FASEB J. Uncover Your Biological Pathway
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by DEISSLER, H.
Right arrow Articles by RAJEWSKY, M. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by DEISSLER, H.
Right arrow Articles by RAJEWSKY, M. F.
(The FASEB Journal. 1999;13:657-666.)
© 1999 FASEB


Research Communications

Neural cell surface differentiation antigen gp130RB13-6 induces fibroblasts and glioma cells to express astroglial proteins and invasive properties

HELMUT DEISSLERa, SABINE BLASS-KAMPMANNa, ERIK BRUYNEELb, MARC MAREELb and MANFRED F. RAJEWSKYa,*


a Institute of Cell Biology (Cancer Research), University of Essen Medical School, D-45122 Essen, Germany; and

b Laboratory of Experimental Cancerology, Department of Radiotherapy and Nuclear Medicine, University Hospital, 3-9000 Ghent, Belgium


   ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Transient expression of the differentiation and tumor cell surface antigen gp130RB13-6 characterizes a subset of rat glial progenitor cells susceptible to ethylnitrosourea-induced neurooncogenesis. gp130RB13-6 is as a member of an emerging protein family of ecto-phosphodiesterases/nucleotide pyrophosphatases that includes PC-1 and the tumor cell motility factor autotaxin. We have investigated the potential role of gp130RB13-6 in glial differentiation by transfection of three cell lines of different origin that do not express endogenous gp130RB13-6 (NIH-3T3 mouse fibroblasts; C6 and BT7Ca rat glioma cells) with the cDNA encoding gp130RB13-6. The effect of gp130RB13-6 expression was analyzed in terms of overall cell morphology, the expression of glial cell-specific marker proteins, and invasiveness. Transfectant sublines, consisting of 100% gp130RB13-6-positive cells, exhibited an altered, bipolar morphology. Fascicular aggregates of fibroblastoid cells subsequently developed into mesh-like patterns. Contrary to the parental NIH-3T3 and BT7Ca cells, the transfectant cells invaded into collagen type I. As shown by immunofluorescence staining of the transfectant sublines as well as of primary cultures composed of gp130RB13-6-positive and -negative cells, expression of gp130RB13-6 induced coexpression of proteins typical for glial cells and their precursors, i.e., glial fibrillary acidic protein, the low affinity nerve growth factor receptor, and the neural proteins Thy-1, Ran-2, and S-100. In accordance with its expression in the immature rat nervous system, gp130RB13-6 may thus have a significant role in the glial differentiation program and its subversion in neurooncogenesis.—Deissler, H., Blass-Kampmann, S., Bruyneel, E., Mareel, M., Rajewsky, M. F. Neural cell surface differentiation antigen gp130RB13-6 induces fibroblasts and glioma cells to express astroglial proteins and invasive properties.


Key Words: glial cells • astrocytes • GFAP • invasion • neurooncogenesis


   INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
ASTROCYTE MORPHOGENESIS and differentiation depend on cell–cell interactions and are intimately associated with the expression of glial fibrillary acidic protein (GFAP)1 (1) . The nature of regulatory molecules that direct pluripotent neural precursor cells to glial lineages is unclear. Various cytokines and hormones affect GFAP expression (as reviewed in ref 2 ) via cAMP and protein kinase C signaling pathways (3) .

The cell surface antigen gp130RB13-6 is transiently expressed during rat brain development by a small (~8%) subset of neural precursor cells capable of differentiating into radial glia-like cells, astrocytes, and ependymal cells in vitro (4) . Precursor cells expressing gp130RB13-6 are distributed in a characteristic spatiotemporal pattern in the germinal layers of the ventricular zones of the immature rat brain. In these zones, glioblast derived from neuroepithelial germinal cells begin their migration to extraventricular sites and give rise to the different types of glial cells. gp130RB13-6-expressing precursor cells are considered targets for the carcinogen N-ethyl-N-nitrosourea (EtNU); indeed, most neuroectodermal tumors induced by EtNU in the rat express this antigen (5 , 6 ). cDNA cloning (7) has identified gp130RB13-6 as a member of a new protein family of phosphodiesterases/nucleotide pyrophosphatases (PDEs) (reviewed in ref 8 ) that includes PC-1 (9 , 10 ) and the tumor cell motility-stimulating exophosphodiesterase autotaxin (ATX) (11, 12; Fig. 1 ). Recently, a protein exclusively expressed apically by rat hepatocytes, the B10 antigen, was found to be identical with gp130RB13-6 (13) , and the cDNA of the human homologue of gp130RB13-6 has been characterized (14) .



View larger version (18K):
[in this window]
[in a new window]
 
Figure 1. The PC-1 protein family (see ref 8 for review). SOM: somatomedin B-like domains; CAT: catalytic domain of phosphodiesterases/nucleotide pyrophosphatases; CA: Ca2+-binding EF-hand domain; ATP: putative Mg-ATP binding site. Asterisk indicates RGD-tripeptide; triangle: identified site of proteolytic cleavage leading to soluble protein. Spacing lines were used to arrange homologous regions between members of the protein family.

