell death
Apoptosis was evaluated by staining cellular DNA content with
the DNA intercalator propidium iodide (PI) using a semiautomatic
procedure (DNA-Prep Reagents, Coulter), followed by analysis on an
EPICS XL flow cytometer. Briefly, cells
(105-106) were recovered by
centrifugation, resuspended in 100 µl of PBS, then permeabilized and
stained by addition of 100 µl of detergent reagent, followed by 1 ml
of PI solution. After mixing, samples were incubated at 37°C for 30
min and analyzed in flow cytometry. Apoptosis was determined as the
percentage of DNA located in the hypoploid
subG0/G1 peak of the cell
cycle.
Western blot analysis
Cells (106) were collected, washed with
ice-cold PBS, and resuspended in RIPA lysis buffer [20 mM Tris-HCl, pH
8, 137 mM NaCl, 1 mM MgCl2, 1 mM
CaCl2, 10% glycerol, 1% Nonidet P-40, 0.5%
deoxycholate, 0.1% sodium dodecyl sulfate (SDS), and protease
inhibitors]. Protein content of the lysate was quantified using the
Bio-Rad DC protein assay (Bio-Rad, Hercules, Calif.). After
SDS-polyacrylamide gel electrophoresis (PAGE) under reducing
conditions, proteins were transferred to nitrocellulose membrane
(Bio-Rad). Membranes were blocked overnight with 5% non-fat dry milk
in TBS buffer (20 mM Tris-HCl, pH 7.5, 150 mM NaCl). Subsequent
antibody incubations and membrane washes were performed in TBS-T buffer
(20 mM Tris-HCl, pH 7.5, 150 mM NaCl, 0.2% Tween 20) containing 1%
non-fat milk. After 2 h antibody incubation and washing,
PO-conjugated goat anti-rabbit or anti-mouse Ig sera were added for
1 h. Blots were washed extensively and developed using the ECL
system (Amersham, Little Chalfont, U.K.).
Preparation of purified spleen B cells
Female C57BL/6 mice, bred in our animal facility, were used
between 3 and 4 wk of age. Spleens were removed from mice killed by
cervical dislocation and B cells were purified by negative selection
using the MACS immunomagnetic separation system (Miltenyi Biotec,
Bergisch Gladbach, Germany), following the manufacturer's
instructions. More than 95% of cells recovered were B220 positive.
Cloning of caspase-7/Mch3 and in vitro
transcription/translation
Caspase-7/Mch3 was cloned from Jurkat cells by reverse
transcription polymerase chain reaction (RT-PCR), using superscript II
reverse transcriptase (Life Technologies, Gaithersburg, Md.) and
expanded long template PCR system (Boehringer Mannheim, Mannheim,
Germany). The PCR product obtained with primers LAP3.5'BamHI
(GGATCCACCATGGCAGATGATCAGGGCTG) and LAP3.3'EcoRI
(GAATTCCTATTGAC TGAAGTAGAGTTCCTTG) was cloned in a second vector pCR2.1
(Invitrogen, San Diego, Calif.). The positive clones were subcloned in
pCDNA3 (Invitrogen) under the T7 promoter and their sequences were
confirmed by sequence analysis. Plasmid templates were used in coupled
in vitro transcription/translation reactions to generate
[35S]methionine-labeled proteins (Promega,
Madison, Wis.).
Preparation of supernatant (S-100) cytosolic fraction and
caspase-7/Mch3 processing assay
Purified splenic B cells and WEHI-231 cells were harvested,
washed with ice-cold PBS, and pellets were resuspended in 5 volumes of
ice-cold buffer (20 mM HEPES-KOH pH 7.5, 10 mM KCl, 1.5 mM
MgCl2, 1 mM sodium EDTA, 1 mM sodium EGTA, 1 mM
DTT, and protease inhibitors). After incubation on ice for 15 min,
cells were lysed by freeze/thaw cycles, centrifuged at
105 g for 1 h and the resulting
S-100 was used for the in vitro caspase-7/Mch3 activation
assay. Briefly, S-100 was incubated in the presence of the translated
[35S]methionine-labeled caspase-7 for 2 h.
