FASEB J. Mp Biomedicals
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by KHARE, S.
Right arrow Articles by PATEL, Y. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by KHARE, S.
Right arrow Articles by PATEL, Y. C.
(The FASEB Journal. 1999;13:387-394.)
© 1999 FASEB


RESEARCH COMMUNICATION

Differential regulation of somatostatin receptor types 1-5 in rat aorta after angioplasty

S. KHAREa ,1 , U. KUMARa ,1 , R. SASIa , L. PUEBLAa , LAZARO CALDERONb , KARL LEMSTROMb , PEKKA HAYRYb and YOGESH C. PATELa , 2


a Fraser Laboratories, Department of Medicine, McGill University, Royal Victoria Hospital, Montreal, Quebec, H3A 1A1 Canada; and

b Transplantation Laboratory, The Haartman Institute, University of Helsinki, Finland 00014


   ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Treatment of restenosis after angioplasty with octapeptide somatostatin (SST) analogs has met with variable success. These analogs bind with high affinity to only two SST receptor (SSTR) subtypes (2 and 5), display moderate affinity for SSTR3, and low affinity for SSTR1 and 4. To optimize the vasculoprotective effect of SST, we have investigated the pattern of expression of all five SSTRs in rat thoracic aorta in the resting state and at 15 min, 3, 7, and 14 days after balloon endothelial denudation. SSTR1-5 were analyzed as mRNA by semiquantitative reverse transcriptase-polymerase chain reaction and as protein by immunocytochemistry. All five SSTRs were expressed in rat aorta both as mRNA and protein and displayed a time-dependent, subtype-selective response to endothelial denudation. mRNA for SSTR1 and 2 increased acutely (SSTR1 > SSTR2) on days 3 and 7, coincident with smooth muscle cell (SMC) proliferation, and declined to basal levels by day 14. SSTR3 and 4 displayed a different pattern with a delayed, more gradual increase in mRNA beginning at days 3–7 and continued to increase thereafter. SSTR5 mRNA was constitutively expressed at a low level and showed no change during the 2 wk postinjury period. By immunohistochemistry, SSTR1-5 antigens were localized predominantly in SMC that were present in the media or had migrated into the intima; antigen expression correlated with receptor mRNA expression. Notably, only SSTR1,3,4 were expressed in the intima: SSTR1 and 4 during the proliferative burst and SSTR3 and 4 after proliferation, when SMC migration into the intima continues. These results demonstrate dynamic changes in SSTR1-5 expression after vascular trauma localized to areas of vascular SMC migration and replication. In view of their early and prominent induction, SSTR1 may be the optimal subtype to target for inhibition of myointimal proliferation, and SSTR3 and 4 for migration and remodeling.—Khare, S., Kumar, U., Sasi, R., Puebla, L., Calderon, L., Lemstrom, K., Hayry, P., Patel, Y. C. Differential regulation of somatostatin receptor types 1-5 in rat aorta after angioplasty.


Key Words: receptor subtypes • smooth muscle cell • SST • leukocyte • MAPK • macrophage


   INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
VASCULAR INTIMAL DYSPLASIA and remodeling are characteristic features of reinjury after balloon angioplasty, coronary bypass surgery, and chronic allograft rejection 1-4) . The initial response to vascular injury is inflammatory and involves the attraction of lymphocytes, macrophages, and thrombocytes to the site of injury as well as the secretion of cytokines, eicosanoids, and growth factors (5) . Under the influence of growth factors and cytokines, smooth muscle cells (SMC)3 proliferate and migrate from the media into the intima and contribute to intimal hyperplasia and stenosis. The key mediators of SMC proliferation, migration and vascular remodeling are interleukin I, tumor necrosis factor {alpha}, platelet-derived growth factor (PDGF), insulin-like growth factor 1 (IGF1), basic fibroblast growth factor, epidermal growth factor (EGF), transforming growth factor {alpha}, and vascular endothelial growth factor (5) as well as the matrix metalloproteinases that facilitate smooth muscle cell locomotion through the extracellular matrix (6 , 7 ). In view of the central role of SMC proliferation, therapeutic strategies designed to prevent stenosis have attempted to suppress SMC proliferation and migration by blocking the production and action of growth factors and cytokines with receptor antagonists and antibodies, antisense oligonucleotides directed against cell cycle regulatory molecules, and peptide inhibitors of mitogenic signaling such as somatostatin (SST) 8-13) .

SST, a neurohormone, is produced widely in the body and acts both systemically via the circulation, as well as locally to inhibit cell proliferation as well as the secretion of various hormones, growth factors, and neurotransmitter substances (14 , 15 ). SST and its metabolically stable synthetic analogs like the octapeptides SMS201-995 (octreotide), and BIM23014 (lanreotide, angiopeptin) exert a number of vascular effects such as vasoconstriction in the gut and inhibition of angiogenesis (16 , 17 ). A family of five G-protein-coupled receptors with seven {alpha} helical transmembrane segments termed SSTR1-5 mediates the actions of SST (18) . All five SSTRs are functionally coupled to inhibition of adenylyl cyclase (18) . Some of the receptor isotypes also modulate other effectors such as phosphotyrosine phosphatase, K+, and voltage-dependent Ca2+ ion channels, a Na+/H+ exchanger, phospholipase C, phospholipase A2, and mitogen-activated protein kinase (MAPK) (18) . Based on structural similarity and the ability to react with octapeptide and hexapeptide SST analogs, the receptor family can be subdivided into two subclasses: the SSTR2,3,5 subclass that reacts with these analogs, and the SSTR1,4 subfamily, which reacts poorly with these compounds (18) .

SST can inhibit cell proliferation both directly via SSTRs that activate antimitogenic signaling as well as indirectly by blocking the production of growth factors such as EGF, IGF1, and PDGF 18-20) Furthermore, SST is capable of suppressing the immune cell response by inhibiting lymphocyte proliferation and the expression of lymphocyte and endothelial cell adhesion molecules (21 , 22 ). These findings led to the use of SST analogs as potential therapeutic agents to minimize myointimal proliferation. In animal experiments using arterial, venous, and vascular transplant models, the administration of octreotide or lanreotide prevents the formation of dysplastic lesions (11-13 , 22-24 ). These results, however, have been inconsistent in different experimental models. In randomized placebo controlled trials, lanreotide in some studies was found to prevent restenosis after subcutaneous transluminal angioplasty as quantitated by angiography or as clinical events (25 , 26 ), whereas the same success has not been achieved with octreotide (27) . Differences in the binding specificity of the SST analogs for the five SSTRs as well as the dose and duration of SSTR administration may contribute in part to the variable results obtained in these studies (18) . For instance, octreotide and lanreotide both bind with high affinity to SSTR2 and 5, but display species-specific variability in binding to SSTR3; octreotide binds well to human SSTR3 but shows only moderate affinity for the rodent receptor, whereas the opposite is true for lanreotide (18) . To optimize the vasculoprotective effect of SST, the ideal approach would be to characterize the pattern of expression of SSTRs in the vascular wall after trauma and to target the subtypes involved with appropriate agonists. Toward this objective, we have determined the time course of expression of mRNA for SSTR1-5 in rat aorta after endothelial denudation (balloon injury) by reverse transcriptase-polymerase chain reaction (RT-PCR) and localized receptors in the aortic wall directly by immunocytochemistry with rabbit polyclonal antibodies to receptor subtype-specific peptides.


   MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Aortic denudations
Male Wistar rats weighing 200–300 g were anesthetized with chloral hydrate (240 mg/kg i.p.). The thoracic aorta was denuded of endothelium using a 2F Fogarty arterial embolectomy catheter (Baxter Healthcare Corporation, Santa Ana, Calif.). The catheter was introduced into the thoracic aorta via the left iliac artery, inflated with 0.2 ml air, and passed five times to remove the endothelium. The iliac artery was ligated and the animals allowed to recover. Buprenorphine (Temgesic, Reckitt Coleman, Hull, England) was administered for peri- and postoperative pain relief. Groups of three to five rats were killed at 15 min, 3 days, 7 days, and 14 days; aortic tissue was removed in order to evaluate SSTR expression.

All animals received humane care in compliance with guidelines established by the National Institutes of Health (Bethesda, Md.). Three separate experiments were performed. In the first experiment, 12 rats were denuded in Helsinki and 15 coded specimens of thoracic vascular tissue (3 control, 12 denuded; 3 specimens/time point) were sent to Montreal for RNA isolation and RT-PCR. In the second experiment, 20 rats were denuded and 25 coded specimens were sent to Montreal (5 specimens/time point). Four of these were used for RNA isolation and RT-PCR; the fifth specimen was used for routine histology, quantitation of cell replication, and SSTR immunocytochemistry. In the third experiment, frozen sections of 20 aortas (4 control, 16 denuded) were processed for immunocytochemistry for SSTR1-5. The results described here derive from experiments 2 and 3.

For RNA isolation, aortic tissue specimens were flash frozen in liquid nitrogen and stored at -80°C. To evaluate morphological changes, aortic cross sections from the mid segment of the denuded area were fixed in 3% paraformaldehyde (pH 7.4), embedded in paraffin for sectioning, and stained with Mayer's hematoxylin and eosin (H/E). For immunocytochemistry, aortic specimens were embedded in Tissue-Tek (Miles Inc., Elkhard, Ind.) and snap frozen in liquid nitrogen. Serial frozen sections (4–6 µM) were air dried on silane coated slides, fixed in acetone at -20°C for 20 min, and stored at -20°C until use.

RT-PCR
Weighed vascular tissue samples were pulverized in liquid nitrogen using a mortar and pestle, and total RNA was isolated by guanidinium isothiocyanate-phenol-chloroform extraction (28) . For reverse transcription, 20 µg total RNA was treated with 10 units/mg RQ1 RNase-free DNase 1 (Promega, Madison, Wis.) in 40 mM Tris-buffered HCl, pH 7.9, 10 mM NaCl, 6 mM MgCl2, and 10 mM CaCl2 for 30 min at 37°C. The DNase I was inactivated and removed by phenol chloroform extraction, followed by ethanol precipitation. The exact concentration and purity of DNA-free RNA were determined by UV absorbance of RNA solutions in quartz microcuvettes before reverse transcription. The absorbance ratio A260:280 of RNA preparations was consistently >=2:0. To estimate the concentration of RNA, we assumed an absorbance at 260 nM of 1 for a 40 µg/ml RNA solution. Five micrograms of DNA-free RNA were then incubated in a 20 µl reaction containing 20 mM Tris-HCl, pH 8.4, 50 mM KCl, 5 mM MgCl2, 1 mM dNTPs, 20 units of RNasin (Promega), 100 pmol of random hexanucleotides (Pharmacia, Piscataway, N.J.), and 200 units of Moloney murine leukemia virus reverse transcriptase (Gibco BRL, Paisley, U.K.) at 42°C for 30 min. Four microliters of the resulting cDNA samples were denatured at 94°C in 20 mM Tris HCl, pH 8.4, 50 mM KCl, 1.5 mM MgCl2 , 200 µM dNTPs, and 20 pmol each of SSTR1-5 primers in 50 µl reaction volume for 10 min. The following primers were used for the PCR amplification.

rSSTR1: Sense: 5' ATGTTCCCCAATGGCACC 3' (nt 1-18)

Antisense: 5' CAGATTCTCAGGCTGGAAGTCCTC 3' (nt 1093-1115)

rSSTR2: Sense: 5' AGCAACGCGGTCCTCACGTT 3' (nt 124-143)

Antisense: 5' GGAGGTCTCCATTGAGGAGG 3' (nt 1077-1196)

rSSTR3: Sense: 5' ATGAGCACGTGCCACATGCAG 3' (nt 565-585)

Antisense: 5'ACAGATGGCTCAGCGTGCTG 3' (nt 1266-1286)

rSSTR4: Sense: 5' ATGGTAACTATCCAGTGCAT 3' (nt 127-147)

Antisense: 5' GTGAGGCAGAAGACACTCGTGAACAT 3' (nt 376-401) SSTR5: Sense: 5' TGGTCACTGGTGGGCTCAGC 3' (nt 70-89)

Antisense: 5' CCTGCTGGTCTGCATGAGCC 3' (nt 1067-1086)

ß-actin: Sense: 5' ATCATGAAGTGTGACGTGGAC 3' (nt 90-110)

Antisense: 5' AACCGACTGCTGTCACCTTCA 3' (nt 529-549)

PCR reaction was initiated by the addition of 2.5 units of Taq polymerase (Gibco BRL) at 85°C (hot start). The following conditions were used: SSTR1,2,4, denaturation at 94°C for 1 min, annealing at 55°C for 30 s, and extension at 72°C for 90 s; SSTR3,5, denaturation at 94°C for 1 min, annealing at 64°C for 30 s, and extension at 72 °C for 90 s. The receptors were coamplified with ß-actin for 30 cycles, followed by final extension at 72°C for 10 min.

Southern transfer and hybridization
PCR products (10 µl) were separated by electrophoresis on 1.2% agarose gels, transferred to Genescreen Plus Membranes (Dupont, Wilmington, Del.), and hybridized with 32P-labeled SSTR1-5; ß-actin-specific cDNA probes were labeled to high specific activity by random hexanucleotide primers using a Life Technologies Kit. After hybridization for 20–22 h at 70°C, filters were washed and exposed to Kodak XAR film for various times. The hybridization signals were quantitated with a Java Video analysis software package (Jandel Scientific, Corte Madera, Calif.) and used as an index of SSTR and actin mRNA. To ensure that the hybridization bands were quantitated in the linear range, each blot was exposed to X-ray film for various intervals of time. Only bands that did not reach saturation density of exposure were subjected to quantitative analysis. The units derived from the Java analysis were arbitrarily assigned a pixel density corrected for background. Values of SSTR1-5 mRNA expression were normalized to those of actin mRNA on the same gels. All experiments were performed at least three times, and each mRNA quantitation represents the average of six measurements.

BrdU staining of proliferating cells
The method used was modified from the radioisotope method of Goldberg et al. (29) . Bromodeoxyuridine labeling (BrdU-Zymed Laboratories, San Francisco, Calif.) quantitated cell proliferation. Rats were injected with 0.3 ml BrdU labeling reagent 4 h before death and cellular incorporation was visualized by staining of paraffin cross sections using a mouse primary antibody (Bu20a, Dako, A/S, Denmark) and Vectastain Elite ABC Kit (Vector Laboratories, Burlingame, Calif.). Sections were deparaffinized and microwave-treated at 500 W for 2 x 5 min in 0.1 M citrate buffer, pH 6, followed by treatment in 95% formamide in 0.15 M tri-sodium citrate at 70°C for 45 min. Antibody dilutions were made according to the manufacturer's instructions. Sections were counterstained with H/E; positive cells in intimal, medial, and adventitial layers were counted separately and analyzed.

Antibodies to SSTR1-5 and immunohistochemistry of SSTR1-5 antigens
Antipeptide rabbit polyclonal antibodies specific to SSTR1-5 were produced and characterized as previously described 30-33) . Synthetic oligopeptides corresponding to deduced sequences in the amino terminal segment or extracellular loop 3 or cytoplasmic tail of hSSTR1-5 were conjugated to keyhole limpet hemocyanin and used to immunize New Zealand white rabbits. The sequences selected were identical or nearly identical between the human and rat SSTR isoforms. Anti-SSTR activity in rabbit sera was screened by the ability to inhibit [125I-LTT] SST-28 binding to membrane SSTRs, by immunocytochemistry of stable CHO-K1 cells individually transfected with hSSTR1-5, and by Western blot analysis 30-33) . Before immunostaining, the slides were refixed with chloroform and air dried (3) . After incubation with 1.5% normal goat serum, frozen sections were incubated with the panel of SSTR1-5 primary antibodies (diluted 1:200 to 1:500) at 4°C for 12 h. With intervening washes in Tris-buffered saline, the sections were incubated with goat anti-rabbit rat absorbed secondary antibody at room temperature for 30 min, followed by exposure to avidin-biotinylated horseradish peroxidase complex (Vectastatin Elite, ABC Kit) in phosphate-buffered saline at room temperature for 30 min. The reaction was revealed by chromogen 3-amino-9-ethylcarbazole (AEC Sigma, St. Louis, Mo.) containing 0.1% hydrogen peroxide, yielding a brown-red reaction product. Specimens were counterstained with hematoxylin and coverslips were mounted (Aquamount BDH). Eosin was not used so that the brown-red immunoreactive product could be contrasted against the blue nuclear stain and readily visualized. Controls used to validate the specificity of the SSTR immunoreactivity included preimmune serum in place of primary antibody and primary antibody absorbed with excess antigen.

Statistical analysis
Statistical significance at different time points after vessel injury was determined by analysis of variance, followed by the Bonferroni test. P values of <0.05 were considered statistically significant.


   RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Vascular cell proliferation in response to denudation injury
To validate our model against previous reports, we tested the proliferation and intimal response of denuded aorta at the same time points as those selected for determination of SSTR mRNA levels and protein expression. After denudation, the endothelial lining was completely removed (Table 1 ). Quiescent cells in the media were induced to proliferation beginning on day 3, followed by migration and further proliferation in the intima on days 7–14. Staining with antibody to ß-SMC actin and ß-leukocyte common antigen (ß-LCA) demonstrated that virtually all cells in the media and >95% of cells in the intima expressed ß-actin; <5% of the intimal cells were positive for ß-LCA, which indicates that the cells migrating and proliferating in the intima were SMC (not shown).


View this table:
[in this window]
[in a new window]
 
Table 1. Number of cells (nuclei per aorta circumference) and number of cells incorporating BrdU (in parentheses)a at different time points after injury

Expression of SSTR1-5 mRNA in the vascular wall after trauma
Figure 1 depicts Southern blots of RT-PCR products showing the pattern of expression of mRNA for the five SSTR subtypes at different times in control and denuded aortic samples. In all RT-PCR, fixed amounts (5 µg) of total RNA were coamplified for SSTR1-5 and actin, allowing a valid comparison of the relative changes in their mRNAs. The time course of the mean levels of expression of mRNA for the five SSTR subtypes after vascular injury is summarized in Fig. 2 . Control aorta expressed readily detectable levels of SSTR3 mRNA, moderate levels of SSTR1 and SSTR4 mRNA, and barely detectable concentrations of SSTR5 and SSTR2 mRNA. After injury, SSTR1 mRNA displayed a dramatic twofold increase at day 3 (P<0.01) concomitant with the induction of SMC proliferation in the media. The mRNA level remained elevated at day 7 (P<0.01) concurrently with SMC proliferation in the intima but thereafter declined to baseline by day 14 when the proliferation was over. A parallel increase in SSTR2 mRNA was also observed at day 3 (P<0.01) although the magnitude of the change (~20%) was considerably smaller than that of SSTR1 mRNA. Unlike SSTR1 and SSTR2 mRNA, SSTR3 mRNA showed a more gradual increase with no change at day 3, followed by a significant increase by 35% at day 7 (P<0.01) and by 40% at day 14 (P<0.001). SSTR4 mRNA followed a similar pattern but the magnitude of the increase was smaller (20%) and statistically significant (P<0.001) only at day 14. In contrast to the other four subtypes, SSTR5 mRNA remained virtually undetectable and its expression pattern did not change after injury.



View larger version (71K):
[in this window]
[in a new window]
 
Figure 1. Analysis by RT-PCR of SSTR1-5 mRNA in aorta before and after balloon endothelial denudation. 5 µg DNA-free total RNA was reverse transcribed and coamplified with primers specific for SSTR1-5 and ß-actin. 10 µl PCR products were fractionated on agarose gels, transferred to membranes, and hybridized simultaneously with 32P-labeled SSTR1-5 and actin-specific cDNA probes. Control lanes represent Southern hybridization signals for nondenuded aortic samples. Day 0 represents results for samples obtained 15 min after denudation. The length of the PCR amplified fragments are indicated as base pairs (bp).



View larger version (20K):
[in this window]
[in a new window]
 
Figure 2. Time course of SSTR1-5 mRNA expression in vascular wall after trauma. SSTR1-5 mRNA was quantitated from Southern hybridization signals of RT-PCR products (Fig. 1) by densitometry using Java Video analysis. The arbitrary pixel density values were corrected for background and expressed as a ratio of actin mRNA. SSTR1 ({bullet}); SSTR2 ({diamondsuit}); SSTR3 ({blacksquare}); SSTR4 ({circ}); SSTR5 ({triangleup}). *P < 0.05; **P < 0.01; ***P < 0.001 vs. control, nondenuded samples (CTRL). Time 0 represents samples collected 15 min after denudation. Mean ±SE of at least six measurements of pixel densities of hybridization signals from three separate experiments.

Expression of SSTR1-5 proteins by immunohistochemistry
Figure 3 illustrates the pattern of expression of the five SSTR proteins in control and injured aortic vessel wall at different times after endothelial denudation. The results confirm the mRNA expression analysis and localize the receptor proteins as a red-brown reaction product in the vascular wall. SSTR1,2,4 were expressed at low levels in the media of the nondenuded (control) aorta, but very little (if any) SSTR3 and 5 was seen. After denudation, SSTR1 was expressed in the media on days 3, 7, and 14, when media proliferation occurred, and strongly in the intima on days 7 and 14 at the time of intimal SMC proliferation and migration. SSTR4 immunoreactivity was faintly visible in the media on days 3 and 7, but became readily detectable in the intima on day 14, correlating with increased intimal thickening and remodeling. SSTR3 was detected in the media on days 3 and 7, and was localized as a strong signal in the intima on day 14. SSTR2 was clearly detectable in the media on day 3, but did not localize in the intima subsequently. SSTR5 was seen as a weak immunopositive signal in the media and intima without a significant temporal change. Immunopositivity associated with all five SSTRs was blocked in control sections incubated with preimmune serum or antigen absorbed antibody in place of primary antibody (not shown).



View larger version (156K):
[in this window]
[in a new window]
 
Figure 3. Photomicrographs illustrating immunohistochemical localization of SSTR1-5 antigen in aortic sections from control (nondenuded) or denuded specimens at different times postinjury. SSTR1-5 was visualized as a brown-red reaction product by peroxidase immunocytochemistry using SSTR1-5 subtype-specific rabbit antibodies. Representative sections (x400) counterstained with hematoxylin are shown. Eosin was not used in order to contrast the brown-red immunoreactive product against the blue nuclear stain. L, lumen; m, media; a, adventitia. SSTR1,2,4 are expressed at low levels in control media, but there is little expression of SSTR3 and 5. After denudation, strong SSTR1 immunoreactivity is seen in the media on day 3 and in the intima on days 7 and 14. SSTR4 immunoreactivity is localized in the media on days 3 and 7 and becomes readily detectable in the intima on day 14, correlating with increased intimal thickening. SSTR3 is detectable in the media on days 3–7 and localizes as a strong signal in the intima on day 14. SSTR2 is readily detectable in the media on day 3 but not in the intima. SSTR5 is seen as a weak immunopositive signal in the media and intima, with little change over time. Immunoreactivity associated with all five SSTRs was blocked in control sections incubated with preimmune serum or antigen absorbed antibody in place of primary antibody (not shown).


   DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
The model used in this study to quantitate SMC replication and migration after endothelial injury of rat aorta has been well established (29 , 34 , 35 ). Although the injury in this model is inflicted in a healthy rather than atheromatous vessel, as would be the case in coronary balloon dilatation in humans, the model is nonetheless valid for investigating SMC migratory and proliferative responses. Previous studies using the rat aortic model have shown that, after injury, cells in the media begin to proliferate on day 2, reach a peak on day 3, and decline to baseline on day 5 (8 , 34-37 ). Migration of cells into the intima begins on day 4, peaks on day 7, and declines to baseline around day 14. Our results of SMC proliferative and intima responses were in complete agreement with results published previously; accordingly, changes in SSTR mRNA and protein expression at the time points selected (before denudation and at 15 min, 3 days, 7 days, and 14 days postdenudation) can be accurately related to the reported time course of myointimal proliferative and migratory responses (8 , 34-37 ).

We found that all five SSTR mRNAs are expressed in rat aorta both as mRNA and protein. Aortic denudation induced a time-dependent, subtype-selective response in the pattern of SSTR expression. The earliest change occurred in the case of SSTR1 and SSTR2, whose mRNA increased after denudation, reached peak levels between days 3 and 7, and declined to basal levels by day 14. SSTR3 and 4 displayed a different pattern, with a delayed, more gradual increase in mRNA beginning at days 3–7, which remained elevated thereafter. SSTR5 was constitutively expressed with no change in the level of expression during the 2 wk postinjury. By immunohistochemistry, SSTR antigens were localized predominantly in SMC that were either present in the media or had migrated into the intima. In general, the level of expression of SSTR1-5 by mRNA measurement correlated with receptor protein expression by immunohistochemistry.

Our results provide the first evidence for the expression of all five SSTRs in the aorta and suggest that, like other tissues (e.g., brain, pituitary, and islet cells, which also express the five SSTR isoforms), the aorta is an important target of SST action (15 , 18 , 30 ). In previous studies, only SSTR2 mRNA has been detected in rat aorta (38 , 39 ). By autoradiography, a rich concentration of SST binding sites has been described in peritumoral (but not normal) vessels, suggesting that SSTRs may be induced by a tumor product and/or by peritumoral inflammation, as also appears to be the case after denudation injury (40) . We found a predominant cellular localization of SSTRs in SMC, although lower levels of expression in endothelial or inflammatory cells cannot be ruled out. Notably, no SSTR protein was observed in the vascular adventitia. Functional SSTRs have also been identified in glomerular mesangial cells and cultured intestinal SMC, which express SSTRs with the pharmacological profile of the type 3 receptor 41-42) .

What is the mechanism of SSTR induction by vascular injury? Steady-state SSTR mRNA levels are augmented by cAMP, gastrin, EGF, and SST itself 43-45) . Glucocorticoids acutely induce SSTR1 and SSTR2 mRNA, whereas estrogen induces SSTR2 and SSTR3 mRNA and thyroid hormone up-regulates SSTR1 and SSTR5 mRNA 46-48) . The 5' upstream promoter regions of the four receptor genes that have been sequenced (SSTR1,2,4, and 5) display a number of consensus sequences that confer responsiveness to cAMP, AP1, AP2, Pit1, and thyroid hormone 49-53) . The time course of the increase in SSTR3 and 4 mRNA in our study approximated the temporal profile of SMC hyperplasia, suggesting that induction of these two subtypes may simply reflect SMC replication. The earlier onset of induction of SSTR1 and SSTR2 suggests a different mediator, possibly a growth factor such as EGF. Induction of endogenous SSTRs in response to vascular injury may represent a compensatory attempt to modulate the proliferative response by SST produced locally by inflammatory cells.

The results of this study will be important in the rational design of SST agonists for inhibition of fibroproliferative myointimal hyperplasias. All five SSTRs are capable of inhibiting cell proliferation (18) . SSTR1-4 act by stimulating PTP, which dephosphorylates receptor tyrosine kinases, thereby attenuating the mitogenic signal (18) . SSTR5, on the other hand, inhibits guanylate cyclase, cGMP-dependent phosphorylation, and activation of MAPK (18) . Since the five SSTRs are expressed in the arterial wall, they could all be potential targets for the direct antiproliferative effects of SST. To date, however, only the effects of octreotide and lanreotide on myointimal proliferation have been tested. Their reported actions are likely to be mediated via SSTR2,3,5, especially SSTR2 and 3, in view of the low-level constitutive expression of SSTR5. Our findings suggest that SSTR2 and 5 may not be the optimal targets for intervention. Their expression levels remained low after injury, and SSTR2 was never recorded in the intima. In view of their early and prominent induction, SSTR1,3 and 4 may be the optimal subtypes to target—SSTR1 for inhibition of myointimal proliferation and SSTR3 and 4 for migration and remodeling.


   ACKNOWLEDGMENTS
 
We are grateful to M. Correia for secretarial help. This work was supported by grants to Y.C.P. from the Canadian Medical Research Council, the U.S. Department of Defence, and the Canadian National Cancer Institute, and to P.H. from Technology Development Center (TEKES), Academy of Finland Contract No. BMH-4CT95-1160 of Biomed 2, the European Union, and University of Helsinki Hospital Research Funds. Y.C.P. is a Distinguished Scientist of the Canadian Medical Research Council.


   FOOTNOTES
 
2 Correspondence: Room M3-15, Royal Victoria Hospital, 687 Pine Ave. West, Montreal, Quebec H3A 1A1, Canada. E-mail: patel{at}rvhmed.lan.megill.ea

1 S.K. and U.K. contributed equally to this paper.

3 Abbreviations: H/E, Mayer's hematoxylin and eosin; SST, somatostatin; SSTR, somatostatin receptor; SMC, smooth muscle cell; PDGF, platelet-derived growth factor; EGF, epidermal growth factor; IGF1, insulin-like growth factor 1; MAPK, mitogen-activated protein kinase; RT-PCR, reverse transcriptase-polymerase chain reaction; LCA, leukocyte common antigen.

Received for publication May 12, 1998. Revision received August 27, 1998.
   REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 

  1. Holmes D. R., Vlietstra R. E., Smith H. C., Vetrovec G. W., Kent K. M., Cowley M. J., Faxon D. P., Gruentzig A. R., Kelsey S. F., Detre K. M.. Restenosis after percutaneous transluminal coronary angioplasty (PTCA)a report from the PTCA Registry of the National Heart, Lung, and Blood Institute. Am. J. Cardiol. 1984;53:77C-81C.[Medline]
  2. Holmes D, Holubkov R., Vliestra R.. Comparison of complications during percutaneous transluminal coronary angioplasty from 1977 to 1981 and from 1985 to 1986the National Heart, Lung, and Blood Institute Percutaneous Transluminal Coronary Angioplasty Registry. J. Am. Coll. Cardiol. 1988;22:1149-1155.
  3. Lemstrom K. B., Koskinen P. K.. Expression and localization of platelet-derived growth factor ligand and receptor protein during acute and chronic rejection of rat cardiac allografts. Circulation 1997;96:1240-1249.[Abstract/Free Full Text]
  4. Hayry P., Isoniemi H., Yilmaz S., Mennander A., Lenstrom K., Raisanen-Sokolowski A., Koskinen P., Ustinov J., Lautenschlager I., Taskinen E.. Chronic allograft rejection. Immunol. Rev. 1993;134:33-81.[Medline]
  5. Ross R.. The pathogenesis of atherosclerosisa perspective for the 1990s. Nature (London) 1993;362:801-809.[Medline]
  6. Bendeck M. P., Irvin C., Reidy M. A.. Inhibition of matrix metalloproteinase activity inhibits smooth muscle cell migration but not neointimal thickening after arterial injury. Circ. Res. 1996;78:38-43.[Abstract/Free Full Text]
  7. Galis Z. S., Muszynski M., Sukhova G. K., Simon-Morrissey E., Libby P.. Thrombin promotes activation of matrix metalloproteinase-2 produced by cultured vascular smooth muscle cells. Ann. N.Y. Acad. Sci. 1995;748:501-507.[Medline]
  8. Hayry P., Myllarniemi M., Aavik E., Alatalo S., Aho P., Yilmaz S., Raisanen-Sokolowski A., Cozzone G., Jameson B. A., Baserga R.. Stabile D-peptide analog of insulin-like growth factor-1 inhibits smooth muscle cell proliferation after carotoid ballooning injury in the rat. FASEB J 1995;9:1336-1344.[Abstract]
  9. Sirois M. G., Simons M., Edelman E. R.. Antisense oligonucleotide inhibition of PDGFR-beta receptor subunit expression directs suppression of intimal thickening. Circulation 1997;95:669-676.[Abstract/Free Full Text]
  10. Wrighton C. J., Hofer-Warbinek R., Moll T., Eytner R., Bach F. H., de Martin R.. Inhibition of endothelial cell activation by adenovirus-mediated expression of I kappa B alpha, an inhibitor of the transcription factor NF-kappa B. J. Exp. Med. 1996;183:1-10.[Free Full Text]
  11. Grant M. B., Wargovich T. J., Ellis E. A., Caballero S., Mansour M., Pepine C. J.. Localization of insulin-like growth factor I and inhibition of coronary smooth muscle cell growth by somatostatin analogues in human coronary smooth muscle cells. A potential treatment for restenosis? Circulation 1994;89:1511-1517.[Abstract/Free Full Text]
  12. Hong M. K., Bhatti T., Matthews B. J., Stark K. S., Cathapermal S. S., Foegh M. L., Ramwell P. W., Kent K. M.. The effect of porous infusion balloon-delivered angiopeptin on myointimal hyperplasia after balloon injury in the rabbit. Circulation 1993;88:638-648.[Abstract/Free Full Text]
  13. Lindner V., Reidy M. A.. Proliferation of smooth muscle cells after vascular injury is inhibited by an antibody against basic fibroblast growth factor. Proc. Natl. Acad Sci. USA 1991;88:3739-3743.[Abstract/Free Full Text]
  14. Reichlin S.. Somatostatin. N. Engl. J. Med. 1983;309:1495-1501.[Medline]
  15. Patel Y. C., Liu J.-L, Galanopoulou A. S., Papachristou D. N.. Jefferson L. S. Cherrington A. D. eds. The Handbook of Physiology, The Endocrine Pancreas and Regulation of Metabolism 1999 Oxford University Press New York In press. .
  16. Wahren J.. Influence of somatostatin on carbohydrate disposal and absorption in diabetes mellitus. Lancet 1976;2:1213-1215.[Medline]
  17. Waltering E. A., Barrie R., O'Dorisio T. M.. Somatostatin analogues inhibit abgiogenesis in the chick chorioallantoic membrane. J. Surg. Res. 1991;50:245-251.[Medline]
  18. Patel Y. C., Srikant C. B.. Somatostatin. Trends Endocrinol. Metab. 1997;8:398-405.[Medline]
  19. Hayry P., Raisanen A., Ustinov J., Mennander A., Paavonen T.. Somatostatin analog lanreotide inhibits myocyte replication and several growth factors in allograft arteriosclerosis. FASEB J 1993;7:1055-1060.[Abstract]
  20. Yumi K., Fagin J. A., Fishbein M. C., Shah P. K., Kaul S., Niu W., Nilsson J., Cercek B., Yamashita M.. Direct effects of somatostatin analog octreotide on insulin-like growth factor-I in the arterial wall. Lab. Invest. 1997;76:329-338.[Medline]
  21. Aguila M. C., Rodriguez A. M., Aguila-Mansilla H. N., Lee W. T.. Somatostatin antisense oligodeoxynucleotide-mediated stimulation of lymphocyte proliferation in culture. Endocrinology 1996;137:1585-1590.[Abstract]
  22. Leszczynski D., Josephs M. D., Fournier R. S., Foegh M. L.. Angiopeptin, the octapeptide analogue of somatostatin, decreases rat heart endothelial cell adhesiveness for mononuclear cells. Regul. Peptides 1993;43:131-140.[Medline]
  23. Foegh M. L., Asotra S., Conte J. V., Howell M., Kagan E., Verma K., Ramwell P. W.. Early inhibition of myointimal proliferation by angiopeptin after balloon catheter injury in the rabbit. J. Vasc. Surg. 1994;19:1084-1091.[Medline]
  24. Foegh M. L., Lou H., Chen M. F., Ramwell P. W.. Angiopeptin induces beneficial vascular remodeling after balloon injury. Transplant. Proc. 1997;29:2605-2608.[Medline]
  25. Eriksen U. H., Amtorp O., Bagger J. P., Emanuelsson H., Foegh H., Henningsen P., Saunamaki K. K., Schaeffer M., Thayssen P., Orskov H.. Randomized double-blind Scandinavian trial of angiopeptin versus placebo for the prevention of clinical events and restenosis after coronary balloon angioplasty. Am. Heart J. 1995;130:1-8.[Medline]
  26. Emanuelsson H., Beatt K. J., Bagger J. P., Balcon R., Heikkila J., Piessens J., Schaeffer M., Suryapranata H., Foegh M.. Long-term effects of angiopeptin treatment in coronary angioplastyReduction of clinical events but not angiographic restenosis. Circulation 1995;91:1689-1696.[Abstract/Free Full Text]
  27. von Essen R., Ostermaier R., Grube E., Maurer R., Tebbe U., Erbel R., Roth M., Oel W., Brom J., Weidinger G.. Effects of octreotide treatment on restenosis after coronary angioplastyresults of the VERAS study. Circulation 1997;96:1482-1487.[Abstract/Free Full Text]
  28. Chomczynski P., Sacchi N.. Single-step method of RNA isolation by acid guanidium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 1987;162:156-158.[Medline]
  29. Goldberg I., Stemerman M. B., Schnipper L. E., Ransil B. J., Croocks G. W., Fuhro R. L.. Vascular smooth muscle cell kineticsa new assay for studying patterns of cellular proliferation in vivo. Science 1979;205:920-921.[Abstract/Free Full Text]
  30. Kumar U., Laird D., Srikant C. B., Escher E., Patel Y. C.. Expression of the five somatostatin receptor (SSTR1-5) subtypes in rat pituitary somatotrophsquantitative analysis by double-layer immunofluorescence confocal microscopy. Endocrinology 1997;138:4474-4476.
  31. Kumar U., Sasi S., Suresh S., Patel A., Thangaraju M., Metrakos P., Patel S. C., Patel Y. C.. Subtype selective expression of the five somatostatin receptors (hSSTR1-5) in human pancreatic islet cellsa quantitative double-labeled immunohistochemical analysis. Diabetes 1999;489:77-85.
  32. Patel Y. C., Panetta R., Esher E., Greenwood M., Srikant C. B.. Expression of multiple somatostatin receptor genes in AtT-20 cells, evidence for a novel somatostatin-28 selective receptor subtype. J. Biol. Chem. 1994;269:1506-1509.[Abstract/Free Full Text]
  33. Greenwood M. T., Hukovic N., Kumar U., Panetta R., Hjorth S. A., Srikant C. B., Patel Y. C.. Ligand binding pocket of the human somatostatin receptor 5 (HSSTR5)mutational analysis of the extracellular domains. Mol. Pharmacol. 1997;52:807-814.[Abstract/Free Full Text]
  34. Clowes A., Reidy M., Clowes M.. Kinetics of cellular proliferation after arterial injury. Lab. Invest. 1983;49:327-333.[Medline]
  35. Clowes A. W., Swartz S. M.. Significance of quiescent smooth muscle migration in the injured rat carotoid artery. Circ. Res. 1985;56:139-145.[Abstract/Free Full Text]
  36. Majesky M. W., Reidy M. A., Bowen-Pope D. F., Hart C. E., Wilcox J. N., Schwartz S. M.. PDGF ligand and receptor gene expression during repair of arterial injury. J. Cell Biol. 1990;111:2149-2158.[Abstract/Free Full Text]
  37. Majesky M. W., Giachelli C. M., Reidy M. A., Schwartz S.. Rat carotid neointimal smooth muscle cells reexpress a developmentally regulated mRNA phenotype during repair of arterial injury. Circ. Res. 1992;71:759-768.[Abstract/Free Full Text]
  38. Weckbecker G., Pally C., Raulf C., Beckmann N., Schuurman J. H., Rudin M., Bruns C.. The somatostatin analog octreotide as potential treatment for re-stenosis and chronic rejection. Transplant. Proc. 1997;29:2599-2600.[Medline]
  39. Chen J. C., Hsiang Y. N., Buchan A. M.. Somatostatin receptor expression in rat iliac arteries after balloon injury. J. Invest. Surg. 1997;10:17-23.[Medline]
  40. Reubi J.-C, Horisberger U., Laissue J.. High density of somatostatin receptors in veins surrounding human cancer tissuerole in tumor-host interaction?. Int. J. Cancer 1994;56:681-688.[Medline]
  41. Dies-Marques M. L., Garcia-Escribano C., Medina J., Boyano-Adanez M. C., Arilla E., Torrecilla G., Rodriguez-Puyol D., Rodriguez-Puyol M.. Effects of somatostatin on cultures human mesangial cells. Endocrinol. Metab. 1995;136:3444-3451.
  42. Murthy K. S., Coy D. H., Makhlouf G.. Somatostatin receptor-mediated signaling in smooth muscleActivation of phospholipase C-ß3 by Gß{gamma} and inhibition of adenylyl cyclase by G{alpha}1 and G{alpha}o. J. Biol. Chem. 1996;271:23458-23463.[Abstract/Free Full Text]
  43. Patel Y. C., Greenwood M. T., Kent G., Panetta R., Srikant C. B.. Multiple gene transcripts of the somatostatin receptor SSTR2tissue selective distribution and cAMP regulation. Biochem. Biophys. Res. Commun. 1993;192:288-294.[Medline]
  44. Vidal C., Rauly I., Zeggari M., Delesque N., Esteve J.-P, Saint-Laurent N., Vaysse N., Susini C.. Up-regulation of somatostatin receptors by epidermal growth factor and gastrin in pancreatic cancer cells. Mol. Pharmacol. 1994;46:97-104.[Abstract]
  45. Bruno J. F., Xu Y., Berelowitz M.. Somatostatin regulates somatostatin receptor subtype mRNA expression in GH3 cells. Biochem. Biophys. Res. Commun. 1994;202:1738-1743.[Medline]
  46. Xu Y., Berelowitz M., Bruno J. F.. Dexamethasome regulates somatostatin receptor subtype messenger ribonucleic acid in rat pituitary GH4C1 cells. Endocrinology 1995;136:5070-5075.[Abstract]
  47. Xu Y., Song J., Berelowitz M., Bruno J. F.. Estrogen regulates somatostatin receptor subtype 2 messenger ribonucleic acid expression in human breast cancer cells. Endocrinology 1996;137:5634-5640.[Abstract]
  48. James R. A., Sarapura V. D., Bruns C., Raulf F., Dowding J. M., Gordon D. F., Wood W. M., Ridgway E. C.. Thyroid hormone-induced expression of specific somatostatin receptor subtypes correlates with involution of the TtT-97 murine thyrotrope tumor. Endocrinology 1997;138:719-724.[Abstract/Free Full Text]
  49. Hauser F., Meyerhof W., Wulfsen I., Schonrock C., Richter D.. Sequence analysis of the promoter region of the rat somatostatin receptor subtype 1 gene. FEBS Lett 1994;345:225-228.[Medline]
  50. Greenwood M. T., Robertson L.-A, Patel Y. C.. Cloning of the gene encoding human somatostatin receptor 2sequence analysis of the 5'-flanking promoter region. Gene 1995;159:291-292.[Medline]
  51. Pscherer A., Dorflinger U., Kirfel J., Gawlas K., Ruschoff J., Buettner R., Schule R.. The helix-loop-helix transscription factor SEF-2 regulates the activity of a novel initiator element in the promoter of the human somatostatin receptor II gene. EMBO J 1996;15:6680-6690.[Medline]
  52. Xu Y., Bruno J. F., Berelowitz M.. Characterization of the proximal promoter region of the rat somatostatin receptor gene, SSTR4. Biochem. Biophys. Res. Commun. 1995;206:935-941.[Medline]
  53. Greenwood M. T., Panetta R., Robertson L.-A, Liu J.-L, Patel Y. C.. Sequence analysis of the 5'-flanking promoter region of the human somatostatin receptor 5. Biochem. Biophys. Res. Commun. 1994;205:1883-1890.[Medline]



This article has been cited by other articles:


Home page
Toxicol PatholHome page
M. Y. Wells, H. Voute, M.-O. Lonchampt, C. Fisch, V. Boulifard, and P. Picaut
Intimal Hyperplasia in Rats after Subcutaneous Injection of a Somatostatin Analog
Toxicol Pathol, February 1, 2009; 37(2): 235 - 243.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
J. L. Ramirez, R. Mouchantaf, U. Kumar, V. Otero Corchon, M. Rubinstein, M. J. Low, and Y. C. Patel
Brain Somatostatin Receptors Are Up-Regulated In Somatostatin-Deficient Mice
Mol. Endocrinol., August 1, 2002; 16(8): 1951 - 1963.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Rocheville, D. C. Lange, U. Kumar, R. Sasi, R. C. Patel, and Y. C. Patel
Subtypes of the Somatostatin Receptor Assemble as Functional Homo- and Heterodimers
J. Biol. Chem., March 10, 2000; 275(11): 7862 - 7869.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. Hukovic, M. Rocheville, U. Kumar, R. Sasi, S. Khare, and Y. C. Patel
Agonist-dependent Up-regulation of Human Somatostatin Receptor Type 1 Requires Molecular Signals in the Cytoplasmic C-tail
J. Biol. Chem., August 27, 1999; 274(35): 24550 - 24558.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by KHARE, S.
Right arrow Articles by PATEL, Y. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by KHARE, S.
Right arrow Articles by PATEL, Y. C.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS