FASEB J.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by GARCÍA RATO, A.
Right arrow Articles by RAMOS, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by GARCÍA RATO, A.
Right arrow Articles by RAMOS, S.
(The FASEB Journal. 1999;13:857-868.)
© 1999 FASEB

Research Communications

Melatonin blocks the activation of estrogen receptor for DNA binding

AVELINA GARCÍA RATO*1, JUANA GARCÍA PEDRERO*, M. ARÁNTZAZU MARTÍNEZ{dagger}, BEATRIZ DEL RIO, PEDRO S. LAZO* and SOFÍA RAMOS*

* Departamento de Bioquímica y Biología Molecular, Universidad de Oviedo, 33006 Oviedo, Spain; and
{dagger} Hospital de Jove, 33212 Gijón, Spain

1Correspondence: Departamento de Bioquímica y Biología Molecular. Facultad de Medicina. Universidad de Oviedo, 33006 Oviedo. Spain. E-mail: SRG{at}sauron.quimica.uniovi.es


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The present study shows that melatonin prevents, within the first cell cycle, the estradiol-induced growth of synchronized MCF7 breast cancer cells. By using nuclear extracts of these cells, we first examined the binding of estradiol–estrogen receptor complexes to estrogen-responsive elements and found that the addition of estradiol to whole cells activates the binding of the estrogen receptor to DNA whereas melatonin blocks this interaction. By contrast, melatonin neither affects the binding of estradiol to its receptor nor the receptor nuclear localization. Moreover, we also show that addition of estradiol to nuclear extracts stimulates the binding of estrogen receptor to DNA, but this activation is also prevented by melatonin. The inhibitory effect caused by melatonin is saturable at nanomolar concentrations and does not appear to be mediated by RZR nuclear receptors. The effect is also specific, since indol derivatives do not cause significant inhibition. Furthermore, we provide evidence that melatonin does not interact with the estrogen receptor in the absence of estradiol. Together, these results demonstrate that melatonin interferes with the activation of estrogen receptor by estradiol. The effect of melatonin suggests the presence of a receptor that, upon melatonin addition, destabilizes the binding of the estradiol–estrogen receptor complex to the estrogen responsive element.—Rato, A. G., Pedrero, J. G., Martínez, M. A., del Rio, B., Lazo, P. S., Ramos, S. Melatonin blocks the activation of estrogen receptor for DNA binding.


Key Words: antiestrogen • breast cancer • estradiol • MCF7 cells


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
MELATONIN IS A hormone of indolic nature that is found throughout the evolutive scale from dinoflagellates to humans. In mammals it is produced mainly by the pineal gland, whose function is transducing the changes of environmental lighting into a nighttime pulse of melatonin. The melatonin signal is an important endogenous synchronizer of the diverse circadian rhythms in the organisms, notably those related to the control of seasonal reproductive phenomena (1) . Many effects of this hormone (including its antitumoral action) have been described in a great variety of cells and tissues. It is known that pinealectomy stimulates tumor growth in experimentally induced breast cancer and that conditions favoring pineal function lead to lower incidence and higher regression of mammary tumors in rats (2) . Melatonin has several biological effects that might explain this protective activity: 1) it is an efficient free radical scavenger in vitro and in vivo (3) , 2) it has immunoenhancing properties both in vivo and in vitro (4 5) , and 3) it controls the development and induces the involution in tissues whose growth depends on sexual hormones in seasonal breeding animals (1) .

It has been described that melatonin affects the development of mammary epithelium in mouse, lowering the number of epithelial structures that represent the site of mammary epithelial growth (6) . The growth inhibitory effects could be mediated by a possible influence of the pineal hormone on the hypothalamic-pituitary-gonadal axis. However, melatonin should have a direct effect, since it affects mouse mammary development in whole mammary tissue culture (7) . In addition, it has been shown that melatonin inhibits the growth of MCF7, a cell line derived from a human mammary adenocarcinoma, after 5 to 7 days of growth (8) . It is well established that MCF7 cells have high levels of estrogen receptors (ER)2 and that estradiol stimulates their growth. It has been proposed that melatonin acts as an antiestrogen in MCF7 cells, since it inhibits the expression of estrogen-regulated genes (9) , potentiates the sensitivity of MCF7 to tamoxifen (TMX) (10) , and modulates the transcription of ER in this cell line (11) .

Melatonin (10) , vitamin D3, and retinoic acid (12) share most of these antiestrogenic effects and neither interferes with the binding of estradiol to ER as do the known classic antiestrogens (such as TMX, ICI 164384, and its derivatives (13) . The elucidation of the molecular mechanism that mediates the effects of the noncompetitive antiestrogen agents is very important, since long-term treatment with antiestrogens, such as TMX, is the endocrine therapy of choice for patients whose breast tumors are estrogen dependent (14) . A therapy with a combination of TMX and melatonin has been used as a second line therapy in TMX-resistant human mammary tumors, with some promising result (15) . The aim of this study was to find conditions in which early effects of melatonin could be detected and to characterize the antiestrogenic effects of melatonin at the molecular level.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Materials
Melatonin (N-acetyl-5-methoxytryptamine) and other indol derivatives, 17 ß-estradiol, and TMX were purchased from Sigma (St. Louis, Mo.); [2,4,6,7- 3H]-estradiol (Spec. Act. 96 Ci/mmol) was from Amersham (Amersham, U.K.). Hormones were always dissolved in ethanol.

Plasmids
The ATC2 containing (ERE)2-TATA-CAT reporter plasmid was provided by Dr. Shapiro (16) , pERE-TK-Luc was provided by Dr. Giguere (17) , and pSG5 RZR{alpha} was provided by Dr. Becker-André (18) .

Cell culture
MCF7 cells were propagated in RPMI 1640 medium (BioWhittaker, Walkersville, Md.) containing 100 µg/ml gentamicin, 25 mM HEPES/NaOH, pH 7.3, and 10% heat-inactivated fetal bovine serum (FCS) (Boehringer Mannheim, Mannheim, Germany) in a humidified atmosphere of 5% CO2 at 37°C. Unless otherwise indicated, all experiments were performed in MCF7 cells synchronized by FCS and estrogen depletion. To synchronize the cultures, cells were harvested from stock dishes and cultured in RPMI supplemented with 10% FCS until ~50% confluence. Cells were then washed with phosphate-buffered saline (PBS) and cultured for 3 days in RPMI 1640 phenol red-free medium and 0.5% charcoal/dextran-treated FCS (sFCS). Under these conditions, 93 to 97% of the cells were arrested at the G0/G1 phase. Cells were activated to grow by addition of serum and/or estradiol at the indicated concentrations in the presence or in the absence of melatonin. Control cultures were run in which ethanol was added to obtain the same concentration (0.01%) as that obtained by adding estradiol and/or melatonin.