At the end of the incubation period, SDS buffer was added to each
reaction, boiled, and subjected to SDS-PAGE.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
17
18
19)
. Growth arrest can be visualized by cell cycle
analysis at 24 h posttreatment, as evidenced by accumulation of
cells in G0/G1 phase and a
decrease in the S phase, whereas apoptosis can be determined as the
fraction of cells in the subG0 peak visualized at
48 h (Fig. 1
A). To determine whether anti-µ-mediated apoptosis induces
caspase activation, we analyzed ICE-like, Mch2 and CPP32-like
activities in cytosolic extracts of WEHI-231 cells treated with
anti-µ antibodies. CPP32-like activity was induced 8 h after
anti-µ incubation and reached a plateau at 24 h (Fig. 1B
). In contrast, no ICE-like or Mch2 activity was detected
in the same extracts. Furthermore, there was no evidence of proteolytic
activation of caspase-1/ICE and caspase-8/FLICE in WEHI-231 cells on
anti-µ treatment, as measured by Western blot analysis (Fig. 2
A). ICE-like and Mch2 activation pathways are functional in
these cells, however, as demonstrated on vaccinia virus infection (data
not shown).
|
|
CPP32-like activity may be due to caspase-3/CPP32, caspase-7/Mch3, or
caspase-2/Nedd2 (3)
. In an attempt to distinguish the caspase
responsible for the CPP32-like activity triggered by IgM cross-linking,
we measured proteolytic activation of these caspases by Western blot
analysis. Anti-µ treatment did not induce proteolytic activation of
CPP32 or Nedd2 (Fig. 2A
), since we were unable to detect the
active forms of these caspases, p17 and p12, respectively. In contrast,
anti-µ treatment induced Mch3 processing (Fig. 2A
). In
untreated cells, Mch3 appears as a 35 kDa protein band; after anti-µ
treatment, a band corresponding to 32 kDa (p32) was recognized by the
anti-Mch3 antibody (Fig. 2A
). The intensity of the p32
subunit band was markedly decreased 48 h after stimulation,
suggesting that this subunit undergoes further processing. Products of
p32 subunit processing were not visualized in Western blot, possibly
because the anti-Mch3 antibody used is directed against the
carboxyl-terminal end of the native caspase. IgM cross-linking also
induced proteolysis of PARP, a well-known substrate of this group of
caspases (Fig. 2B
). These results suggest that BCR
cross-linking in WEHI-231 cells induces the selective activation of the
CPP32 subfamily member Mch3, with subsequent proteolysis of PARP.
To rule out the possibility that caspases are activated by the Fas/FasL
pathway in anti-µ-treated WEHI-231 cells, we also examined Fas and
FasL expression. There was no up-regulation of Fas levels after
anti-µ treatment and no detectable FasL protein was observed either
before or after anti-µ treatment (data not shown). It is therefore
unlikely that anti-µ treatment activates caspases in WEHI-231 cells
via the Fas/FasL pathway. Moreover, FLICE is not activated after BCR
cross-linking, as shown by the lack of proteolysis after anti-µ
addition (Fig. 2A
); this further supports the observation
that BCR is not using the Fas/FasL pathway. In fact, it has been
reported that although anti-Fas and sublethal concentrations of
anti-µ were additive in the induction of apoptosis in WEHI-231 cells,
Fas did not appear to play a direct role in apoptosis mediated by BCR
cross-linking (20)
.
Inhibition of CPP32-like activity is not sufficient to
block anti-µ-induced apoptosis
To determine whether CPP32-like, presumably Mch3, activity
was responsible for anti-µ-induced apoptosis in WEHI-231 cells, we
examined the effect of caspase inhibitors. As Fig. 3
shows, the inhibitor of the CPP32-like family Ac-DEVD-CHO and the
general caspase inhibitor z-VAD-fmk both inhibited CPP32-like activity
(Fig. 3A
) and PARP proteolysis (Fig. 3B
) induced
by anti-µ cross-linking. Only z-VAD-fmk, however, and not
Ac-DEVD-CHO, was able to prevent apoptosis induced by IgM
cross-linking, as evidenced by the lack of the
subG0 peak in cells treated with anti-µ for
48 h in the presence of z-VAD-fmk (Fig. 4
). The tetrapeptide Ac-YVAD-cmk, an irreversible specific inhibitor of
the ICE-like family of caspases, showed no effect on CPP32-like
activity (Fig. 3A
), PARP proteolysis (Fig. 3B
),
or apoptosis (Fig. 4)
when used as a control. As shown by cell cycle
analysis at 24 h (Fig. 4)
, neither Ac-DEVD-CHO nor z-VAD-fmk
counteracted the growth arrest mediated by anti-µ ligation, since
~70% of cells remained arrested in the
G0/G1 phase, as compared
with untreated cells. These results suggest that caspases other than
members of the CPP32 family are also involved in BCR-induced apoptosis
in WEHI-231 cells. In addition, caspases do not play a role in
anti-µ-mediated growth arrest, since it was not prevented by the
general caspase inhibitor z-VAD-fmk.