The present study was performed to functionally characterize rat gp130RB13-6 with respect to its involvement in glial cell differentiation and its subversion in neurooncogenesis. To investigate the function of gp130RB13-6, we have transfected the complete cDNA encoding gp130RB13-6 under the control of the cytomegalovirus (CMV) promoter into three different recipient cell lines (NIH-3T3, BT7Ca, and C6) that do not express endogenous gp130RB13-6. Induction of the expression of GFAP and other neural marker molecules, characteristic alteration of morphology, and the acquisition of collagen I invasiveness were observed.


   MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Culture of cell lines and double-immunofluorescence staining
Immortalized mouse NIH-3T3 fibroblasts (ATCC #CRL1658), rat C6 glioma cells (ATCC #CCL107), tumorigenic neuroectodermal BT7Ca cells (15) , human MCF-7/AZ mammary carcinoma cells (16) , and rat DHD-FIB myofibroblasts derived from a chemically induced colon cancer (17) were grown in monolayer culture. NIH-3T3, C6, and BT7Ca cells were cultured as previously described (4) . MCF-7/AZ cells were grown in a 1:1 mixture of DMEM and HAM-F12 medium, and DHD-FIB cells in HAM-F10 medium, both supplemented with 10% fetal calf serum, streptomycin, and penicillin.

For double-immunofluorescence analyses, cells were seeded onto glass coverslips at a density of 5 x 103/cm2. Staining with monoclonal antibody (mAb) RB13-6 (18) and antibodies specific for the marker molecules GFAP (Dakopatts, Hamburg, Germany), LNGFR (Boehringer Mannheim, Mannheim, Germany), Ran-2 (a gift from Dr. M. C. Raff, London, U.K.), S-100 (Bio Trend, Cologne, Germany), and Thy-1.1 (Biermann, Bad Nauheim, Germany) was performed as previously described in detail (4) .

Construction of the plasmid for expression of gp130RB13-6
Lambda gt11-derived EcoRI fragments of the isolated cDNA (bp 212-2197, bp 2198-2762; ref 7 ) were cloned into the EcoRI site of pBluescript SK (+) (Stratagene, Heidelberg, Germany), resulting in plasmids pG9I and pG9II, respectively. The polymerase chain reaction (PCR) product containing the 5'-end of the cDNA (bp 1-393) was cloned into the SrfI site of pCR Script SK (+) (Stratagene) according to the supplier's protocol, giving plasmid p510. To remove the terminal linker sequence, a BamHI/BspEI fragment was generated by partially digesting pG9I with BspEI and cutting the isolated 4.9 kb fragment with BamHI. This fragment was ligated to the BspEI/BamHI fragment generated by PCR (primer FHind: AAGCTTTTCTGGCTAAACAGGTTTACACAGC; primer R2: ATCCGCACAGGAACAGAGGGC) from plasmid p510. The cDNA was then completed by insertion of the 3'-EcoRI fragment from pG9II, resulting in plasmid pCOMP, which contained the complete cDNA flanked by two HindIII sites. These sites were used to insert the complete cDNA into the expression vector pRc/CMV (Invitrogen, Leek, The Netherlands), resulting in plasmid pRc136 used for the transfection experiments. The sequence of the PCR-derived 5' region was confirmed by DNA sequencing.

Transfection and enrichment of gp130RB13-6-positive cells
Transfection of NIH-3T3, BT7Ca, and C6 cells using lipofectamine (Life Technologies, Eggenstein, Germany) was performed according to the manufacturer's protocol. After 3 days, transfection efficiency was analyzed by flow cytometry (FCM, see below) and the cells were transferred into medium containing 500 µg/ml (NIH-3T3 and BT7Ca cells) or 800 µg/ml (C6 cells) of Geneticin (Sigma, Deisenhofen, Germany). Geneticin-resistant cells were analyzed for gp130RB13-6 expression by FCM and most intensely stained cells (1–5% of cell of the total population) were isolated by fluorescence-activated cell sorting. Sorted gp130RB13-6-positive cells were recultivated and, after two to four passages, subjected to the next step of enrichment. Three sorting cycles resulted in cell lines 3T3-136, BT7-136, and C6-136, each composed of 100% gp130RB13-6-expressing cells.

Flow cytometry (FCM)
FCM analyses were performed as previously described (4 , 5 ). Enrichment of gp130RB13-6-positive cells after transfection was performed by fluorescence-activated cell sorting. Single immunostained cells exhibiting strong mAb RB13-6-defined fluorescence signals were separated and collected in phosphate-buffered saline (PBS) containing 20% fetal calf serum. Sorted cells were immediately transferred into culture medium and maintained under standard conditions.

Western blots
Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and Western blots were performed as previously described (19) . Cells cultivated in petri dishes were collected in PBS, counted, and solubilized at a density of 107 cells/ml either in SDS-PAGE sample buffer (10 min at 90°C) or by incubation for 1 h at 4°C in PBS containing 50 mM n-octylglucoside (USB, Bad Homburg, Germany) and protease inhibitors (0.5 mM Pefabloc, Roth, Karlsruhe, Germany; 10 µg/ml aprotinin, Sigma).