Cell proliferation assays
MCF7 cells were seeded in 24-multiwell plates containing coverslips (1 x 1 cm) at a density of 30,000 cells per dish. Synchronized cells were stimulated to grow as indicated above. After the appropriate time (12–28 h), cells were incubated for another 2 h in medium containing 100 µM BrdU (19) , rinsed with PBS, fixed with methanol at 4°C, rehydrated with PBS, and incubated with 1.5 M HCl for 30 min to denature DNA. Then they were washed at least three times with PBS to remove and neutralize residual HCl. Coverslips were incubated with a mouse anti-BrdU monoclonal antibody (Becton-Dickinson, Rutherford, N.J.) for 1 h at room temperature, rinsed with PBS, and incubated with rabbit antimouse immunoglobulin G conjugated with FITC (Boehringer Mannheim) for 30 min. Propidium iodide (5 µg/ml) was added and incubated for 10 min at room temperature. Coverslips were mounted on slides with a drop of Fluoromount G (Southern Biotechnic, VWR) and protected from light. The whole population of BrdU-labeled cells was visualized in a Confocal Laser Microscope (Bio-Rad MRC 600) connected to an Image Analysis System. The percentage of cells that incorporated BrdU was determined by screening at least 500 cells in four different areas of each preparation.

Transient transfection assays
MCF7 cells seeded in 60 mm plates were synchronized as described above and transfected with 0.5 µg of the reporter plasmid (Quiagen purified) using lipofectamine (Life Technologies, Inc., Paisley, U.K.) as transfection agent. Liposomes were formed by incubating 0.5 µg of DNA plasmid with 4 µg of lipofectamine for 30 min at room temperature in a total volume of 100 µl of serum-free growth medium. After dilution with 0.8 ml of phenol red-free RPMI, the liposomes were added to the cells, which were incubated 16 h at 37°C. After this incubation, the medium was replaced with phenol red-free RPMI supplemented with 10% sFCS and the appropriate effectors. After another 24 h, the cells were harvested and CAT assays were performed with whole cell extract after normalization for protein concentration (20) . The reaction products were analyzed with an ascending TLC, followed by quantification with an Instantimager (Packard). All experiments were repeated at least three times.

When indicated, cells synchronized at Go/G1 phase in six-well plates were also transfected using the Lipofectamine Plus Reagent from Life Technology with 1 µg of pERE-TK-LUC, 50 ng of pRLTK, and 0.1 µg of pSG5-RZR{alpha} or 0.1 µg of pSG5 as a control. Cells were incubated with 1 ml of RPMI medium without red-phenol and FCS containing the plasmidic DNA plus 6 µl of the Plus Reagent and 4 µl of lipofectamine for 3 h. After that, 1 ml of RPMI medium without red-phenol and with 20% of sFCS was added to the cells and incubation continued for 24 h. Afterward, cells were stimulated during 24 h with 10 nM estradiol and 1 nM melatonin, as indicated. Cell extracts and luciferase determination were performed with the Dual Luciferase System from Promega (Madison, Wis.), as recommended.

Preparation of nuclear and cytosolic extracts
Cells were washed in PBS, pelleted, and resuspended in buffer A containing 10 mM HEPES-KOH pH 7.9, 1.5 mM MgCl2, 10 mM KCl, 5 mM dithiothreitol (DTT), 5 mM phenyl methyl sulfonyl fluoride (PMSF), and protease inhibitors (50 µg/ml antipain, 2 µg/ml aprotinin, 1 µg/ml leupeptin, 1 µg/ml pepstatin A). After 10 min on ice, cells were vortexed and centrifuged for 10 s. The supernatant of this centrifugation was supplemented with EDTA up to 10 mM, KCl up to 120 mM, and glycerol to 20% and designated cytosolic extracts. Pellets were resuspended in an equal volume of buffer C [20 mM HEPES-KOH pH 7.9, 1.5 mM MgCl2, 0.2 mM EDTA, 25% (v/v) glycerol, 0.8 M KCl, and protease inhibitors]. Samples were spun down for 5 min at 10,000 g at 4°C; the supernatant, designated nuclear extracts, were used fresh or stored at -70°C after normalization for protein at 2.5 mg/ml.

Electrophoretic mobility shift assay (EMSA)
Binding of the E2–ER to estrogen response element (ERE) was performed essentially as described (20) . Nuclear or cytosolic extracts (2 µl), containing 5 µg of protein, were mixed with 10 µl of buffer B [20 mM HEPES-KOH, pH 7.9; 10 mM MgCl2, 1 mM EDTA, 10% (v/v) glycerol, 100 mM KCl, 0.2 mM PMSF, 0.2 mM DTT, 0.5% Nonidet P-40 and protease inhibitors] and incubated with 1 µg of poly (dI:dC) in a total volume of 20 µl. Mixtures were preincubated at 0°C for 15 min, followed by incubation with the indicated hormones at 0°C for 10 min. Ethanolic hormone solutions were diluted at the required hormone concentrations in 1% bovine serum albumin containing 10% ethanol, keeping the ethanol concentration at 1% during the assay. Controls were run with the same ethanol concentration (1%) as that obtained by adding estradiol and/or melatonin. The binding reaction was then initiated by adding a [32P] 5' end-labeled synthetic ERE double-stranded oligonucleotide (10 fmol containing 3–5 x 104 dpm) 5' TCGAAAAGTCAGGTCACAGTGACCTGATCAATCGA 3', which corresponds to sequence -338 to -312 of the promoter upstream element of the Xenopus vitellogenin A2 gene (20) . The mix was incubated at 0°C for 1 h, followed by incubation at 20°C for 30 min (20) . The samples were analyzed in a pre-electrophoresed (10 mA for) 5% polyacrylamide gel (acrylamide to bisacrylamide ratio of 40:1) in TBE (45 mM Tris borate and EDTA 1 mM) at 11 mV/cm. After 2–3 h, suitable separation was achieved and the gel was vacuum-dried; an autoradiography was obtained and quantified with an Instantimager (Packard, Downers Grove, Ill.). For specificity assays, different concentrations of unlabeled competitor oligonucleotides were mixed with the labeled probe before adding them to the binding reaction. When indicated, anti-RE monoclonal antibodies NCL-ER-LH1 (Novocastra Lab., Newcastle upon Tyne, U.K.) were added before hormone addition. To determine the stability of the E2–ER–ERE complex, 200-fold molar of unlabeled ERE was added after the 20 min incubation at 20°C and incubation continued for 0, 5, 15, 30, and 45 min at 20°C.

Western blot analysis
Rabbit polyclonal antibodies against the carboxy-terminal region of ER were obtained and used to detect the 66 kDa ER in cytosolic and nuclear extracts (100 µg of protein per assay) after sodium dodecyl sulfate-polyacrylamide gel electrophoresis and detection with the ECL System (Amersham). RZR was detected with rabbit polyclonal antibodies raised against the carboxyl-terminal region of RZR{alpha}.