|
|
In view of the evidence suggesting that activation of a non-CPP32-like
caspase is important for anti-µ-induced apoptosis and the observation
that apoptosis is associated with further processing of Mch3 p32
subunit, we examined whether this processing was due to
autoproteolysis, as has previously been proposed (21)
, or to other
caspases. Ac-DEVD-CHO, which inhibits CPP32-like activity, failed to
prevent p32 proteolysis (Fig. 5
). In contrast, the general caspase inhibitor z-VAD-fmk prevented p32
processing, as shown by the persistence of the p32 subunit at 48 h
after anti-µ treatment. These results suggest that processing of the
Mch3 p32 subunit, like apoptosis, is mediated by a caspase(s) that does
not belong to the CPP32 family. Furthermore, the CPP32-like caspase
substrate PARP is not cleaved when the p32 subunit processing is
blocked by z-VAD-fmk, suggesting that this subunit is inactive.
|
Differential effects of hBcl-2 overexpression and CD40
ligation in apoptosis and growth arrest induced by BCR cross-linking
Bcl-2 and Bcl-xL have been reported to
block the caspase pathway (22
23
24)
. To examine the role of Bcl-2 in
anti-µ-induced apoptosis, we derived a subclone from WEHI-231 cells
transfected with human Bcl-2 (WEHI-hBcl2) (19)
, which expressed high
hBcl-2 protein levels, as evidenced by Western blot analysis
(Fig. 6
A). This subclone was resistant to apoptosis induced by
anti-µ treatment (Fig. 6B
). Prevention of apoptosis
correlated with inhibition of both CPP32-like activity (Fig. 6C
) and PARP proteolysis (Fig. 6D
). Bcl-2
overexpression also inhibited processing of the Mch3 p32 subunit (Fig. 6E
). Again, PARP, a Mch3 caspase substrate, was not cleaved
when the p32 subunit is present, suggesting either that p32 is not
active or that Bcl-2 may be preventing PARP proteolysis downstream of
Mch3 by another pathway. The intensity of the p32 band is unexpectedly
stronger than that of p35 at time 0; since protein loading was
equivalent in all lanes, this is more likely due to p32 subunit
accumulation than to prevention by Bcl-2 of Mch3 cleavage from the p35
form to p32.
|
CD40 signaling mediates rescue from anti-µ-induced cell death
(25
26
27)
. Treatment of WEHI-231 cells with CD40L prevented apoptosis
(Fig. 7
A), induction of CPP32-like activity (Fig. 7B
),
and PARP proteolysis (Fig. 7C
) mediated by IgM
cross-linking. In addition, CD40L treatment inhibited the initial
processing of the 35 kDa protein Mch3 into the p32 subunit (Fig. 7D
). The fact that CD40L, but not Bcl-2, blocked this
processing suggests that rescue from anti-µ-induced apoptosis may be
mediated through different mechanisms.
|
Cell cycle analysis also revealed that growth arrest induced by
anti-µ in WEHI-231 cells was not inhibited by hBcl-2 overexpression,
since 48 h after anti-µ addition more than 70% of cells were in
G0/G1 phase, as opposed to
48.7% in the control cells (Fig. 6B
). In contrast, CD40L
inhibited growth arrest (Fig. 7A
). These results suggest
that apoptosis and growth arrest pathways are distinct, since only
CD40L treatment, but neither Bcl-2 overexpression nor z-VAD-fmk
treatment, prevents both growth arrest and apoptosis.
Prevention of growth arrest is achieved by inhibition of Rb
activation and maintenance of cyclin A levels
It has recently been described that cell cycle arrest and
subsequent apoptosis induced by IgM cross-linking is correlated with
increased levels of the cyclin-dependent kinase inhibitors p21 and p27
and of the tumor suppressor p53 (28,
29)
. To determine whether CD40L or
Bcl-2 prevents growth arrest or apoptosis by controlling the
up-regulation of these proteins, we analyzed their expression levels
after BCR cross-linking. Nevertheless, we were unable to detect any
significant changes in p21, p27, or p53 expression levels (data not
shown). In fact, we found very low expression of p21 and p53 in
WEHI-231 cells. Prevention of growth arrest or apoptosis in WEHI-231
cells does not therefore appear to involve regulation of these
proteins.
It has also been reported that anti-µ cross-linking induces Rb
activation (dephosphorylation) as well as a decrease in cyclin A
expression levels (29,
30)
. The hypophosphorylated form of Rb is growth
repressive and regulates cell cycle progression by binding a number of
proteins, including E2F. On phosphorylation, E2F is released and the
cells progress into S phase (31)
. To understand whether some of these
effects were related to growth arrest and/or apoptosis induced by BCR
cross-linking in WEHI-231 cells, we studied the effect of caspase
inhibitors, CD40 ligation, and Bcl-2 overexpression in these changes.
As shown in Fig. 8
, Bcl-2 overexpression does not counteract Rb dephosphorylation and
cyclin A down-regulation induced by anti-µ addition. This may explain
why, although cells do not die, they remain arrested. In fact, the
prevention of apoptosis by Bcl-2 reported here is very similar to that
described in 3T3 fibroblasts, in which z-VAD-fmk prevented apoptosis
triggered by E1A, c-myc, Bak, or grim (32,
33)
. The cells do
not have an apoptotic phenotype, but they are arrested and undergo
detachment.
|
In contrast, CD40 stimulation by CD40L retards Rb
dephosphorylation (Fig. 8A
). Whereas anti-µ treatment
induces a strong dephosphorylation that can already be detected by
24 h, in the presence of CD40L we observed Rb activation only at
48 h after anti-µ addition. By 72 h, cells were still in
cycle (data not shown), suggesting that CD40L treatment in fact
prevents growth arrest rather than retarding it. Moreover, CD40
stimulation by CD40L maintains cyclin A levels (Fig. 8B
), in
accordance with prevention of growth arrest (Fig. 7A
). The
decrease detected in cyclin A expression occurs only 48 h after
anti-µ addition, whereas growth arrest begins earlier (24 h, Fig. 1A
). We thus cannot distinguish whether cyclin A expression
is down-regulated and the cells are therefore arrested or, more likely,
whether this down-regulation is an effect of growth arrest rather than
its cause.
IgM-mediated apoptosis in splenic B lymphocytes induces
caspase-7/Mch3 processing
We have described that purified B cells expressing surface
immunoglobulin specific for the H-2Kk MHC class I
haplotype, when stimulated with MHC class I H-2Kk
alloantigen, initiate a rapid signaling process that results in
apoptosis (34)
. In addition, signaling through the IgM membrane
receptor by anti-IgM antibody treatment triggers apoptosis in these B
cells and in normal spleen B cells. To extrapolate some of the results
obtained in the immature lymphoma cell line to normal in
vivo cell physiology, we tested Mch3 processing in splenic B
lymphocytes after apoptosis induction by IgM cross-linking. For this
purpose, the supernatant (S-100) cytosolic fractions of purified
splenic B cells and WEHI-231 cells, untreated or treated with anti-µ,
were incubated with the translated pro-Mch3, and the cleavage of the
[35S]methionine-labeled Mch3 precursor was
monitored. As shown in Fig. 9
A, translation of Mch3 generated two major products: a 35 kDa
product corresponding to the full-length pro-Mch3 and a 30 kDa internal
translation product, probably starting with Met45 (indicated with an
asterisk in Fig. 9A
). Incubation of pro-Mch3 with S-100 from
anti-IgM-treated WEHI-231 cells generated a 32 kDa subunit, whereas the
pro-Mch3 form (p35) completely disappeared (Fig. 9A
). We
were unable, however, to detect any other subunits of Mch3, as was
expected from the further processing of the p32 subunit deduced from
its disappearance in Western blot analysis. The p32 subunit is
therefore either not being processed, as the in vitro
caspase-7 processing experiments suggest, or p32 is unstable in
vivo.
|
Similarly, incubation of pro-Mch3 with S-100 from
anti-IgM-treated splenic B cells also induced pro-Mch3 processing,
generating a 32 kDa subunit (Fig. 9B
). The generation of
this subunit started 8 h after ex vivo treatment of B
cells with anti-µ; the pro-Mch3 form had been completely processed by
24 h. S-100 from untreated splenic B cells did not induce
processing of pro-Mch3 (Fig. 9
B), although these cells suffered spontaneous cell death in
ex vivo culture (Fig. 9C
). These results strongly
suggest that this processing is specifically induced by BCR
cross-linking.
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
36
37)
. Control of the apoptotic process therefore plays a selective
role in the course of B cell activation and maturation, and
identification of the mechanism involved in B cell deletion is thus of
interest for understanding B cell biology. For this reason, attention
has been devoted to the identification of the signaling pathways
involved in this process. In this study, we used the WEHI-231 cell line, a well-established model of B cell tolerance, to characterize some of the molecular mechanisms operating in BCR-mediated apoptosis. The results presented here demonstrate that anti-µ treatment induces CPP32-like activity mediated by caspase-7/Mch3 and PARP proteolysis, leading to initiation of apoptosis. Blockage of apoptosis was achieved by treatment with z-VAD-fmk, CD40L, and overexpression of Bcl-2. These treatments blocked CPP32-like activity as well as PARP proteolysis, but only CD40 ligation was able to prevented growth arrest induced by anti-µ in WEHI-231 cells. Growth arrest in these cells correlated with Rb activation (dephosphorylation) and down-regulation of cyclin A. CD40 stimulation was able to delay Rb activation and prevented cyclin A down-regulation, which was maintained at normal levels. It is nonetheless unclear whether down-regulation of this cyclin is responsible for growth arrest or is just a consequence of cells being arrested. Our results also suggest that caspase activation is not necessary for anti-µ-induced growth arrest, since when we inhibit caspase activity, the cells remain arrested but do not die. In contrast to z-VAD-fmk, the specific CPP32-like caspase inhibitor Ac-DEVD-CHO fails to prevent cell death triggered by anti-µ, although it completely inhibits CPP32-like activity. This suggests that caspases other than Mch3 and its family members are also critical for BCR-triggered apoptosis. Our data establish the importance of a caspase not belonging to the CPP32-family and the specific involvement of caspase-7/Mch3 in the induction of deletional tolerance.
The mechanisms for caspase-7/Mch3 processing proposed in the literature
are summarized in Fig. 10A
. Mch3 can be cleaved
directly by caspase-8 or caspase-9 on D(198), giving rise to a large
and a small subunit (p20 and p12, respectively). Caspase-3 can also
process Mch3 by cleavage on D(23)
, giving rise to 
proMch3 (p32).
This model, proposed for Mch3 processing, is quite similar to that for
caspase-3 (38,
39)
.
|
As we have shown, BCR cross-linking induced processing of the
CPP32 family member Mch3 into a p32 subunit that we suppose to be
further proteolyzed. The processing into the p32 subunit, however, did
not appear to involve a classical caspase, as it was not inhibited by
z-VAD-fmk. Further proteolysis of the p32 subunit was caspase
dependent, as it was inhibited by z-VAD-fmk, but did not appear to
involve autoproteolysis since it was not inhibited by the inhibitor of
CPP32-like caspases, Ac-DEVD-CHO. Anti-µ treatment does not induce
activation of caspase-3 and caspase-8 (Fig. 2A
), nor does
BCR cross-linking induce caspase-9 activation or cytochrome
c release from mitochondria (A. Ruiz-Vela, B. Wolf, D. R. Green, C. Martínez-A., unpublished results). Mch3 processing
induced by BCR ligation is thus not mediated by any of these three
caspases. If we induce the caspase-9 pathway by adding cytochrome
c to cytosolic extracts (S-100), however, we observe Mch3
processing similar to that described (Fig. 10A
; A.
Ruiz-Vela, B. Wolf, D. R. Green, C. Martínez-A.,
unpublished results). BCR cross-linking-mediated processing of Mch3
therefore differs from that described, which is induced either by Fas
or by the mitochondria pathway. In fact, caspase processing is
described to vary between cell types, and this difference in processing
may also depend on the type of apoptotic signal induced, suggesting
that the caspase cleavage sites are regulated differently (40)
.
In Fig. 10B
, we illustrate the Mch3 processing model based
on our results. The p35-p32 transition is mediated by a protease
(protease X) or an atypical caspase and is inhibited by CD40 ligation,
but not by Bcl-2 or z-VAD-fmk. The p32 subunit of Mch3 does not appear
to be active since, when processing of this subunit is blocked by Bcl-2
overexpression, there is no proteolysis of the Mch3 substrate, PARP.
Another explanation, however, could be that Bcl-2 prevents PARP
proteolysis through a distinct pathway. Further processing of the p32
subunit appears to be mediated by a caspase that does not belong to the
CPP32 family (caspase Y), and is inhibited by both Bcl-2 and CD40
ligation. Whether this same caspase is also critical for apoptosis is
at present unclear. Proteases such as granzyme B can also cleave Mch3
(41)
; however, WEHI-231 cells do not express granzyme B, making it
unlikely that this protease is responsible for Mch3 processing.
Both Bcl-2 and CD40 ligation inhibit BCR-induced apoptosis. Our results
are in agreement with those published by Honjo's group, showing that
Bcl-2 prevented IgM cross-linking-induced apoptosis (42)
. Moreover,
Bcl-2 abrogated sIg-mediated apoptosis and also blocked clonal deletion
of self-reactive immature B cells (43)
. BCR cross-linking also induces
growth arrest. Whereas z-VAD-fmk, Bcl-2 and CD40 ligation rescue
WEHI-231 cells from BCR-driven apoptosis, only CD40 ligation is able to
prevent BCR-driven growth arrest, suggesting that the pathways for BCR
cross-linking-triggered growth arrest and apoptosis differ. The
mechanisms through which CD40 ligation and Bcl-2 overexpression prevent
cell death triggered by anti-µ in WEHI-231 cells are unknown. CD40
signaling induces Bcl-xL expression, and
mutational analysis of CD40 revealed that the domain of CD40 required
for blocking apoptosis in WEHI-231 cells coincides with that required
for Bcl-xL induction (25)
. Overexpression of
Bcl-xL inhibits anti-µ-induced apoptosis but
not cell cycle arrest, similar to Bcl-2 (25,
27)
. The CD40-mediated
inhibition of BCR cross-linking-induced growth arrest must thus involve
signals other than Bcl-xL.
Bcl-2 and Bcl-xL have been reported to act by
inhibiting cytochrome c release from the mitochondria (44,
45)
. Mitochondrial cytochrome c, which functions as an
electron carrier in the respiratory chain, translocates to the cytosol
in cells undergoing apoptosis, where it participates in the activation
of DEVD-specific caspases (reviewed in ref 46
). It has also been shown
that during apoptosis in intact cells, cytochrome c
translocation was blocked by Bcl-2 but not by the caspase inhibitor
z-VAD-fmk; however, exogenous cytochrome c bypassed the
inhibitory effect of Bcl-2 in vitro. We observed that Bcl-2
overexpression and z-VAD-fmk treatment in WEHI-231 cells prevented
apoptosis and caspase activity, which could lead us to believe that
Bcl-2 may act by blocking cytochrome c translocation to
cytosol. This is not the case, however, since this pathway is not
activated by BCR cross-linking in WEHI-231 cells (A. Ruiz-Vela, B.
Wolf, D. R. Green, C. Martinez-A., unpublished results). Susin et
al. (47)
reported that mitochondria that have undergone the
permeability transition, an event that involves the formation of a
nonspecific channel in the mitochondrial membranes and that is also
blocked by Bcl-2, released the apoptosis-inducing factor (AIF), a 50
kDa protease that acts directly on resuspended nuclei to induce
DNA fragmentation and chromatin condensation. These effects of AIF are
resistant to Ac-DEVD-CHO. We found that IgM-driven apoptosis in
WEHI-231 cells induces changes in 
m (data
not shown). Moreover, we could not prevent cell death induced by
anti-µ using Ac-DEVD-CHO. Altogether, these data suggest that
protease X in our model (Fig. 10)
, responsible for the initial
processing of Mch3, is activated independently of cytochrome
c, whereas the caspase implicated in p32 subunit processing,
caspase Y, displays properties compatible with those described for AIF.
Experiments are presently under way to characterize both of these
enzymes and to elucidate the different mechanisms through which Bcl-2
and CD40 signaling interfere with caspase activation, apoptosis, and
cell cycle progression.
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
Abbreviations: m,
mitochondrial depolarization; Ac-DEVD-CHO, acetyl-Asp-Glu-Val-aspartic
acid aldehyde; Ac-YVAD-cmk, acetyl-Tyr-Val-Ala-Asp-chloromethylketone;
AIF, apoptosis-inducing factor; BCR, B cell receptor; CAD,
caspase-activated deoxyribonuclease; FCS, fetal calf serum; HPLC,
high-performance liquid chromatography; ICE, interleukin
1ß-converting enzyme; IgM, immunoglobulin M; PARP, poly(ADP-ribose)
polymerase; PBS, phosphate-buffered saline; PCR, polymerase chain
reaction; PI, propidium iodide; PO, peroxidase; Rb, retinoblastoma;
SDS-PAGE, sodium dodecyl sulfate-polyacrylamide gel electrophoresis;
z-VAD-fmk, z-Val-Ala-DL-Asp-fluoromethylketone.
Received for publication September 4, 1998.
Revision received December 7, 1998.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
This article has been cited by other articles:
|
|
 |
|
  D. M. Ray, F. Akbiyik, S. H. Bernstein, and R. P. Phipps CD40 Engagement Prevents Peroxisome Proliferator-Activated Receptor {gamma} Agonist-Induced Apoptosis of B Lymphocytes and B Lymphoma Cells by an NF-{kappa}B-Dependent Mechanism J. Immunol., April 1, 2005; 174(7): 4060 - 4069. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Korfali, S. Ruchaud, D. Loegering, D. Bernard, C. Dingwall, S. H. Kaufmann, and W. C. Earnshaw Caspase-7 Gene Disruption Reveals an Involvement of the Enzyme during the Early Stages of Apoptosis J. Biol. Chem., January 9, 2004; 279(2): 1030 - 1039. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W. J. M. Mackus, S. M. A. Lens, R. H. Medema, M. J. Kwakkenbos, L. M. Evers, M. H. J. v. Oers, R. A. W. v. Lier, and E. Eldering Prevention of B cell antigen receptor-induced apoptosis by ligation of CD40 occurs downstream of cell cycle regulation Int. Immunol., September 1, 2002; 14(9): 973 - 982. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. A. Bennin, A. S. A. Don, T. Brake, J. L. McKenzie, H. Rosenbaum, L. Ortiz, A. A. DePaoli-Roach, and M. C. Horne Cyclin G2 Associates with Protein Phosphatase 2A Catalytic and Regulatory B' Subunits in Active Complexes and Induces Nuclear Aberrations and a G1/S Phase Cell Cycle Arrest J. Biol. Chem., July 19, 2002; 277(30): 27449 - 27467. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Huo, R.-H. Luo, S. A. Metz, and G. Li Activation of Caspase-2 Mediates the Apoptosis Induced by GTP-Depletion in Insulin-Secreting (HIT-T15) Cells Endocrinology, May 1, 2002; 143(5): 1695 - 1704. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. J. Herold, A. W. Kuss, C. Kraus, and I. Berberich Mitochondria-Dependent Caspase-9 Activation Is Necessary for Antigen Receptor-Mediated Effector Caspase Activation and Apoptosis in WEHI 231 Lymphoma Cells J. Immunol., April 15, 2002; 168(8): 3902 - 3909. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. L. Hess, J. D. Johnson, and J. M. Cook-Mills Different orders for acquisition of apoptotic characteristics by leukocytes J. Leukoc. Biol., September 1, 2001; 70(3): 405 - 412. |