Collagen invasion assay and colony morphology in collagen I
The collagen type I invasion assay was performed as previously described in detail (20) . Briefly, 105cells were seeded on top of a 0.09% collagen I (UBI, Lake Placid, N.Y.) gel. After 24 h of incubation at 37°C, invasion was scored on living cells with a computer-controlled step motor. The percentage of invading cells was recorded as well as the mean depth of invasion. Photographs were taken and cell morphology on top of collagen I was documented.

For analysis of colony morphology in collagen I embedded cultures (21) , 1.25 ml aliquots per well of a 0.09% collagen I solution were poured into a 6-well plate as in the collagen I invasion assay. After gelation for 1 h at 37°C, 500 solitary cells were added per well in another layer of 0.09% collagen I; after final gelation, 3 ml of the corresponding medium was placed on top. Each cell can thus form a 3-dimensional colony of either compact, diffuse round, or fibroblastoid appearance. Colonies were examined after 7 and 14 days of incubation.


   RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Generation of gp130RB13-6-overexpressing cell lines
Three different cell lines (NIH-3T3 mouse fibroblasts; C6 and BT7Ca rat glioma cells; 15) were transfected with a plasmid construct containing the complete rat cDNA encoding gp130RB13-6 under the control of a CMV promoter. Selection of construct-harboring cells (Geneticin-resistant) resulted in cell populations with a wide range of gp130RB13-6 expression, as shown by FCM (Fig. 2 ). Cell lines exhibiting homogenous expression of gp130RB13-6, designated 3T3-136, BT7-136, and C6-136, were generated by three cycles of fluorescence-activated cell sorting with gp130RB13-6-specific mAb RB13-6 and recultivation of the most intensely immunostained cells. Long-term expression of gp130RB13-6 by these cell lines, as determined by FCM, was similar to that of BT4Ca cells, which possess ~30.000 antigenic determinants per cell (22) . Expression of gp130RB13-6 was confirmed by immunoaffinity purification from transfectant cells, followed by Western blot detection of the specific band at 130 kDa (not shown).



View larger version (56K):
[in this window]
[in a new window]
 
Figure 2. Expression of gp130RB13-6 induced by transfection of plasmid pRc136 containing the complete cDNA in NIH-3T3 murine fibroblasts (A, B), C6 rat glioma cells (C, D), and BT7Ca rat glioma cells (E, F). A, C, E) Flow cytometric analyses of gp130RB13-6 expression at 2 days after transfection. Transfectant cells and their parental counterpart cells of origin were stained with mAb RB13-6. B, D, F) Flow cytometric analyses of cell lines obtained after repeated cell sorting. Staining intensity due to mAb RB13-6 binding: filled areas. Background fluorescence (autofluorescence and nonspecific binding of secondary antibody: areas under solid lines.

Morphology of cells overexpressing gp130RB13-6
Compared with their gp130RB13-6-negative parental cell lines, all gp130RB13-6-positive transfectant cell lines showed distinct morphological alterations toward a more bipolar cell shape. Regardless of their parental cell type of origin, the transfectant cells formed characteristic fascicular aggregates with a mesh-like pattern at semiconfluency (Fig. 3 ). Whereas individual bipolar cells were observed early after transfection in cultures consisting of gp130RB13-6-positive and gp130RB13-6-negative cells, the formation of characteristic aggregates occurred when the cultures were dominated by gp130RB13-6-positive cells. Similar morphological transitions were not observed in transfection experiments with vector DNA. In cultures of C6-136 and BT7-136 cells, the proliferation rate was not significantly influenced by gp130RB13-6 overexpression. 3T3-136 cells showed a slightly decreased proliferation rate, reaching a plateau at lower cell density (data not shown). With all of the gp130RB13-6-overexpressing cell lines, detachment of cells from culture dishes by treatment with trypsin/EDTA was achieved more easily than in the parental cell lines.



View larger version (78K):
[in this window]
[in a new window]
 
Figure 3. Altered morphology of cells induced to express gp130RB13-6 (+gp130RB13-6) are compared with the respective parental cell lines NIH-3T3, C6, and BT7Ca (-gp130RB13-6). Fascicular cell aggregates present at low and intermediate cell density (left panel) resulted in mesh-like patterns at semiconfluency (right panel). Scale bar: 100 µm.

gp130RB13-6 induces the expression of astrocyte/Schwann cell marker proteins in transfectant cells
The gp130RB13-6-overexpressing cell lines in monolayer culture were immunophenotyped with a set of antibodies specific for glial cell molecules (Table 1 ). All three cell lines were induced to express several marker proteins. Most striking was the abundant expression of GFAP, a marker considered to be specific for astrocytes and nonmyelinating Schwann cells (Fig. 4 and Fig. 5 ). Both the proportion of GFAP-positive cells and the intensity of immunostaining were increased in monolayers with close cell–cell contacts and during formation of mesh-like patterns. In contrast, the induced expression of LNGFR was similar at different cell densities. LNGFR expression by gp130RB13-6-positive, Geneticin-resistant NIH-3T3 transfectant cells was also detected prior to the enrichment by fluorescence-activated cell sorting. After the first and second round of cell sorting, i.e., in mixed populations of gp130RB13-6-positive and -negative cells, LNGFR expression was manifest in cultures generated from NIH-3T3, C6, and BT7Ca cells. The expression of GFAP, LNGFR, S-100, Thy-1, and Ran-2, observed in the established cell lines expressing gp130RB13-6, is indicative of glial phenotypes. Induction of GFAP, the most significant glial marker protein, was confirmed by Western blot analysis (Fig. 5) detecting one specific band at 46 kDa, as expected for GFAP (1) .