Ligand binding assays
Estradiol binding to whole MCF7 cells was performed as described previously (22) , using [2,4,6,7-3H]-estradiol. MCF7 cells growing in 24-multiwell plates were synchronized as above and stimulated for 40 min with 10% sFCS without or with 1 nM melatonin. Cells were washed three times with PBS and 1 ml of culture media was added to each well. The binding reaction started with the addition of [3H] estradiol (96 Ci/mol) to obtain concentrations ranging from 0.030 nM to 2 nM with or without a 200-fold excess of diethylstilbestrol to control for unspecific binding. The incubation continued for 30 min, followed by washing with PBS, and the [3H] estradiol bound to the monolayer was extracted overnight with ethanol at 4°C. The radioactivity was determined in the alcoholic extracts. The number of cells was evaluated with sulforhodamine B, a fluorometric protein assay described previously (23) . Fluorescence was determined in a Cytofluor 2300 system (Millipore Corp., Bedford, Mass.). The number of cells was used to normalize the binding values. Affinity and number of binding sites were calculated by Scatchard analysis.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
Effect of melatonin on estradiol-dependent cell proliferation
It has been described that the rate of growth of nonsynchronized MCF7 cells is reduced by melatonin and that this effect is evident after 5 to 7 days in culture (8) . Since the effect of growth factors should become evident at shorter time, we searched for early effects of melatonin. MCF7 cultures were synchronized by serum and estrogen deprivation and then stimulated with sFCS or untreated FCS in the presence and absence of estradiol. The number of cells that reached S phase was evaluated from the incorporation of bromodeoxyuridine, followed by its immunodetection. Six percent sFCS did not induce cell proliferation by itself, but the number of cells that entered S phase reached a value of 30% when this medium was supplemented with 1 nM estradiol. The stimulatory effect of 1 nM estradiol was also detectable in cells growing with 10% FCS. About 30% of the cells entered S phase 20 to 32 h after stimulation with 10% FCS. This value increased up to 55% when the medium was supplemented with 1 nM estradiol (Fig. 1 A). Melatonin (1 nM) did not have any effect in cultures stimulated in the absence of estradiol, but reduced significantly the number of cells that entered S phase in estradiol stimulated cells (Fig. 1B ). Figure 2 shows the results of an experiment that assayed the effect of different melatonin concentrations on the proliferation of MCF7 cells activated by 10% FCS alone or in the presence of 1 nM estradiol. Melatonin showed maximal antiproliferative activity at 1 nM. This is the peak concentration of the pineal hormone during the night. The antiproliferative effect of melatonin was evident only in the culture treated with estradiol (Fig. 2A ). Melatonin (1 nM) inhibited 90% of the estradiol-induced cell proliferation (Fig. 2B ).



View larger version (20K):
[in this window]
[in a new window]
  		Figure 1. Estradiol-induced cell proliferation. Inhibitory effect of melatonin. A) MCF7 cells synchronized by incubation for 3 days in phenol red-free medium containing 0.5% sFCS were activated to grow by addition of 10% FCS ({square}) or 6% sFCS ({circ}) in the presence ({blacksquare}, {bullet}) and absence ({square},{circ}) of 1 nM estradiol. At the indicated times, the percentage of cells that entered S phase was evaluated from the incorporation of BrdU, followed by immunodetection as described in Materials and Methods. Points represent the mean of three experiments (bars, ± ES). 2000–3000 cells were examined in each experimental point. The mean values of proliferation with estradiol were significantly higher than the values without the hormone P < 0.05. B) Cells were synchronized and stimulated as above but in the presence or in the absence of 1 nM melatonin as indicated. The number of cells that reached S phase 26 h after stimulation was determined as in panel A. *P < 0.05 vs. controls.



View larger version (26K):
[in this window]
[in a new window]
  		Figure 2. Effect of melatonin concentration on the growth of MCF7 cells stimulated by FCS and 1 nM estradiol. A) Cells synchronized as in Fig. 1 were activated to grow by addition of 10% FCS ({blacksquare}) or 10% FCS and 1 nM estradiol ({bullet}) in the presence of the indicated concentrations of melatonin (MLT). After 26 h, the percentage of cells that entered S phase was evaluated as in Fig. 1 . *P < 0.05 vs. cells not treated with melatonin. B) Effect of melatonin in estradiol-induced cell proliferation. Estradiol-dependent cell proliferation was calculated from the data represented in panel A. Estradiol-dependent cell proliferation in the absence of melatonin (C) was taken as 100%.

Effect of melatonin on the binding of E2–ER complex to ERE
To determine the mechanism by which melatonin could affect the estrogen signaling pathway, estrogen-dependent binding of ER to the ERE of the Xenopus vitellogenin A2 gene was evaluated in nuclear extracts of MCF7 cells using a gel retardation assay (20) . Cells were synchronized by serum and estrogen deprivation, stimulated for 40 min in 0.5% sFCS plus 10 nM estradiol, or treated only with the vehicle in the presence of the indicated melatonin concentration (Fig. 3 ). Nuclear extracts were obtained and assayed for ERE binding. Cells nonstimulated with estradiol (control) showed low ERE binding activity. The binding activity increased threefold in 10 nM estradiol-treated cells; however, this stimulation was partially blocked in cells treated with estradiol and melatonin. Melatonin showed maximal inhibition of binding when added to the cells at 1 nM. Higher concentrations did not induce greater inhibition of binding (Fig. 3) .



View larger version (32K):
[in this window]
[in a new window]
  		Figure 3. Effect of melatonin on estradiol-dependent binding of ER to ERE. A) MCF7 cells were synchronized as in Fig. 1 and further incubated for 40 min in media containing 0.5% sFCS (lane 1) or 10 nM estradiol in the absence (lane 2) or in the presence of the indicated melatonin concentration (lanes 3–6). After 40 min, nuclear extracts were prepared. To equal amounts of protein (5 µg), estradiol was added to obtain 10 nM in order to optimize ER binding to ERE and assayed for ER binding activity by EMSA, as described in Materials and Methods. B) Quantification binding. The radioactivity in the specific band was determined by electronic autoradiography in an Instantimager analyzer (Packard). The results are expressed as arbitrary units and represent the mean ± SD of five independent experiments. The binding obtained with nuclear extracts of cells stimulated without estradiol was taken as 100 and is shown in black. (**)< 0.05 *P < 0.1, vs. control extracts of cells not treated with melatonin.

The specificity of the retarded band was confirmed by the following criteria: 1) the binding was increased when 10 nM estradiol was added to the nuclear extracts, 2) anti-ER monoclonal antibodies induced a supershift of the ER/ERE complex (Fig. 4 A), and 3) the binding was competed by a 50 molar excess of unlabeled ERE but not by an unrelated DNA sequence (Fig. 4B ).



View larger version (75K):
[in this window]
[in a new window]
  		Figure 4. Specificity and ligand-dependent binding of ER to ERE. A) Synchronized MCF7 cells were stimulated for 40 min in 0.5% sFCS media with 10 nM estradiol or the vehicle. Nuclear extracts were prepared and pretreated with 10 nM estradiol (E2) or an equal volume of solvent (C), as described in Materials and Methods. When indicated (Anti-ER), the extract was preincubated for 10 min at 0°C with the anti-ER monoclonal antibody NCL-ER-P31. Extracts were assayed for ERE binding activity by EMSA. B) Nuclear extracts from MCF7 cells treated with estradiol were incubated with 10 fmol of [32P] ERE and increasing amounts of unlabeled probe (ERE) to obtain the indicated molar ratio (Mr). 100-fold excess of a nonrelated oligonucleotide of similar size containing the serum-responsive element (SRE) was also used.

Melatonin affects neither estradiol binding to ER nor ER translocation to the nucleus
The melatonin-induced inhibition of binding of E2–ER complex to DNA described above could be due to the inhibition of estradiol binding to ER or to a decrease in the steady-state levels of ER. To test these possibilities, [3H] estradiol binding was assayed in synchronized MCF7 cells stimulated with 10% sFCS and 1 nM melatonin. Melatonin did not affect the binding of estradiol to cells (data not shown), which showed a Kd= 0.2 nM and a total number of binding sites of 200,000/cell. The lack of effect of melatonin on estradiol binding to ER has already been shown in nonstarved MCF7 cells (11) . The kinetic parameters of estradiol binding to MCF7 cells are similar to those obtained by other authors (24 25) .

It is generally believed that the ER normally resides within the nucleus. Upon cell homogenization, however, unoccupied receptor leaks out into the cytosolic preparation, whereas ligand-activated receptors are retained in the nuclear fraction (26) . To check whether melatonin could affect ER localization, nuclear and cytosolic extracts from stimulated MCF7 cells were obtained and the binding of the E2–ER complex to DNA was analyzed by EMSA. Should melatonin affect ER localization, a higher binding activity is to be expected in the cytosolic extracts of cells treated with estradiol and melatonin compared with that of cells treated with estradiol. The ERE binding activity did not increase in cytosolic extracts of MCF7 cells treated with estradiol and melatonin (Fig. 5 A) even though the corresponding nuclear extract showed lower binding than those of cells stimulated with estradiol alone. This indicates that melatonin does not affect ER localization. This was further confirmed when the 66 kDa ER was analyzed in cytosolic and nuclear extracts by Western blot. Thus, ER was detected in cytosolic extracts from control cells, whereas it was barely detected in the cytosolic extracts from cells treated with estradiol with or without melatonin (Fig. 5B ). The amount of nuclear ER did not change significantly with any treatment despite the fact that estradiol can increase its binding to ERE up to threefold. These results agree with previous evidences indicating that both unoccupied and occupied ER can be localized in the cell nucleus (21, 26) and strongly favor the concept that treatment of cells with estradiol induces dimerization and possibly modifications of ER, which increase its ability to bind to DNA (13) . It is likely that these processes are those affected when cells are treated with melatonin.



View larger version (56K):
[in this window]
[in a new window]
  		Figure 5. Melatonin does not affect ER localization. A) Nuclear and cytosolic extracts were obtained from synchronized MCF7 cells stimulated for 40 min with sFCS with or without 10 nM estradiol in the presence or the absence of 1 nM melatonin as indicated. Extracts (5 µg protein) were assayed for ERE binding activity as in Fig. 3 . B) Nuclear extracts (100 µg protein) and their corresponding cytosolic extracts were analyzed for ER by Western blot using a polyclonal anti-ER as described in Materials and Methods.

In nuclear extracts melatonin inhibits the binding of E2–ER complex to ERE by decreasing its affinity
We next investigated whether the effects observed on melatonin treatment of cells on E2–ER binding to ERE can also be obtained in cell-free extracts. Nuclear extracts of synchronized estradiol-stimulated cells were assayed for their capacity to bind to ERE in the presence of increasing concentrations of melatonin. The results presented in Fig. 6 show that melatonin inhibits the binding of the E2–ER complex to ERE. The effect was dose dependent and saturable. The inhibition was also specific, since different methoxy- and hydroxy-indols were not effective in inhibiting the binding of E2–ER to the DNA (Table 1 ). To test whether melatonin decreases the affinity of the E2–ER for the ERE, the rate of dissociation of the E2–ER–ERE complex was determined by adding a 200-fold molar excess of unlabeled ERE after the complex was formed. Fig. 7 shows the results obtained after incubation of the complexes formed at 20°C for 0, 5, 15, 30, and 45 min. It is shown that the rate of dissociation of the E2–ER–ERE complex formed in the presence of estradiol (10 nM) and melatonin (1 nM) is considerably faster than that of the complex formed only in the presence of estradiol (10 nM). These results indicate that the presence of melatonin destabilized the binding of E2–ER to DNA.



View larger version (31K):
[in this window]
[in a new window]
  		Figure 6. In vitro effect of melatonin on estradiol-dependent binding of ER to ERE. A) MCF7 synchronized cells were stimulated for 40 min with 0.5% sFCS plus 10 nM estradiol and nuclear extracts were prepared. The ERE binding activity was determined in the presence of 10 nM estradiol and the indicated melatonin concentrations by EMSA. B) Quantification of binding was carried out as in Fig. 3 . The results represent the mean ± SD of 10 independent experiments. Binding activity of nuclear extracts assayed in the absence of estradiol was taken as 100 and is shown in black. *P < 0.05 vs. control extracts not treated with melatonin.


View this table:
[in this window]
[in a new window]
  		Table 1. Effect of different hydroxy- and methoxy-indols on the binding of ER to EREa



View larger version (24K):
[in this window]
[in a new window]
  		Figure 7. Effect of melatonin on the dissociation rate of the E2–ER–ERE complex. A) Nuclear extracts were assayed for ERE binding in the presence 10 nM estradiol or 10 nM estradiol plus of 1 nM melatonin, as described in Fig. 6 . After the E2–ER–ERE complex was formed, 200-fold excess of unlabeled ERE was added and incubation at 20°C was pursued. At the indicated times (min) 20 µl samples were withdrawn and loaded in the electrophoresis gel. Different mobility of the retarded band is due to the different times during which samples have been analyzed by polyacrylamide gel electrophoresis. B) Quantification of the remaining binding of nuclear extracts treated with estradiol ({circ}) or estradiol plus melatonin ({bullet}). The results represent the mean ± SD of three independent experiments taken as 100%, the binding at time 0 min.

Since the AF2 domains on the carboxyl terminus of nuclear receptors are the regions that mediate interaction with many different proteins regulating their activity (27, 28) , we have studied whether the possible melatonin receptor interacts with the HBD/AF2 domain of ER. Pull-down experiments using the glutathion-agarose-GST–HBD/AF2 complex in the presence of nuclear extracts and with [(125) I ] or [3H ]-labeled melatonin showed no binding of melatonin to the AF2 region. On the other hand, the addition of melatonin did not affect the interaction of AF2 with coactivator proteins (data not shown). The lack of effect of melatonin in these pull-down experiments suggests that the melatonin receptor does not bind to the ER AF-2 domain and/or that the interaction of the melatonin receptor with ER needs the whole estrogen receptor.

Melatonin inhibits neither estradiol-independent binding of ER nor TMX-dependent binding of ER to DNA
Previous studies have shown that temperature and ionic environment affect the hormone dependence binding of ER to ERE. Thus, the absence of Mg2+ in the binding buffer renders the process independent of estrogen, whereas 5 mM Mg2+ and the presence of Nonidet P-40 make the binding estrogen-dependent (29) . To study how these conditions could affect the interaction between melatonin and ER; binding experiments were performed using nuclear extracts obtained from synchronized cells stimulated with 10% sFCS. These extracts were treated with melatonin or estradiol in the presence or absence of melatonin. The binding reaction was performed in the absence of Mg2+ and Nonidet P-40 or in the presence of Mg2+ and the detergent. The results indicate that the binding of ER to DNA was independent of estradiol when performed in the absence of Mg2+ and Nonidet P-40, since untreated nuclear extracts as well as those treated with melatonin alone showed the same binding activity as estradiol-treated nuclear extracts (Fig. 8 A, B). Only when both estradiol and melatonin were present in the assay was the binding reduced. As expected, 5 mM Mg2+ and Nonidet P-40 made the binding estrogen dependent and susceptible to inhibition by melatonin. These results indicate that melatonin is unable to interact with the ER in the absence of estradiol. In the presence of estradiol, however, melatonin was able to prevent ER binding to ERE regardless of the assay conditions or whether the nuclear extracts were derived from cells not stimulated with estradiol.



View larger version (46K):
[in this window]
[in a new window]
  		Figure 8. Effect of melatonin on ER–ERE complex under different binding conditions. Nuclear extracts of MCF7 synchronized cells unstimulated with estradiol were pretreated for 10 min at 0°C with no hormones (lanes 1 and 5); 1 nM melatonin (lanes 2 and 6); 10 nM estradiol (lanes 3 and 7); or 10 nM estradiol plus 1 nM melatonin (lanes 4 and 8). Binding activity was determined by EMSA in the absence and presence of 5 mM Mg2+ and Nonidet P-40. B) Quantification of binding was carried out as in Fig. 3 . The results represent the experiment shown in panel A. Similar results were obtained in three independent experiments.

If the effect of melatonin requires estrogen and thus holoconformation of the receptor, it should be expected that melatonin would not destabilize the TMX-dependent binding of ER to the ERE. Figure 9 shows the effect of 1 nM melatonin on nuclear extracts treated with 10 nM estradiol or 10 µM TMX. The results indicate that 10 nM estradiol increased by threefold the binding of ER to ERE, whereas 10 µM of TMX increased the binding twofold. Melatonin inhibited by 40% the E2–ER–ERE complex formation and showed no significant effect on the TMX–ER–ERE complex. The latter complex presented a slightly different mobility on gel electrophoresis, as described previously (29) .



View larger version (27K):
[in this window]
[in a new window]
  		Figure 9. Effect of melatonin on TMX-induced binding of ER to ERE. Nuclear extracts derived of synchronized MCF7 cells unstimulated with estradiol were pretreated for 10 min at 0°C with no hormones, 10 nM estradiol, and 10 µM TMX plus or minus melatonin, as indicated. Binding to ERE was performed as in Figs. 3 4 5 6 with 5 mM MgCl2 and Nonidet P 40. B) Quantification of binding was carried out as in Fig. 3 . The results represent the mean ± SD of three independent experiments taken as 100% binding in the absence of estradiol. *P < 0.05 vs. extracts treated with estradiol without melatonin.

Melatonin inhibition of estradiol-dependent gene expression
Melatonin has been found to modulate the expression of several estrogen-regulated endogenous genes (9) . In this work, we have investigated the effect of melatonin on the expression of a gene selectively regulated by ERE with a minimal (TATA) promoter. For this purpose, we performed transient transfection assays of synchronized MCF7 cells using the plasmid ATC2 that contains the CAT reporter gene under the control of the ERE from the Xenopus vitellogenin A2 gene (16) . The transfected cells were stimulated with 10% sFCS with or without 10 nM estradiol in the presence or absence of 1 nM melatonin. The results presented in Fig. 10 clearly show that melatonin inhibited estradiol-dependent gene expression. The mean inhibition of CAT expression by melatonin in six different experiments was 50.9 ± 11.9% (P<0.05). Similar inhibitory effect of melatonin was observed when estradiol-dependent gene expression was determined in synchronized MCF7 cells transfected with the plasmid pvERE-TK luc (Fig. 11 ).



View larger version (43K):
[in this window]
[in a new window]
  		Figure 10. Effect of melatonin on CAT expression regulated by ERE. Synchronized MCF7 cells were transiently transfected with 0.5 µg of ATC2 containing CAT under the control of an ERE. The transfected cells were stimulated for 24 h with 10% sFCS plus 10 nM estradiol in the presence or absence of 1 nM melatonin, as indicated. Then, cell extracts were prepared and assayed for CAT activity as indicated in Materials and Methods. The figure shows the autoradiography (A) and quantification (B) of a representative experiment. The quantification was carried out as in Fig. 3 . In six independent experiments, melatonin inhibited by 50.9% ± 11.9 (P<0.05) the estradiol-dependent CAT expression.



View larger version (19K):
[in this window]
[in a new window]
  		Figure 11. Effect of RZR{alpha} on estrogen-dependent gene expression. Synchronized MCF7 cells were transfected with 1 µg of pvERE-TK-LUC, 50 ng of pRLTK, and 0.1 µg of pSG5-RZR{alpha} or 0.1 µg of pSG5 as a control. After 24 h in RPMI medium without red-phenol and 10% of sFCS, the cells were stimulated with 10 nM estradiol and 1 nM melatonin as indicated. All data are expressed as arbitrary light units normalized to Renilla luciferase activity.

Effect of RZR{alpha} on the antiestrogenic effect of melatonin
According to the above results, which used nuclear extracts, the melatonin-induced destabilization of E2–ER–ERE complex is specific, saturable, and its interaction with the ER appears to be dependent on the holoconformation of the estrogen receptor, thus suggesting the presence in nuclear extracts of a receptor for melatonin mediating this antiestrogenic effect. It has been proposed that RZR{alpha}, a member of RZR/ROR{alpha} family of nuclear receptors, could be a nuclear receptor for melatonin. We therefore examined the possibility that this protein mediates the above-described effects of melatonin.

If RZR{alpha} mediates the inhibitory effect of melatonin on estradiol-dependent gene expression, it should be expected that expression of RZR in MCF7 cells results in an increase in the inhibitory potency of melatonin. Estradiol-dependent gene expression was assayed on MCF7 cells transiently transfected with the plasmid pSG5-RZR{alpha} or pSG5 expression vector. The results presented in Fig. 11 show that in cells transfected with the control plasmid, melatonin decreased estradiol-dependent luciferase expression. However, in cells transfected with a RZR{alpha} expression vector, basal luciferase expression and the expression induced by estradiol were increased. Melatonin caused an additional increase in estrogen-dependent gene expression. This result clearly indicates that if there is a RZR{alpha}-melatonin complex, it causes stimulation rather than inhibition of estrogen-dependent gene expression. Therefore, it can be concluded that the antiestrogenic effect of melatonin is not mediated by RZR{alpha}.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
The antiproliferative effect of melatonin on MCF7 cells has been a useful model with which to study the antiestrogenic effect of melatonin (8 9 10 11, 15) . The aim of the present study was to characterize the effect of melatonin on the estrogen-responsive pathway at the molecular level. We first determined the growth conditions in which an early antiproliferative effect of melatonin could be demonstrated. Using MCF7 synchronized cells, it was observed that 1 nM estradiol was required to promote proliferation in cells treated with 6% sFCS as well as to increase the rate of proliferation on cells stimulated with 10% whole FCS. These results indicate that the estradiol present in FCS was not enough to promote high MCF7 cell proliferation. We also observed that melatonin (1 nM) interferes with this effect of estradiol on proliferation. Thus, estrogen-dependent DNA synthesis was virtually abolished by melatonin within the first cell cycle poststimulation, which represents an earlier effect than that observed by other groups using the same cell line (8) . These results suggest that our working procedure, though less sensitive than others (8) , is able to analyze a process highly dependent on estradiol such as that studied in the present work.

We have also shown that melatonin concentrations higher than 1 nM exhibit lower inhibitory effect on cell proliferation than that observed at physiological concentrations during the night (1 nM). Although similar observations have been made by others, no explanation has been provided to justify this biphasic behavior (8, 11) . Biological effects of melatonin are explained by several mechanisms, some mediated by high-affinity receptors (18, 30 31 32 33) , in which melatonin is acting like a hormone, and low-affinity processes involving the free radical scavenger activity of melatonin. This is a nonenzymatic antioxidative defense against oxidative damage of biomolecules caused by melatonin. (3) . The high-affinity receptor proposed in this paper would mediate the destabilization of the E2–ER binding to DNA and, hence, would impair the estrogen mitogenic activity. The low-affinity protective mechanism might explain that high concentrations of melatonin would compensate the inhibitory effect mediated by the high-affinity melatonin receptor(s). In this way, melatonin could prevent free radical cell damage due to estrogen metabolism, as recently postulated (34) .

The present study extends previous data indicating that nuclear extracts from estrogen-starved MCF7 cells stimulated with estradiol showed a higher ERE binding activity than those from cells not stimulated with estrogen (21) . We have found that this estradiol-dependent ER-activation was prevented by treatment of the cells with melatonin. Neither nuclear localization of ER nor binding of estradiol to ER are affected by melatonin. The lack of melatonin effect on binding of estradiol indicates that modulation of ER expression by melatonin (11) is not the cause of this inhibitory effect of melatonin, indicating that melatonin seems to inhibits the estrogen signaling pathway. As an additional consequence, it would be expected that estradiol-dependent transcription would be affected by melatonin. The results presented in this work clearly show that melatonin inhibits the estrogen-dependent expression of a reporter gene. This antiestrogenic effect of melatonin could be explained as a consequence of the destabilization of E2–ER complex binding to DNA by melatonin. Nevertheless, it cannot be excluded that the antiestrogenic effect of melatonin is due to its down-regulatory effect on ER expression described previously (11) .

It is known that estrogens activate different kinases that cause ER phosphorylation at various serines (35, 36) , resulting in an increase on ER binding to DNA and subsequently the trans-activation activity of ER. It is conceivable that melatonin destabilizes the E2–ER–ERE complex by affecting the phosphorylation of ER. However, the inhibitory effect of melatonin is observed both in nuclear extracts derived from cells treated with estrogen (Figs. 6 and 7) and in extracts from untreated cells (Figs. 8, 9) . These results suggest that estradiol-induced phosphorylation of ER is not required for melatonin to destabilize the E2–ER–ERE complex. Moreover, we and other authors (21) have demonstrated that estradiol added to nuclear extracts increases the binding of ER to ERE. This activation of ER by estradiol cannot be dependent on ER phosphorylation, since neither ATP nor the ATP regeneration system was present during that incubation, which strongly suggests that the effect of melatonin is not due to inhibition of ER phosphorylation.

Addition of estradiol to MCF7 nuclear extracts increases ER binding to ERE. Melatonin impairs this activation by destabilizing the E2–ER–ERE complex (Fig. 7) . This effect is saturable, specific, and dependent on estradiol, indicating that an estradiol-induced conformational change of ER appears to be necessary to interact with melatonin. It is important to point out that the TMX–ER–ERE complex is not destabilized by melatonin. All these results suggest the presence in the nuclear extracts of a high-affinity receptor for melatonin, which in the presence of melatonin is able to interact and destabilizes the complex E2–ER from binding to DNA.

Several proteins have been reported to be able to bind melatonin at the nanomolar range: 1) the membrane-bound, GI-coupled melatonin receptors (Mel1A and Mel1B), which cannot be directly implicated in the antiestrogenic effect of melatonin determined in nuclear extracts (30 31) , 2) the RZR (18) , and 3) calmodulin (32, 33) . MCF7 breast cancer cells express the RZR receptor, which has been proposed as a nuclear receptor for melatonin. However, RZR{alpha} does not appear to mediate the antiestrogenic effect of melatonin, since overexpression of RZR{alpha} results in stimulation rather than an inhibition of estradiol-dependent gene expression.

However, in conditions where we could demonstrate antiestrogenic effects of melatonin, we did not find an effect of melatonin either on RZR binding to the DNA or in the RZR-dependent gene expression. These results suggest that the antiestrogenic effects of melatonin are not mediated by RZR. Steroid receptors are known to bind to DNA as homodimers (13) . Recently, however, it has become clear that steroid receptors as well as thyroid and retinoid receptors might present cross-talk with transcription factors such as AP-1 or with other members of the nuclear receptor family (12, 38 39 40) . Thus, vitamin D3 and retinoic acid present antiestrogenic effects on MCF7 cells similar to those described for melatonin (i.e., inhibition of cell proliferation, potentiation of TMX effect, and inhibition of E2-dependent expression of intrinsic or reporter genes) (12, 38) . Negative transcriptional effects may be exerted by these receptors through different mechanisms: 1) competition between receptors acting on the same DNA sequence; thus, the thyroid hormone receptor competes with ER for binding to the palindromic ERE (39) , and 2) destabilizing the binding of the hormone–receptor complex to DNA by two possible methods, either competition for nonspecific transcription factors (41) or formation of nonfunctional heterodimeric proteins (42) .

One potential candidate to mediate the described antiestrogenic effects of melatonin could be calmodulin. Several lines of evidence lend support to this proposal. ER has a calmodulin binding site and interaction of ER and calmodulin has been known for several years (43, 44) . In addition, inhibitors of calmodulin decrease the affinity of ER for its ligand as well as the stability of binding of E2–ER to DNA (44) . Moreover, a number of antagonists of calmodulin exhibit antiestrogenic activity (45) . On the other hand, it has been shown that melatonin binds to calmodulin in a Ca2+-dependent fashion, resulting in inhibition of calmodulin (32 33) . This mechanism has recently been proposed as a mediator of the inhibitory effects of melatonin on nitric oxide synthase activity in rat cerebellum and hypothalamus (46) . The effect of antagonists of calmodulin does not appear to be restricted to the estrogen receptor, since other steroid receptors are also regulated by this calcium binding protein (47) . This fact could contribute to explain the pleiotropic effects of melatonin on other steroid hormone receptors, including glucocorticoid (48) and testosterone receptors (49) . Additional studies are needed to provide experimental evidence to the proposal that calmodulin is involved in the antiestrogenic effect of melatonin in mammalian cells.


   ACKNOWLEDGMENTS
 
This work was supported by grants from Fundación Ramón Areces and from CICYT SAF/96–0132. A.G.R. was the recipient of fellowships from the Universidad de Oviedo, Junta Provincial de Asturias de la Asociación Española Contra el Cáncer, and the Fundación Científica de la Asociación Española Contra el Cáncer. We would like to thank Drs. Carlos Lopez-Otín and Juan M. Guerrero for helpful comments, Dr. David Shapiro for providing ATC2, Dr. V. Giguère for providing pERE-TK-Luc, and Dr. Becker-André for providing pSG5 RZR{alpha}.


   FOOTNOTES
 
2 Abbreviations: DTT, dithiothreitol; E2, 17 ß-estradiol; EMSA, electrophoretic mobility shift assay; ER, estrogen receptor; ERE, estrogen response element; PBS, phosphate-buffered saline; PMSF, phenyl methyl sulfonyl fluoride; RZR{alpha}, orphan receptor retinoid Z; sFCS, charcoal/dextran-treated fetal bovine serum; TBE, 45 mM Tris borate and EDTA 1 mM; TMX, tamoxifen.

Received for publication May 27, 1998. Revision received December 22, 1998.
   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Reiter, R. J. (1980) The pineal and its hormones in the control of reproduction. Endocr. Rev. 1,109-131[Medline]
  2. Cos, S., Garijo, F., Corral, J., Mediavilla, M. D., Sánchez-Barceló, E. J. (1989) Histopathologic features of DMBA-induced mammary tumors in blind-underfeed, blind-anosmic, and blind cold-exposed rats: influence of the pineal gland. J. Pineal Res. 6,221-231[Medline]
  3. Reiter, R. J., Poeggeler, B., Tan, D. X., Chen, L. D., Mancherter, L. C., Guerrero, J. L. (1993) Antioxidant capacity of melatonin: a novel action not requiring receptor. Neuroendocrinol. Lett. 15,103-116
  4. Maestroni, J. M. G., Conti, A., Lissoni, P. (1994) Colony-stimulating activity and hematopoietic rescue from cancer chemotherapy compounds are induced by melatonin via endogenous interleukin 4. Cancer Res 54,4740-4743[Abstract/Free Full Text]
  5. Morrey, K. M., Mclachlan, J. A., Serkin, C. D., Baouche, O. (1994) Activation of human monocytes by pineal hormone melatonin. J. Immunol. 153,2671-2679[Abstract]
  6. Mediavilla, M. D., San Martin, M., Sanchez-Barcelo, E. J. (1992) Melatonin inhibits mammary gland development in female mice. J. Pineal Res. 13,13-19[Medline]
  7. Sánchez-Barceló, E. J., Mediavilla, M. D., Allen Tucker, H. (1990) Influence of melatonin on mammary gland growth: in vivo and in vitro studies. Proc. Soc. Exp. Biol. Med. 194,103-107[Abstract]
  8. Hill, S. M., Blask, D. E. (1988) Effects of the pineal hormone melatonin on the proliferation and morphological characteristics of human breast cancer cells (MCF7) in culture. Cancer Res 48,6121-6126[Abstract/Free Full Text]
  9. Molis, T. M., Spriggs, L. L., Hill, S. M. (1994) Melatonin modulation of estrogen-regulated proteins, growth factors, and proto-oncogenes in human breast cancer. J. Pineal Res. 18,93-103
  10. Wilson, S. T., Blask, D. E., Lemus-Wilson, A. M. (1992) Melatonin augments the sensitivity of MCF7 human breast cancer cells to tamoxifen in vitro. J. Clin. Endocrinol. Metab. 75,669-670[Abstract]
  11. Mollis, T. M., Walters, M. R., Hill, S. M. (1994) Modulation of estrogen receptor mRNA expression by melatonin in MCF7 human breast cancer cells. Mol. Endocrinol. 8,1681-1690[Abstract]
  12. Demirpierce, E., Balaguer, P., Trouse, F., Nicolas, J. C., Pons, M., Gagne, D. (1994) Antiestrogenic effects of all-trans-retinoic acid and dihydroxyvitamin D3 in breast cancer cells occurs at the estrogen response element level but through different molecular mechanism. Cancer Res 54,1458-1464[Abstract/Free Full Text]
  13. Green, S., Chambon, P. (1991) The oestrogen receptor: from perception to mechanism. Parker, M. G. eds. Nuclear Hormone Receptors ,15-38 Academic Press San Diego, California.
  14. Jordan, V. C. (1990) Tamoxifen for the prevention of breast cancer. de Vita, Jr Hellman, S. Rosenberg, S. A. eds. Cancer Prevention ,1-12 J. B. Lippincott Co Philadelphia.
  15. Lissoni, P., Barni, S., Meregalli, S., Fossati, V., Cazzaniga, M., Esposoti, D., Tancini, G. (1995) Modulation of cancer endocrine therapy by melatonin: a phase II study of tamoxifen plus melatonin in metastatic breast cancer patients progressing under tamoxifen alone. Br. J .Cancer 71,854-856[Medline]
  16. Chang, T. C., Nardull, A. M., Lew, D., Shapiro, D. J. (1992) The role of estrogen response elements in expression of the Xenopus laevis vitellogenin B1 gene. Mol. Endocrinol. 6,346-354[Abstract]
  17. Tremblay, G. B., Tremblay, A., Labrie, F., Giguere, V. (1998) Ligand-independent activation of the estrogen receptors alpha and beta by mutations of a conserved tyrosine can be abolished by antiestrogens. Cancer Res 58,877-881[Abstract/Free Full Text]
  18. Carlberg, C., Huijsduijnen, R. H. V., Staple, J., DeLamarter, J. F., Becker-André, M. (1994) RZRs a new family of retinoid-related orphan receptors that function as both monomers and homodimers. Mol. Endocrinol. 8,757-770[Abstract]
  19. Migliaccio, S., Wetsel, W., Fox, W. M., Washburn, T. F., Korach, K. S. (1993) Endogenous protein kinase-C activation in osteoblasts-like cells modulates responsiveness to estrogen and estrogen receptor levels. Mol. Endocrinol. 7,1133-1143[Abstract]
  20. Luckow, B., Schutz, G. (1987) CAT constructions with multiple unique restriction sites for the functional analysis of eukaryotic promoters and regulatory elements. Nucleic Acid Res 10,5490-5495
  21. Kumar, V., Chambon, P. (1988) The estrogen receptor binds tightly to its responsive element as a ligand-induced homodimer. Cell 55,145-156[Medline]
  22. Danforth, D. N., Jr, Tamarkin, L., Lippman, M. E. (1983) Melatonin increases oestrogen receptor binding activity of human breast cancer cells. Nature (London) 305,323-325[Medline]
  23. Skehan, P., Storeng, R., Scudiero, D., Monks, A., McMahon, J., Vistica, D., Warren, J., Bokesch, H., Kenney, S., Boyd, M. R. (1990) New colorimetric cytotoxicity assay for anticancer-drug screening. J. Natl. Cancer Inst. 82,1107-1112[Abstract/Free Full Text]
  24. Tora, L., White, J., Brou, C. (1989) The human estrogen receptor has two independent nonacidic transcriptional activation functions. Cell 59,477-487[Medline]
  25. Weis, K. E., Ekena, K., Thomas, J. A., Lazennec, G., Katzenellenbogen, B. S. (1996) Constitutively active human estrogen receptors containing amino acid substitutions for tyrosine 537 in the receptor protein. Mol. Endocrinol. 10,1388-1398[Abstract]
  26. Murdoch, F. E., Gorski, J. (1991) The role of ligand in estrogen receptor regulation of gene expression. Mol. Cell. Endocrinol. 78,C103-C108[Medline]
  27. Halachmi, S., Marden, E., Martin, G., MacKay, H., Abbondanza, C., Brown, M. (1994) Estrogen receptor-associated proteins: possible mediators of hormone-induced transcription. Science 264,1455-1458[Abstract/Free Full Text]
  28. Cavailles, V., Dauvois, S., L'Horset, F., Lopez, G., Hoare, S., Kushner, P. J., Parker, M. G. (1995) Nuclear factor RIP140 modulates transcriptional activation by the estrogen receptor. EMBO J 14,3741-3751[Medline]
  29. Brown, M., Sharp, P. A. (1990) Human estrogen receptor forms multiple protein-DNA complexes. J. Biol. Chem. 263,11238-11243
  30. Godson, C., Reppert, S. M. (1997) The Mel1a melatonin receptor is coupled to parallel signal transduction pathways. Endocrinology 138,397-404[Abstract/Free Full Text]
  31. Conway, S., Drew, J. E., Canning, S. J., Barrett, P., Jockers, R., Strosberg, D., Guardiola-Lemaitre, B., Delagrange, P., Morgan, P. J. (1997) Identification of Mel1a melatonin receptors in the human embryonic kidney cell line HEK293: evidence of G-protein-coupled melatonin receptors which do not mediate the inhibition of stimulated cyclic AMP levels. FEBS Lett 407,121-126[Medline]
  32. Benitez-King, G., Huerto-Delgadillo, L., Anton-Tay, F. (1991) Melatonin modifies calmodulin levels in MDCK and N1E-115 cell lines and inhibits phosphodiesterase activity in vitro. Brain Res 557,289-292[Medline]
  33. Romero, M. P., García-Pergadeña, A., Guerrero, J. M., Osuna, C. (1998) Membrane-bound calmodulin in X. laevis oocytes as a novel binding site for melatonin. FASEB J 12,1401-1408[Abstract/Free Full Text]
  34. Cavalieri, E. L., Stack, D. E., Devanesan, P. D., Todorovic, R., Dwivedy, I., Higginbotham, S., Johansson, S. L., Patil, K. D., Gross, M. L., Gooden, J. K., Ramanathan, R., Cerny, R. L., Rogan, E. G. (1997) Molecular origin of cancer: catechol estrogen-3,4-quinones as endogenous tumor initiators. Proc. Natl. Acad. Sci. U. S. A. 94,10937-10942[Abstract/Free Full Text]
  35. Joel, P. B., Traish, A. M., Lannigan, D. A. (1998) Estradiol-induced phosphorylation of serine 118 in the estrogen receptor is independent of p42/p44 mitogen-activated protein kinase. J. Biol. Chem. 273,13317-13323[Abstract/Free Full Text]
  36. Castano, E., Vorojeikina, D. P., Notides, A. C. (1997) Phosphorylation of serine-167 on the human oestrogen receptor is important for oestrogen response element binding and transcriptional activation. Biochem. J. 326,149-157
  37. Samuels, M. L., Weber, M. J., Bishop, J. M., McMahon, M. (1993) Conditional transformation of cells and rapid activation of the mitogen-activated protein kinase cascade by an estradiol-dependent human raf-1 protein kinase. Mol. Cell. Biol. 13,6241-6252[Abstract/Free Full Text]
  38. Pratts, M. A. C., Deonarine, D., Teixeira, C., Novosad, D., Tate, B. F., Grippo, J. F. (1996) The AF-2 region of the retinoic acid receptor {alpha} mediates retinoic acid inhibition of estrogen receptor function in breast cancer cells. J. Biol. Chem. 271,20346-20352[Abstract/Free Full Text]
  39. Glass, C. K., Holloway, J. M., Devary, O. V., Rosenfeld, M. G. (1988) The thyroid hormone receptors binds with opposite transcriptional effects to a common sequence motif in thyroid hormone and estrogen responsive elements. Cell 54,313-323[Medline]
  40. Beato, M., Herrlich, P., Schülz, G. (1995) Steroid hormone receptors: many actors in search of a plot. Cell 83,851-857[Medline]
  41. Meyer, M. E., Gronemeyer, H., Turcotte, B., Bocquel, M-T., Tasset, D., Chambon, P. (1989) Steroid hormone receptors compete for factors that mediate their enhancer function. Cell 37,432-442
  42. Segars, J. H., Marks, M. S., Hirschfeld, S., Driggers, P. H., Martinez, E., Grippo, J. F., Wahli, W., Ozato, K. (1993) Inhibition of estrogen-responsive gene activation by the retinoid X receptor ß: evidence for multiple inhibitory pathways. Mol. Cell. Biol. 13,2258-2268[Abstract/Free Full Text]
  43. Castoria, G., Migliaccio, A., Nola, E., Auricchio, F. (1988) In vitro interaction of estradiol receptor with Ca2+-calmodulin. Mol. Endocrinol. 2,167-174[Abstract]
  44. Bouhoute, A., Leclercq, G. (1995) Modulation of estradiol and DNA binding to estrogen receptor upon association with calmodulin. Biochem. Biophys. Res. Commun. 208,748-755[Medline]
  45. Hardcastle, I. R., Rowlands, M. G., Houghton, J., Jarman, M. (1996) Homologs of idoxifene: variation of estrogen receptor binding and calmodulin antagonism with chain length. J. Med. Chem. 39,999-1004[Medline]
  46. Pozo, B. I., Reiter, R. J., Calvo, J. R., Guerrero, J. M. (1997) Inhibition of cerebellar nitric oxide synthase and cyclic GMP production by melatonin via complex formation with calmodulin. J. Cell. Biochem. 65,430-442[Medline]
  47. Yang-Min, N., Sánchez, E. R. (1996) In vivo evidence for the generation of a glucocorticoid receptor heat shock protein-90 complex incapable of binding hormone by the calmodulin antagonist phenoxybenzamine. Mol. Endocrinol. 10,14-23[Abstract]
  48. Sainz, R. M., Mayo, J. C., Uría, H., Kotler, M., Antolin, I., Menendez-Pelaez, A. (1995) The pineal hormone prevents in vivo and in vitro apoptosis in thymocytes. J. Pineal Res 19,178-188[Medline]
  49. Gilad, E., Matzkin, H., Zisapel, N. (1997) Interplay between sex steroids and melatonin in regulation of human benign prostate epithelial cell growth. J. Clin. Endocrinol. Metab. 82,2535-2541[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 Integr Cancer TherHome page
V. Srinivasan, D W. Spence, S. R. Pandi-Perumal, I. Trakht, and D. P. Cardinali
Therapeutic Actions of Melatonin in Cancer: Possible Mechanisms
Integr Cancer Ther, September 1, 2008; 7(3): 189 - 203.
[Abstract] [PDF]

Home page
 EndocrinologyHome page
D. M. Presman, E. Hoijman, N. R. Ceballos, M. D. Galigniana, and A. Pecci
Melatonin Inhibits Glucocorticoid Receptor Nuclear Translocation in Mouse Thymocytes
Endocrinology, November 1, 2006; 147(11): 5452 - 5459.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
B. del Rio, J. M. G. Pedrero, C. Martinez-Campa, P. Zuazua, P. S. Lazo, and S. Ramos
Melatonin, an Endogenous-specific Inhibitor of Estrogen Receptor {alpha} via Calmodulin
J. Biol. Chem., September 10, 2004; 279(37): 38294 - 38302.
[Abstract] [Full Text] [PDF]