View this table:
[in this window]
[in a new window]
 
Table 1. Expression of marker molecules by gp130RB13-6-transfectant cells and the corresponding gp130RB13-6-negative parental cellsa



View larger version (106K):
[in this window]
[in a new window]
 
Figure 4. Induction of GFAP and LNGFR expression, as analyzed by immunofluorescence staining. Cell lines induced to express gp130RB13-6 (+gp130RB13-6) are compared with the respective parental cell lines (-gp130RB13-6). Scale bar: 25 µm.



View larger version (53K):
[in this window]
[in a new window]
 
Figure 5. Western blot analyses of GFAP expression by 3T3-136 cells. Lane A: NIH-3T3 parental cells harvested at a cell density of 3.0 x 105/cm2. Lanes B1, B2, and B3: 3T3-136 cells harvested at cell densities of 4.0 x 103/cm2, 1.6 x 105/cm2, or 3.2 x 105/cm2, respectively. Control lanes a, b1, b2, and b2 were processed without the primary anti-GFAP antibody.

Collagen invasion assay and colony morphology in collagen I
The transfectant sublines 3T3-136 and BT7-136, derived from the noninvasive NIH-3T3 and BT7Ca cells, were able to invade into collagen I, as reflected by the invasion index and the mean depth of invasion (Fig. 6 ). On top of collagen I, transfectant cells were fibroblastoid, with a morphological appearance differing from that of the corresponding parental cells (Fig. 7 ). MCF-7/AZ cells were epithelial and noninvasive (negative control), whereas DHD-FIB cells were fibroblastoid and invasive (positive control). The degree of invasiveness of the invasive C6 glioma cells was not significantly altered by expression of gp130RB13-6.



View larger version (19K):
[in this window]
[in a new window]
 
Figure 6. Invasion of gp130RB13-6-expressing transfectant cells (+) and of the corresponding gp130RB13-6-negative parental cells (-) into collagen type I gels. A) Invasion index: Number of cells invading the gel (% of the total number of cells scored). Cells were classified as fibroblastoid (f), round (r), or epithelioid (e). B) Mean depth (µm) of the penetration of cells into the gel. Bars: Standard deviations. MCF-7/AZ cells were used as negative control, DHD-FIB as positive control.



View larger version (128K):
[in this window]
[in a new window]
 
Figure 7. Morphology of cells induced to express gp130RB13-6 (+gp130RB13-6) cells and the corresponding gp130RB13-6- negative parental cells (-gp130RB13-6) on top of the collagen type I gels. After 24 h of incubation, MCF-7/AZ cells used as negative control give rise to an epithelioid morphotype; DHD FIB cells (positive control) exhibit a fibroblastoid morphotype (not shown). Scale bar: 100 µm.

The colony morphology inside the Collagen I gels was reminiscent of that of colonies on top of the gels (data not shown). Compact aggregates of cells expressing functional E-cadherin were obtained with MCF7/AZ cells (negative control). In contrast, the fibroblastoid DHD-FIB cells formed diffuse 3-dimensional colonies (positive control). BT7Ca cells seeded at clonal density remained round or in the form of two or three cell aggregates after 14 days. NIH-3T3 cells were flat and nonaggregating. C6 cells formed dispersed fibroblastoid colonies. gp130RB13-6-expressing transfectant cells invariably formed diffuse fibroblastoid colonies.


   DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
We have recently identified the rat neuroglial differentiation antigen gp130RB13-6 as a nucleotide-cleaving cell surface antigen with type I phosphodiesterase activity (7) . gp130RB13-6 is characterized by a high degree of homology to the plasma cell membrane glycoprotein PC-1 (9 , 10 ) and the tumor cell motility-stimulating exophosphodiesterase ATX 11,12) . Nucleotide processing cell surface PDEs (as reviewed in ref 8 ) may represent critical elements in the regulation of cell differentiation and behavior, and hence possibly in oncogenesis.

The molecular mechanisms underlying the initiation and execution of the astrocyte/Schwann cell differentiation program are insufficiently defined. gp130RB13-6 is a candidate molecule in this control cascade because it is transiently expressed by a small subset of neural precursor cells during nervous system development (4 , 5 ). It is interesting that expression of gp130RB13-6 is also a phenotypic trait of neuroectodermal rat tumors induced by EtNU (6) . Therefore, we have attempted to characterize a function of this molecule on the basis of phenotypic changes induced in gp130RB13-6-negative NIH-3T3 mouse fibroblasts as well as in C6 and BT7Ca rat glioma cells, upon transfection of the gp130RB13-6 cDNA. All three parental lines gave rise to morphologically altered, but very similar, gp130RB13-6-positive sublines induced to express astrocyte/Schwann cell marker proteins, indicative of the involvement of gp130RB13-6 in the control of neuroglial differentiation.

Notably, expression of GFAP, an intermediate filament protein considered specific for the cytoskeleton of astroglial cells and nonmyelin-forming Schwann cells (see 23, 24 for reviews), was induced in all cell lines. Various cytokines and hormones have been identified as modulators of GFAP expression by astrocytes in vitro (25 , 26 ); however, the precise molecular mechanism responsible for the developmental switch from vimentin to GFAP during astrocyte differentiation is uncertain. gp130RB13-6 may, therefore, not only be a phenotypic trait of neural progenitors capable of differentiating into astrocytes or nonmyelin-forming Schwann cells, but a critical element driving the differentiation program of these cells. The level of rat gp130RB13-6 expression forced on cells by the strong CMV promoter in the present experiments seems to trigger glial differentiation even in murine cells of nonneural origin (NIH-3T3 fibroblasts) or cells derived from malignant rat gliomas (BT7Ca and C6). The molecular mechanism underlying the induction of GFAP expression by gp130RB13-6 is not clear. Unidentified trans-activating proteins binding to the GFAP promoter sequence that mediates glial cell-specific expression (27) might be activated through a signaling cascade involving the short intracellular domain of gp130RB13-6 or by other factors responsive to the large extracellular domain. Proteins binding to the intracellular part of gp130RB13-6 and other members of the PC-1 protein family have not yet been identified. However, the interaction of PC-1 with insulin and fibroblast growth factor membrane receptor functions has been described (28 , 29 ). It is not clear whether the inhibition of insulin receptor phosphorylation is caused by direct interaction or ATP depletion by hydrolysis, a reaction catalyzed by PC-1 (30 , 31 ). Future experiments with gp130RB13-6 mutants may provide information regarding the molecular processes leading to the expression of GFAP and other glial cell-associated marker proteins. The observed increase in GFAP immunoreactivity during the formation of cell monolayers with close cell–cell contacts is in accordance with results obtained with primary astrocytic cultures (32) . It remains to be determined whether this effect is due to a phosphorylation-dependent assembly of GFAP filaments (33) . Since GFAP is considered a determining factor for astrocytic cell shape, the morphological alterations observed might have been mediated through the induced GFAP. The fascicular cell aggregates formed in the cultures suggest the involvement of a soluble factor directing cells toward preexisting cell clusters. A soluble derivative of gp130RB13-6 is a candidate protein that might possess this property. Soluble forms generated by proteolytic cleavage have been described for both PC-1 (34) and ATX; ATX was cloned on the basis of its function as secreted tumor motility-stimulating molecule (11) .

The other marker proteins induced by gp130RB13-6 in the present experiments are not expressed exclusively by astroglial or Schwann cells. Nevertheless, LNGFR, S-100, Thy-1, and Ran-2 are important components of the expression profiles of astrocytes and nonmyelin-forming Schwann cells 35-38) . The widely expressed Thy1.1 antigen is known to be expressed by astrocytes but not by oligodendrocytes (39) . Expression of LNGFR by glial cells is considered a necessary component for the autocrine regulation of NGF production by these cells. Cells expressing LNGFR might require NGF to prevent apoptosis (40) .

The induction of cell motility and invasion into collagen I by expression of gp130RB13-6 in NIH-3T3 and BT7Ca cells is in accordance with the demonstration of a motility-stimulating effect of the related protein ATX (11) . Stimulation of motility was linked to the enzymatic activity of autotaxin as a PDE; however, phosphorylation of the catalytic site was not required for this function by an ATX mutant (41) . Recently, gp130RB13-6 was identified as a molecule that was down-regulated in vascular smooth muscle cells after stimulation with PDGF-BB and angiotensin II (42) . To understand the cellular functions of gp130RB13-6, which seem to be different in different types of cells and may be modulated during development, additional biochemical analyses will be needed that differentiate between the effects of membrane-bound and shed gp130RB13-6. The induction of invasiveness into collagen I supports the assumption that gp130RB13-6 is an important factor in the process of glial cell differentiation, which is accompanied by the migration of glial precursors from the ventricular germinal layers to their final destinations in the intermediate or mantle zone and other extraventricular sites (2) . This motility-stimulating function of gp130RB13-6 provides an obvious explanation for the observations that the expression of gp130RB13-6 is a characteristic of the malignant phenotypes resulting from EtNU-induced neurooncogenesis in the rat (5 , 6 ).

In summary, the induced expression of the rat differentiation and tumor antigen gp130RB13-6 in murine NIH-3T3 fibroblasts, as well as in C6 and BT7Ca rat glioma cells, leads to the expression of neural marker proteins clearly indicative of differentiation toward astroglial and nonmyelin-forming Schwann cells. Ongoing experiments are focused on the molecular mechanisms underlying the involvement of gp130RB13-6 in the control of differentiation in neuroglial precursors and on the role of gp130RB13-6 in malignant conversion.


   ACKNOWLEDGMENTS
 
The authors are grateful to Drs. C. Birchmeier and W. Birchmeier (Berlin-Buch) for critical reading of the manuscript and valuable advice, to Dr. M. C. Raff (London) for kindly providing the anti-RAN-2 antibody, and to Dipl.-Ing. K. Lennartz for assistance with the flow-cytometric analyses. We thank Lieve Baeke and Jean Roels van Kerckvoorde for technical assistance. This work was supported by the Deutsche Forschungsgemeinschaft (Ra 119/16-1), the Dr. Mildred Scheel Stiftung für Krebsforschung, the National Foundation for Cancer Research, Bethesda, Md. (through Krebsforschung International e.V., Germany), and by grants from the ASLK/VIVA Verzekeringen and the FWO-Vlaanderen (Brussels).


   FOOTNOTES
 
* Correspondence: Institute of Cell Biology (Cancer Research), University of Essen Medical School and West German Cancer Center Essen, Hufelandstrasse 55, D-45122 Essen, Germany. E-mail: rajewsky{at}uni-essen.de

1 Abbreviations: ATX, autotaxin; CMV, cytomegalovirus; EtNU, N-ethyl-N-nitrosourea; FCM, flow cytometry; GFAP, glial fibrillary acidic protein; LNGFR, low affinity nerve growth factor receptor; mAb, monoclonal antibody; PBS, phosphate-buffered saline; PCR, polymerase chain reaction; PDE, phosphodiesterase/nucleotide pyrophosphatase; SDS-PAGE, sodium dodecyl sulfate-polyacrylamide gel electrophoresis.

Received for publication April 30, 1998. Revision received December 3, 1998.
   REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 

  1. Chiu, F. C., Goldman, J. E. (1985). Regulation of glial fibrillary acidic protein (GFAP) expression in CNS development and in pathological states. J. Neuroimmunol. 8,283-292[Medline]
  2. Kilpatrick, T. J., Richards, L. J., Bartlett, P. F. (1995). The regulation of neural precursor cells within the mammalian brain. Mol. Cell Neurosci. 6,2-15[Medline]
  3. Shafit-Zagardo, B., Kume-Iwaki, A., Goldman, J. E. (1988). Astrocytes regulate GFAP mRNA levels by cyclic AMP and protein kinase C-dependent mechanisms. Glia 1,346-354[Medline]
  4. Blass-Kampmann, S., Kindler-Röhrborn, A., Deissler, H., D'Urso, D., Rajewsky, M. F. (1997). In vitro differentiation of neural progenitor cells from prenatal rat brain: common cell surface glycoprotein on three glial cell subsets. J. Neurosci. Res. 48,95-111[Medline]
  5. Kindler-Röhrborn, A., Blass-Kampmann, S., Lennartz, K., Liepelt, U., Minwegen, R., Rajewsky, M. F. (1994). Surface antigens of cell subpopulations in prenatal rat brain are expressed in a characteristic nonrandom pattern on their ethylnitrosourea-induced malignant counterparts. Differentiation 57,215-224[Medline]
  6. Blass-Kampmann, S., Bilzer, T., Rajewsky, M. F. (1998). gp130RB13–6-positive neural progenitor cells are susceptible to the oncogenic effect of ethylnitrosourea in prenatal rat brain. Neuropath. Appl. Neurobiol. 24,9-20[Medline]
  7. Deissler, H., Lottspeich, F., Rajewsky, M. F. (1995). Affinity purification and cDNA cloning of rat neural differentiation and tumor cell surface antigen gp130RB13–6 reveals relationship to human and murine PC-1. J. Biol. Chem. 270,9849-9855[Abstract/Free Full Text]
  8. Goding, J. W., Terkeltaub, R., Maurice, M., Deterre, P., Sali, A., Belli, S. I. (1998). Ecto-phosphodiesterases/pyrophosphatases of lymphocytes and non-lymphoid cells: Structure and function of the PC-1 family. Immunol. Rev. 161,11-26[Medline]
  9. van Driel, I. R., Goding, J. W. (1987). Plasma cell membrane glycoprotein PC-1. Primary structure deduced from cDNA clones. J. Biol. Chem. 262,4882-4887[Abstract/Free Full Text]
  10. Buckley, M. F., Loveland, K. A., McKinstry, W. J., Garson, O. M., Goding, J. W. (1990). Plasma cell membrane glycoprotein PC-1. cDNA cloning of the human molecule, amino acid sequence, and chromosomal location. J. Biol. Chem. 265,17506-17511[Abstract/Free Full Text]
  11. Murata, J., Lee, H. Y., Clair, T., Krutzsch, H. C., Anders, , Sobel, M. E., Liotta, L. A., Stracke, M. L. (1994). cDNA cloning of the human tumor motility-stimulating protein, autotaxin, reveals a homology with phosphodiesterases. J. Biol. Chem. 269,30479-30484[Abstract/Free Full Text]
  12. Stracke, M. L., Clair, T., Liotta, L. A. (1997). Autotaxin, tumor motility-stimulating exophosphodiesterase. Adv. Enzyme Regul. 37,135-144[Medline]
  13. Scott, L. J., Delautier, D., Meerson, N. R., Trugnan, G., Goding, J. W., Maurice, M. (1997). Biochemical and molecular identification of distinct forms of alkaline phosphodiesterase I expressed on the apical and basolateral plasma membrane surface of rat hepatocytes. Hepatology 25,995-1002[Medline]
  14. Jin-Hua, P., Goding, J. W., Nakamura, H., Sano, K. (1997). Molecular cloning and chromosomal localization of PD-I beta (PDNP3), a new member of the human phosphodiesterase I genes. Genomics 45,412-415[Medline]
  15. Laerum, O. D., Rajewsky, M. F., Schachner, M., Stavrou, D., Haglid, K. G., Haugen, (1977). Phenotypic properties of neoplastic cell lines developed from fetal rat brain cells in culture after exposure to ethylnitrosourea in vivo. Z. Krebsforsch. 89,273-295
  16. Bracke, M. E., Van Larebeke, N. A., Vyncke, B. M., Mareel, M. M. (1991). Retinoic acid modulates both invasion and plasma membrane ruffling of MCF-7 human mammary carcinoma cells in vitro. Br. J. Cancer 63,867-872[Medline]
  17. Dimanche-Boitrel, M. T., Genne, P., Duchamp, O., Chauffert, B. (1994). Confluence dependent resistance (CDR) to doxorubicin and E-cadherin expression in murine mammary cells. Cancer Lett 85,171-176[Medline]
  18. Kindler-Röhrborn, A., Ahrens, O., Liepelt, U., Rajewsky, M. F. (1985). Expression of monoclonal antibody-defined cell surface antigens during rat brain development. Differentiation 30,53-60[Medline]
  19. Deissler, H., Blass-Kampmann, S., Kindler-Röhrborn, A., Meyer, H. E., Rajewsky, M. F. (1996). Characterization of rat NCA/CD9 cell surface antigen and its expression by normal and malignant neural cells. J. Neurosci. Res. 43,664-674[Medline]
  20. Vakaet, L., Jr, Vleminckx, K., Van Roy, F., Mareel, M. (1991). Numerical evaluation of the invasion of closely related cell lines into collagen type I gels. Invasion Metastasis 11,249-260[Medline]
  21. Matsuyoshi, N., Hamaguchi, M., Taniguchi, S., Nagafuchi, A., Tsukita, S., Takeichi, M. (1992). Cadherin mediated cell–cell adhesion is perturbed by v-src tyrosine phosphorylation in metastatic fibroblasts. J. Cell. Biol. 118,703-714[Abstract/Free Full Text]
  22. Dux, R., Kindler-Röhrborn, A., Lennartz, K., Rajewsky, M. F. (1991). Calibration of fluorescence intensities to quantify antibody binding surface determinants of cell subpopulations by flow cytometry. Cytometry 12,422-428[Medline]
  23. Rutka, J. T., Murakami, M., Dirks, P. B., Hubbard, S. L., Becker, L. E., Fukuyama, K., Jung, S., Tsugu, A., Matsuzawa, K. (1997). Role of glial filaments in cells and tumors of glial origin: a review. J. Neurosurg. 87,420-430[Medline]
  24. Laping, N. J., Teter, B., Nichols, N. R., Rozovsky, I., Finch, C. E. (1994). Glial fibrillary acidic protein: regulation by hormones, cytokines, and growth factors. Brain Pathol 4,259-275[Medline]
  25. Morrison, R. S., De Vellis, J., Lee, Y. L., Bradshaw, R. A., Eng, L. F. (1985). Hormones and growth factors induce the synthesis of glial fibrillary acidic protein in rat brain astrocytes. J. Neurosci. Res. 14,167-176[Medline]
  26. Rutka, J. T., De Armond, S. J., Giblin, J., McCulloch, J. R., Wilson, C. B., Rosenblum, M. L. (1988). Effect of retinoids on the proliferation, morphology and expression of glial fibrillary acidic protein of an anaplastic astrocytoma cell line. Int. J. Cancer 42,419-427[Medline]
  27. Masood, K., Besnard, F., Su, Y., Brenner, M. (1993). Analysis of a segment of the human glial fibrillary acidic protein gene that directs astrocyte-specific transcription. J. Neurochem. 61,160-166[Medline]
  28. Maddux, B. A., Sbraccia, P., Kumakura, S., Sasson, S., Youngren, J., Fisher, A., Spencer, S., Gruppe, A., Henzel, W., Stewart, T. A., Reaven, G. M., Goldfine, I. D. (1995). Membrane glycoprotein PC-1 and insulin resistance in non-insulin-dependent diabetes mellitus. Nature (London) 373,448-451[Medline]
  29. Oda, Y., Kuo, M.-D., Huang, S. S., Huang, J. S. (1991). The plasma cell membrane glycoprotein, PC-1, is a threonine-specific protein kinase stimulated by acidic fibroblast growth factor. J. Biol. Chem. 266,16791-16795[Abstract/Free Full Text]
  30. Grupe, A., Alleman, J., Goldfine, I.D., Sadick, M., Stewart, T. A. (1995). Inhibition of insuline receptor phosphorylation by PC-1 is not mediated by the hydrolysis of adenosine triphosphate or the generation of adenosine. J. Biol. Chem. 270,22085-22088[Abstract/Free Full Text]
  31. Stefan, C., Wera, S., Stalmans, W., Bollen, M. (1996). The inhibition of the insuline receptor by the membrane protein PC-1 is not specific and results from the hydrolysis of ATP. Diabetes 45,980-983[Abstract]
  32. Goldman, J. E., Chiu, F. C. (1984). Growth kinetics, cell shape, and the cytoskeleton of primary astrocytic cultures. J. Neurochem. 42,175-184[Medline]
  33. Inagaki, M., Nakamura, Y., Takeda, M., Nishimura, T., Inagaki, N. (1994). Glial fibrillary acidic protein: dynamic property and regulation by phosphorylation. Brain Pathol 4,239-243[Medline]
  34. Belli, S. I., van Driel, I., Goding, J. W. (1993). Identification and characterization of a soluble form of the plasma cell membrane glycoprotein PC-1 (5'-nucleotide phosphodiesterase). Eur. J. Biochem. 217,421-428[Medline]
  35. Bothwell, M. (1991). Tissue localization of nerve growth factor receptor and nerve growth factor receptors. Curr. Top. Microbiol. Immunol. 165,55-70[Medline]
  36. Morrison, R. S., de Vellis, J. (1983). Differentiation of purified astrocytes in chemically defined medium. Brain Res 285,337-345[Medline]
  37. Pruss, R. P. (1979). Thy-1 antigen on astrocytes in long-term cultures of rat central nervous system. Nature (London) 280,688-690[Medline]
  38. Bartlett, P. F., Noble, M. D., Pruss, R. M., Raff, M. C., Rattray, S., Williams, C. A. (1980). Rat neural antigen-2 (RAN-2): a cell surface antigen on astrocytes, ependymal cells, Muller cells, and lepto-meninges. Brain Res 204,339-351
  39. Brown, R. H., Schweitzer, J., Dichter, M. A. (1984). Expression of the Thy-1 antigen in long-term cultures of embryonic mouse spinal cord. Brain Res 296,87-91[Medline]
  40. Rabizadeh, S., Oh, J., Zhong, L. T., Yang, J., Bitler, C. M., Butcher, L. L., Bredesen, D. E. (1993). Induction of apoptosis by the low-affinity NGF receptor. Science 261,345-348[Abstract/Free Full Text]
  41. Lee, H. Y., Clair, T., Mulvaney, P. T., Woodhouse, E. C., Aznavoorian, S., Liotta, L., Stracke, M. L. (1996). Stimulation of tumor cell motility linked to phosphodiesterase catalytic site of autotaxin. J. Biol. Chem. 271,24408-24412[Abstract/Free Full Text]
  42. Kettenhofen, R., Meyer zu Brickwedde, M.-K., Ko, Y., Vetter, H., Sachinidis, A. (1998). Identification of a phosphodiesterase I/nucleotide pyrophosphatase-related gene mRNA in rat vascular smooth muscle cells by the differential display approach. J. Mol. Biol. 279,323-329[Medline]



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
D. L. Baker, Y. Fujiwara, K. R. Pigg, R. Tsukahara, S. Kobayashi, H. Murofushi, A. Uchiyama, K. Murakami-Murofushi, E. Koh, R. W. Bandle, et al.
Carba Analogs of Cyclic Phosphatidic Acid Are Selective Inhibitors of Autotaxin and Cancer Cell Invasion and Metastasis
J. Biol. Chem., August 11, 2006; 281(32): 22786 - 22793.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
W. H. Moolenaar
Lysophospholipids in the limelight: autotaxin takes center stage
J. Cell Biol., July 22, 2002; 158(2): 197 - 199.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
H.-J. Buhring, M. Seiffert, C. Giesert, A. Marxer, L. Kanz, P. Valent, and K. Sano
The basophil activation marker defined by antibody 97A6 is identical to the ectonucleotide pyrophosphatase/phosphodiesterase 3
Blood, May 15, 2001; 97(10): 3303 - 3305.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. Gijsbers, H. Ceulemans, W. Stalmans, and M. Bollen
Structural and Catalytic Similarities between Nucleotide Pyrophosphatases/Phosphodiesterases and Alkaline Phosphatases
J. Biol. Chem., January 5, 2001; 276(2): 1361 - 1368.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by DEISSLER, H.
Right arrow Articles by RAJEWSKY, M. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by DEISSLER, H.
Right arrow Articles by RAJEWSKY, M. F.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS