FASEB J.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by FREY, B. M.
Right arrow Articles by FREY, F. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by FREY, B. M.
Right arrow Articles by FREY, F. J.
(The FASEB Journal. 1999;13:2235-2245.)
© 1999 FASEB

Annexin I modulates cell functions by controlling intracellular calcium release

BRIGITTE M. FREY*1, BERNHARD F. X. REBER{dagger}, BANNIKUPPE S. VISHWANATH*, GENEVIÈVE ESCHER* and FELIX J. FREY*

* Division of Nephrology and Hypertension and
{dagger} Institute of Pharmacology, University of Berne, CH-3010 Switzerland

1Correspondence: Division of Nephrology and Hypertension, Inselspital, 3010 Berne, Switzerland. E-mail brigitte.frey{at}dkf2.unibe.ch


   ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Annexin I is an intracellular protein in search of a function. Ex vivo it has calcium- and phospholipid-binding properties. To evaluate its role in vivo, MCF-7 cells were stably transfected with annexin I in sense or antisense orientations. In cells overexpressing annexin I, calcium release was abrogated on stimulation of purinergic or bradykinin receptors, whereas non-transfected cells or cells with down-regulated annexin I released calcium within seconds. Basal calcium and calcium stores were not affected. The impaired calcium release was paralleled by a down-regulation of the activities of phospholipase C, group II phospholipase A2, and E-cadherin with altered adhesion and enhanced tumor growth on soft agar. Significantly smaller tumors, with the histologically most differentiated cells, were observed in nude mice inoculated with cells transfected with the antisense rather than with the sense plasmid. These observations indicate that annexin I modulates cell functions by controlling intracellular calcium release. Frey, B. M., Reber, B. F. X., Vishwanath, B. S., Escher, G., Frey, F. J. Annexin I modulates cell functions by controlling intracellular calcium release.


Key Words: phospholipase A • phospholipase C • E-cadherin • tumor • MCF-7 • Ca2+ homeostasis


   INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
ANNEXIN I IS a highly abundant intracellular protein (1 , 2) . The low concentrations found in extracellular fluids are the result of a selective secretion (1) . In some tissues annexin I exceeds 0.4% of the total protein (2 , 3) . It is one of the biochemically best characterized of a group of calcium- and phospholipid-binding proteins (2) . The annexin family commonly possesses four repeats of the endonexin fold domain, the actual calcium-binding sites. In vitro the affinity for calcium in the absence of phospholipids is low, but increases severalfold to an apparent Kd of 75 µM in the presence of phosphatidylserine liposomes (4) . Each member of the annexin family has a similar carboxyl-terminal region called the core domain, which is responsible for the calcium-phospholipid binding, whereas the amino-terminal tail is unique and varies in length and sequence (5) .

Various annexins have been implicated in cellular processes, including modulation of phospholipase A2 (PLA2) activity and inflammation (3) , immune response (6) , proliferation (7) , blood coagulation (8) , differentiation (9) , exocytosis (10) , membrane skeletal linkage (11) , and intracellular signal transduction (12) . Annexin I is a good substrate of receptor- or non-receptor tyrosine kinases, interacts calcium-dependently with protein kinase C (PKC), and is phosphorylated by this kinase (4 , 13 , 14) . Although the conservation of annexins during evolution argues strongly for their important physiological role, Buckingham and Flower point out in their recent review that the most important and still outstanding question is how and by which cellular mechanism annexin I exerts its diverse actions on cellular physiology (15) . We hypothesize that one common denominator for many of its presumed actions might be intracellular binding of calcium.

The concept that annexin I might be involved in the regulation of intracellular calcium signaling is based on analogies with other calcium storage proteins such as calsequestrins (16) or calreticulins (17) , which are calcium-binding proteins of the muscle sarcoplasmic reticulum. These analogies are a wide distribution in mammalian tissues, high conservation of their amino acid sequence, high capacity of calcium binding, modulation of cellular adhesiveness, and modulation of protein-protein interactions.

To analyze whether annexin I affects intracellular calcium kinetics and dynamics we have overexpressed and down-regulated annexin I by a stably integrated plasmid containing annexin I in the sense or anti-sense orientation in MCF-7 cells. We found that annexin I is strongly involved in the modulation of intracellular calcium release and by that mechanism interferes with processes that are calcium-dependent.


   MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Construction of expression vectors harboring annexin I in the sense and anti-sense orientation
Annexin I cloned into bluescript vector (pBS; Stratagene AG, Basel, Switzerland) was amplified using a specific annexin I 5'-primer, containing a Kozak consensus sequence and further subcloned in the sense and anti-sense orientation into the pcDNA3 vector (InVitrogen) (18 , 19) . Both plasmids were partly sequenced and verified by in vitro transcription/translation analysis using the transcription-translation kit from Amersham.

Cell culturing and stable transfections
MCF-7 cells (ATTC, Rockville, MD) were grown in Dulbecco’s minimal essential medium (DMEM) with 10% fetal calf serum (FCS), penicillin, and streptomycin. Geneticin (1.5 mg/ml) was added to transfected cultures. Confluent monolayers were harvested with trypsin (0.1%) treatment. Cells (104) were incubated in 24-well plates. For growth in soft agar 2 ml of 0.6% agar in DMEM with 10% FCS was plated per well (six-well plates). Top agar, 0.36% containing 104 cells/3 ml, was layered over the hardened agar. Cultures were incubated at 37°C in 5% CO2 for 2–5 weeks. Cells were photographed with or without Hoffman contrast (20) using an inverted microscope (Diaphot 300, Nikon).

For transfection 2 x 106 cells/400 µl of phosphate-buffered saline (PBS) were mixed with 20 µg/40 µl linearized pcDNA3 vector containing annexin I in the sense or anti-sense orientation. Electroporation was performed on a Gene Pulser II Apparatus (Bio-Rad) using 250 V and 960 µF (Capacitance). The time constant was between 28 and 35 ms. Geneticin was added 3 days after transfection. Two weeks later the clones were picked and grown in 24-well plates.

The induction of annexin I by steroids was studied by incubating the cells with 100 µM dexamethasone or hydrocortisone over 72 h. Then the cells were analyzed as described below.

The PLA2 activity was determined in the supernatant of cells incubated without or with IL-1ß (5 nM) and/or TNF-{alpha} (5000 U/well) in the presence or absence of dexamethasone (10 µM) as given below (21) . Cells (50,000 cells/well) were grown for 4 days, then cytokines and steroids were added for 3 days.

Total water-soluble [3H]inositol phosphate fractions (IPF) were assessed in cells labeled with 1 µCi myo-[3H]inositol (Amersham) for 24 h and stimulated with 100 µM ATP, 10 µM Mastoparan, Mas7, and Mas17 (Biomol, Plymouth Meeting, PA) for 15, 30, and 60 s in the presence of 5 mM LiCl2 (22) .

In vivo tumor studies
The animal studies have been approved by the Institutional Review Board. After acclimatization and a control by a veterinarian, mice were injected subcutaneously (s.c., neck) with 100 µg of estradiol valerate (Progynon Depot, Schering AG, Zurich, Switzerland) 2 days before and 14 days after cell inoculation. Cells in cold PBS were mixed with 10 mg/ml cold Matrigel (Collaborative Biomedical Products, Bedford, MA); 0.5 ml containing 5 x 106 cells was immediately injected subcutaneously into the flank region of 6-week-old female athymic nu/nu BALB/c mice. Mice were palpated three times weekly from study day 9 until day 28, killed, and macroscopically and microscopically evaluated by the Research & Consulting Company, Ittingen, Switzerland. Histological examinations were performed on treatment sites, adrenal glands, bones, brain, lungs, kidneys, liver, lymph nodes, spleen, and gross lesions from all animals, i.e., 10 mice per group.

The volume of the tumor was calculated according to the following formula: size (mm3) = {pi}(width)2 x mm(length)/12.

Analysis of genomic DNA and of mRNA of annexin I, 11ß-hydroxysteroid dehydrogenase 1 and 2 (11ß-OHSD1 and 11ß-OHSD2), PLA2, and ß-actin
Genomic DNA was isolated and amplified by PCR using T7 and SP6 primers, the flanking regions of annexin I cloned into pcDNA3 (23) .

To check for stable insertion, genomic DNA (0.5 µg) or cDNA were added to the transcription mix and incubated for 30 min at 30°C. The transcription product was added to the translation mix containing [35S]methionine and kept at 30°C for 90min. One-tenth of the translation product was loaded onto a 12% sodium dodecyl sulfate (SDS) gel. The dried gel was exposed to X-ray film overnight.

Total RNA was extracted by the guanidinium thiocyanate method (24) . Its quality was controlled by running 1 µg on a 1% agarose-formaldehyde gel.

Two micrograms of total RNA were reverse transcribed using 1 U AMV reverse transcriptase, 10 pmol 3'-primer complementary to the corresponding cDNA position (852–873 for 11ß-OHSD1, 1271–1295 for 11ß-OHSD2, 978-1006 for annexin I, 695–719 for group II PLA2, and 1022–1049 for the internal standard ß-actin). For PCR 2 µl reverse-transcribed cDNA was added to a conventional buffer mix containing 10 pmol of the appropriate 3' and 5' cDNA primers (117–137 for 11ß-OHSD1, 381–406 for 11ß-OHSD2, 1–30 for endogenous annexin I, GCGCGGCCGCCGCCATGGCAATGGTATCA for the transfected annexin I, 58–82 for group II PLA2, and 416–441 for ß-actin), 1 µCi [{alpha}-32P]dCTP, and 1 U Taq polymerase. Ten microliters of each PCR reaction were separated on an agarose gel. Bands were visualized under ultraviolet light, excised, and the radioactivity measured in a liquid scintillation counter (Tricarb 2000 CA, Packard Instruments) using a Cerenkov program.

Cellular distribution of annexin I by Western blotting
The extraction technique of McLeod allows the separation of three fractions of annexin I: cell-surface (S), intracellular (IC), and membrane-bound (MB) (25) . Cells were resuspended in 100 µl DMEM, 10 mM EGTA, 10 mM vanadate, and incubated for 30 min at room temperature. The supernatant was considered as cell-surface fraction. The pellet mixed with 100 µl of 50 mM Tris, pH 7.5, 10 mM EGTA, 10 mM vanadate was frozen for 1 h at -20°C. The supernatant was considered as intracellular fraction. The pellet was resuspended in 100 µl of 1%Triton X-100, 10 mM vanadate in PBS. This extract was considered as the membrane-bound fraction. Equal amounts were separated on a 12.5% polyacrylamide gel. The proteins were transferred to an Immobilon membrane (Millipore). The membrane was blocked with 5% BSA for 2 h, washed with PBS, and incubated with the anti-annexin I antibody for 2 h at 37°C (19) . The washed membrane was blocked again and incubated with a goat anti-rabbit IgG horseradish peroxidase conjugate at room temperature for 1 h. The detection was performed with enhanced chemiluminescence (ECL; Amersham).

Activity measurement of 11ß-OHSD1, 11ß-OHSD2, and PLA2
Oxidation or reduction at C-11 by 11ß-OHSD1 was determined by measuring the rate of conversion of corticosterone to 11-dehydrocorticosterone in the presence of NADP or dehydrocorticosterone to corticosterone in the presence of NADPH (26) . Cells were extracted with 10 mM Tris-HCl, pH 7.5, 5 mM EDTA, pH 8, 1% Triton X-100, 2 mM phenylmethylsulfonyl fluoride (PMSF), and 100 µg total protein incubated in 0.25 mM NADP or NADPH, 100 mM Tris, pH 8.3, 10 nCi [3H]corticosterone or [3H]dehydrocorticosterone, and 5 µM corticosterone or dehydrocorticosterone for 45 min at 37°C. Steroids were extracted with 500 µl ethyl acetate, the organic layer evaporated, the steroid residue dissolved in 20 µl methanol containing 20 µg of unlabeled corticosterone and dehydrocorticosterone, transferred to thin-layer plates (6°F254, silica gel, Merck), and developed in chloroform-methanol (90:10 v/v). The spots corresponding to the steroids were excised and counted in a scintillation counter. Specific activity was expressed as nanomoles of product formed per microgram protein per hour.

The assay for 11ß-OHSD2 was performed as described (27) . Cells were homogenized with 250 mM sucrose and 10 mM Tris-HCl pH 7.5 and incubated with 1 mM NAD, 10 nM corticosterone, and 50 nCi [3H]corticosterone in homogenization buffer for 45 min at 37°C. The subsequent steps were as those described for 11ß-OHSD1.

PLA2 was assayed as described previously using [3H]oleate-labeled Escherichia coli as substrate (28) .

Flow cytometric analyses (FACS)
One million cells were fixed with 1 ml of ORTHO PermaFix (Ortho Diagnostics, Raritan, NJ) for 40 min. Cells were incubated for 30 min with washing buffer (10% goat serum, 1.5% BSA, 0.005% EDTA in PBS) and for 60 min with either control serum or with 1 µg/106 cells of the antibodies directed against tubulin, vinculin, vimentin, pan-cytokeratin, A-Cam, desmosomal protein, annexin I, II, and V, glucocorticoid receptor, mineralocorticoid receptor, FAK, paxillin, p120, L1, ß integrin, VASP, pan-cadherin, cadherin-5, -E, -P -K, Catenin-{alpha}, -ß, -{gamma}, desmoglein, cytoplasmic PLA2, PLA2, group II, actinine, and phosphotyrosine (PY20). Actin was stained with fluorescein isothiocyanate (FITC)-phalloidin (Molecular Probes, Eugene, OR). The antibodies were from Santa Cruz Biotechnology, Santa Cruz, CA, from Zymed Laboratories, South San Francisco, CA, from Transduction Laboratories, Lexington, KY, from Sigma, St. Louis, MO, and from Dako Diagnostics AG, Zug, Switzerland. Cells were incubated with anti-mouse FITC-IgG (whole molecule) antibody for 30 min, washed, resuspended in PBS, and immediately analyzed by FACScan analysis (Becton-Dickinson, Mountain View, CA). At least 20,000 cells were analyzed.

Single-cell [Ca2+]i measurement
The method has been described in detail elsewhere (29) . Agonist-induced changes in [Ca2+]i were observed as a change in Fura-2 (Molecular Probes) fluorescence within cells grown on coverslips and viewed on an inverted microscope. Fluorescence signals (520–560 nm) were measured within the cytosol (10 cells) at two excitation wavelengths, 340 and 380 nm, respectively. Conversion of Fura-2 fluorescence to [Ca2+]i was calculated (30) . Cells were kept at room temperature in 500-µl wells filled with a solution of 140 mM NaCl, 5 mM KCl, 1.5 mM MgCl2, 2 mM CaCl2, and 10 mM HEPES-NaOH (pH 7.4) during experiments. Ca2+ responses were evoked by exchange of medium with 250 nM bradykinin (Sigma) 50 µM ATP or UTP, respectively, in the absence or presence of thapsigargin (100 nM, Molecular Probes). Analysis of data traces was performed on a Macintosh 8500/120 computer.

Statistical analysis
Differences within the three groups were calculated using nonparametric analysis of variance (Kruskal-Wallis).


   RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Generation of MCF-7 clones
MCF-7 clones were developed by stable transfection of MCF-7 cells with the pcDNA3 plasmid containing annexin I in the sense or anti-sense orientation and by selection with 1.5 mg/ml of Geneticin. For detection of cells with integrated pcDNA3 plasmids containing annexin I in the sense or the anti-sense orientation genomic DNA was analyzed by polymerase chain reaction (PCR) in 90 and 67 G418-resistant clones, respectively. Positive clones were analyzed by Western blotting. Annexin I was overexpressed in 13 and down-regulated in 5 clones. One clone of each construct was selected and designated S14 as harboring the sense and AS33 as harboring the anti-sense construct. In parallel, MCF-7 cells cultured for the same length of time as the transfected cells were designated MCF-7A. To optimize expression a Kozak consensus sequence was engineered in front of the first ATG of the annexin I cDNA (18) . In vitro transcription and translation resulted in identical products for both constructs (Fig. 1 ). Reverse-transcribed genomic DNA of a clone harboring the sense construct was translated in vitro. A product of the same size as that obtained with plasmid cDNA was obtained (Fig. 1) . As expected, no product was obtained for the clones harboring the antisense construct (Fig. 1) .



View larger version (70K):
[in this window]
[in a new window]
 
Figure 1. In vitro transcription and translation of annexin I cDNA and of genomic DNA. Top panel: Coomassie blue-stained polyacrylamide gel of recombinant annexin I (r-Annexin, 38.7 kDa), of the translation products of reverse-transcribed pcDNA3 plasmid (lane 2), of reverse-transcribed pcDNA3 plasmids containing the annexin I cDNA either with (lane 3) or without (lane 4) the Kozak sequence, or of reverse-transcribed genomic DNA from clones containing annexin I cDNA in the sense (lane 6) or anti-sense (lane 7) orientation. Bottom panel: Autoradiogram of the stained polyacrylamide gel presenting the [35S]methionine-labeled translation product annexin I (lanes 3, 4, 6). A translation product was only obtained for plasmids containing the annexin I cDNA in the sense orientation and for cells transfected with this plasmid.

Modulation of the expression and cellular distribution of annexin I
Endogenous annexin I steady state mRNA was the same for non-transfected and transfected cells using ß-actin as internal standard (Fig. 2A , left and right). However, when transcription of the engineered annexin I was examined, only cells with annexin I in the sense orientation showed transcription (Fig. 2A , middle). A comparison of the amount of annexin I protein associated with surface, membrane, and intracellular fractions under basal conditions revealed that most of annexin I was present intracellularly in non-transfected and transfected cells (Fig. 2B ). Although the expression of annexin I was significantly increased in S14 cells, the distribution pattern seems to be similar within the three cell types analyzed.



View larger version (87K):
[in this window]
[in a new window]
 
Figure 2. A) mRNA of annexin I. Left panel: PCR products of endogenous annexin I from non-transfected cells and cells transfected with sense and anti-sense constructs. A similar level of annexin I mRNA was found in non-transfected and transfected cells. Middle panel: PCR products of engineered annexin I using the annexin I primers containing the Kozak sequence. The PCR product was detected only in cells transfected with plasmid containing annexin I in the sense orientation. Right panel: PCR products of the internal standard ß-actin. M, marker; MCF-7 1, non-transfected cells; MCF-7 2, cells transfected with the anti-sense; and MCF-7 3, cells transfected with the sense construct of annexin I; B, blank, where no DNA was added. B) Cellular distribution of annexin I. Western blot of cellular fractions of annexin I in non-transfected cells (MCF-7A), in cells containing the annexin I plasmid in the sense orientation (S14), and in cells containing annexin I in the anti-sense orientation (AS33). In all three fractions an increased level of annexin I was observed in S14 cells. S, surface fraction; IC, intracellular fraction; MB, membrane-bound fraction. Marker: r-annexin I.

Different groups of investigators have shown that glucocorticoids induce the synthesis of annexin I (31 32 33 34 35) . Thus we tested the following hypothesis: whether glucocorticoids can further increase the expression or alter the distribution of annexin I. When all three cell types were incubated with 100 µM dexamethasone or hydrocortisone no effect on the expression or cellular distribution of annexin I was observed (data not shown). An explanation for different susceptibility of cells toward glucocorticosteroids might be different amounts of the enzyme 11ß-hydroxysteroid dehydrogenase (11ß-OHSD) type 1 or 2, enzymes converting active 11ß-hydroxysteroids into inactive 11-ketosteroids (21 , 36) . Therefore we assessed these enzymes in non-transfected and transfected MCF-7 cells. We found high levels of 11ß-OHSD type 2, but not type 1 mRNA (results not shown). The mean specific activities (± SE) for 11ß-OHSD2 were similar, i.e. 45.4 ± 9.5, 33.0 ± 4.5, 34.5 ± 11.6 fmol/µg protein/h for MCF-7A, S14, and AS33, respectively.

Annexin I affects morphology, adhesion properties, and tumorigenic behavior of MCF-7 in soft agar and nude mice
S14 had a less irregular shape than MCF-7A or AS33 cells, suggesting tighter junctions (Fig. 3A-C , left). When S14 cells were treated with trypsin, mainly cell clusters were obtained, which only after prolonged treatment and vigorous pipetting could be separated into single cells. Observation of S14 cells by using Hoffman contrast revealed a decreased adhesion to the surface of the culture dish (Fig. 3B , middle column). We hypothesized that this reduced adhesion favors tumor growth and spreading. Therefore cells were grown in soft agar (Fig. 3A-C , right). S14 cells developed colonies (Fig. 3B , right), whereas AS33 cells did not, even when the culturing time was prolonged over several weeks. The non-transfected cells grew only very slowly as a function of time (Fig. 3A, C ). The impact of annexin I on tumor cell growth in vitro was also observed in vivo in nude mice. The tumor volume at the site of injection increased with increasing expression of annexin I: AS33 (median and range), 29 mm3, 12–52 mm3 (n = 10); 7A, 44 mm3, 29–116 mm3 (n = 10); S14, 59 mm3, 25–85 mm3 (n = 9); (P<0.009, AS33 vs. S14).



View larger version (121K):
[in this window]
[in a new window]
 
Figure 3. Influence of overexpression or down-regulation of annexin I on the growth properties and tumorigenicity. Microscopy of non-transfected MCF-7 cells (A), of sense-transfected S14 (B), and of anti-sense-transfected AS33 cells (C). Cells in culture dishes were photographed at a magnification of 400 without (left panel) or with (middle panel) Hoffman contrast and cells in soft agar (right panel) at a magnification of 200.

The more pronounced tumor growth of S14 cells compared to AS33 or control MCF-7A cells is paralleled by decreased FACS heights of the adhesion molecule E-cadherin and its associated proteins gamma-catenin and p120 in S14 cells compared to AS33 or control cells (P<0.0001; Fig. 4 ). Similarly, diminished FACS-heights of VASP and vinculin were found in S14 cells, whereas the focal adhesion kinase FAK was increased (P values for all markers <0.0001; Fig. 4 ).



View larger version (39K):
[in this window]
[in a new window]
 
Figure 4. Flow cytometric analyses. Non-transfected MCF-7 cells (black bars), sense-transfected S14 cells (hatched bars), and anti-sense-transfected AS33 cells (gray bars) were fixed and incubated with antibodies against vinculin, VASP, FAK, p120, E-cadherin, {gamma}-catenin. A marked decrease for E-cadherin could be observed in S14 cells when compared with AS33 cells. The mean (± SE) is given from a representative experiment. Statistically significant differences (P<0.0001) were found for all six proteins when the three cell lines were compared.

Overexpression of annexin I decreases PLC and PLA2, group II, activity
The activity of PLC was assessed after receptor-mediated stimulation of the cells using ATP and after receptor-independent stimulation using Mastoparan and Mas7, two agents capable of directly activating G proteins. The mean [3H]inositol phosphate fraction (IPF) released from S14 cells was significantly lower 15 and 30 s after stimulation using ATP compared to control or AS33 cells (Fig. 5A ). A similar pattern was observed when the G proteins were activated directly (Fig. 5B ). All three cell types released very low IPF when they were incubated with inactive Mastoparan analog Mas17 (data not given).



View larger version (26K):
[in this window]
[in a new window]
 
Figure 5. [3H]inositol phosphate fraction. A) myo-[3H]inositol-labeled cells were stimulated with ATP for 15 (black bars), 30 (hatched bars), and 60 s (gray bars). The mean values (n = 4 of one of three experiments) of [3H]inositol phosphate release at time point zero, before ATP was added, were deducted from each mean value after stimulation (delta cpm). In S14 cells a marked decrease in [3H]inositol phosphate release was observed 15 and 30 s after stimulation compared to control or AS33 cells. B) and C) The same experiment was performed as in panel A but Mastoparan and Mas7 were used as stimulators.

Stimulation of control and transfected cells with TNF-{alpha}, IL-1ß, or a combination of both increased the activity of PLA2 (Fig. 6 ). Independent of the type of stimulation used, the phospholipase activity was lower in S14 cells compared to MCF-7A or AS33 cells (Fig. 6 , for all eight combinations: P<0.0029–0.0005). Adding dexamethasone to the cultures abrogated the activity of PLA2 in S14 cells, whereas there was still a substantial activity in AS33 cells.



View larger version (33K):
[in this window]
[in a new window]
 
Figure 6. mRNA and activity of phospholipase after stimulation with TNF-{alpha} or/and IL-1ß in the absence or presence of dexamethasone. A) Agarose gel electrophoresis of total RNA from non-transfected (MCF-7A) and transfected (S14, AS33) cells. B) PCR products of group II PLA2 from MCF-7A, S14 and AS33 cells. B, blank where no DNA was added; MCF-7A, non-transfected cells; S14, cells containing the annexin I plasmid in the sense orientation; AS33 cells containing the annexin I plasmid in the anti-sense orientation; PLA2-cDNA; M, marker. C) MCF-7 cells, S14, and AS33 cells were incubated with TNF-{alpha} or/and IL-1ß in the absence or presence of dexamethasone. The PLA2 activity was increased in anti-sense transfected AS33 cells (gray bars) compared to non-transfected (MCF-7A, black bars) or sense-transfected S14 cells (hatched bars). The inhibitory effect of dexamethasone on PLA2 activity was most pronounced in S14 cells.

All the observations obtained have a potential common denominator, namely calcium. Therefore single-cell calcium measurements were performed.

Effect of annexin I overexpression on receptor-mediated calcium release
Single-cell calcium measurements were performed using two functional receptor-coupled pathways of intracellular Ca2+ release in non-transfected and transfected MCF-7 cells (Fig. 7 ). The effect of annexin I overexpression on agonist-induced G-protein coupled Ca2+ release from intracellular stores was analyzed by using bradykinin, an agent known to induce Ca2+ responses. A transient Ca2+ release was observed (Fig. 7A ). Cell stimulation in [Ca2+]i-free medium evoked comparable increases of [Ca2+]i demonstrating intracellular Ca2+ release. Similar Ca2+ signal characteristics were seen for the two purinergic agonists ATP and UTP.



View larger version (36K):
[in this window]
[in a new window]
 
Figure 7. Agonist-induced [Ca2+]i release. A) Agonist-induced [Ca2+]i release in the presence and absence of extracellular Ca2+ in MCF-7 cells. The temporal changes of mean [Ca2+]i values of 10 individual cells during agonist stimulation (250 nM bradykinin, 50 µM ATP, 50 µM UTP) are given. Horizontal bars depict time interval when cells were kept in a given specific medium as indicated. Each mean single data point and SE is shown. B) Effect of annexin I transfection on bradykinin-induced and ATP-induced [Ca2+]i releases. Shown are averaged traces of non-transfected MCF-7A (filled squares, n = 80), annexin I anti-sense (AS33, filled circles, n = 50), and annexin I sense-transfected cells (S14, open circles, n = 110). Traces were aligned at the signal onset before average calculation. Columns represent the corresponding mean (± SE) Ca2+ responses.C) Effect of annexin I transfection on intracellular [Ca2+]i stores in MCF-7 cells. Left panels: non-transfected and transfected cells (n = 10) were stimulated by 50 µM ATP to verify effects of annexin I transfection on agonist-induced Ca2+ release. Right panels: slow and transient cytosolic [Ca2+]i increase during thapsigargin-induced block of Ca2+ re-uptake. Time intervals of extracellular Ca2+, thapsigargin, and ATP presence are indicated by horizontal bars.

The basal [Ca2+]i (approximately 60 nM) was not affected by transfection. Overexpression of annexin I caused a reduction of bradykinin (90%) and ATP (50%) induced peak Ca2+ responses (Fig. 7B) . By contrast, when the constitutive expression of annexin I was reduced only a small reduction (15–20%) of peak Ca2+ responses was measured. Thus, increased annexin I levels clearly impair stimulus-evoked cellular Ca2+ homeostasis by attenuation of the Ca2+ responses.

An explanation for the reduced Ca2+ response might be depletion of Ca2+ stores in transfected cells. Indirect means were used to determine the filling state of the intracellular IP3-sensitive calcium pool. Basal [Ca2+]i was observed during incubation with thapsigargin (100 nM), a known inhibitor of cellular ATPases. Non-transfected, sense- and anti-sense-transfected cells responded with a comparable slow transient change in their basal [Ca2+]i that is taken as inhibition of calcium re-uptake from the cytosol into Ca2+ stores and is in agreement with normal filling of the Ca2+ stores in the three cell types (Fig. 7C) . Thus, neither higher nor lower levels of annexin I seem to affect intrastore Ca2+. Furthermore all three cells responded to ionomycin with a slow transient Ca2+ release in Ca2+-free medium (data not shown) arguing for normal Ca2+ filling of the stores.


   DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
To study by which mechanism annexin I exerts its diverse cellular actions MCF-7 cells were stably transfected with a plasmid harboring annexin I in the sense or antisense orientation. We have not chosen to attempt to change the annexin I concentrations by adding glucocorticoids to cell cultures because first, glucocorticoids exhibit many confounding cellular effects and second, there is still a debate as to whether or not steroids induce the expression of annexin I at all (31 32 33 34 35 , 37 , 38) . In the present study glucocorticoids did not modulate the expression or the distribution pattern of endogenous annexin I, a finding in agreement with observations from other investigators, but in contrast to reports from other authors, who described a glucocorticoid-induced expression of annexin I (25 , 32 33 34 35 , 37 , 38) . It is unlikely that the absence of glucocorticoid induction of annexin I in our investigation is the consequence of a multi-drug resistance, because wild-type MCF-7 cells only become drug resistant by introducing the mdr1 gene (39) . MCF-7 cells contain glucocorticoid receptors as visualized by FACS (results not shown), therefore the lack of glucocorticoid-mediated up-regulation of annexin I is not attributable to an absence of glucocorticoid receptors. The relevance of the glucocorticoid receptors might be questioned, however, because recent promotor analyses by Donnelly and Moss suggest that the putative glucocorticoid response element of annexin I is non-functional (40) . These factors and the presence of high or low activities of 11ß-OHSD type 1 and/or 2 enzyme, converting active 11ß-hydroxysteroids into inactive 11-ketosteroids and vice versa, might explain at least part of the long debate about the inducibility of annexin I by glucocorticoids in in vitro experiments (2 , 19) .

The morphology of MCF-7 cells changed when the expression of annexin I was modulated in the present investigation. This effect is specific for annexin I because up- or down-regulation of annexin II or VI did not alter cell morphology (41 , 42) . The morphological alterations observed in S14 and AS33 cells paralleled the expression pattern of the adhesion molecules E-cadherin, {gamma}-catenin, and p120. E-cadherin is a calcium-binding protein that plays a key role in the maintenance of tissue integrity. Removal of calcium abolishes adhesive activity of cadherins, renders cadherins vulnerable to proteases, and induces a dramatic reversible conformational change in their extracellular region (43 , 44) . An association between reduced E-cadherin expression and enhanced tumor invasion and metastasis has been described (45 46 47 48) . The actual function of E-cadherin is mediated by a group of cytoplasmic proteins termed catenins, the loss or dysfunction of which has been implicated in the gain of tumor cell invasive potential (49 , 50) . A role in regulation of the cadherin/catenin adhesion complex has been attributed to p120, a protein found at a lower level in S14 cells compared to the level found in AS33 or non-transfected cells (Fig. 4) (51 , 52) .

S14 cells with lower E-cadherin levels exhibited higher FAK expression than non-transfected or AS33 cells (Fig. 4) . Inhibition of the FAK reduced migration and proliferation and overexpression of FAK stimulated cell migration and increased the potential of tumor invasion (53 54 55 56) . These increased FAK levels could favor the cell migration and the spreading of S14 cells, because FAK is an important signal molecule in cell adhesion. In S14 cells a diminished amount of VASP and vinculin was found (Fig. 4) . Vinculin is a VASP-binding protein that is relevant for recruiting VASP to cell membranes and by that mechanism influences focal adhesion and suppresses the tumorigenic ability (57 58 59) . A similar rounder morphology and a reduced ability to spread and to adhere as shown for S14 cells (Fig. 3 , middle panel) has been observed in vinculin-mutant F9 cells compared to the wild type (60) .

The change of the factors discussed favored increased tumor growth of S14 compared with AS33 cells in nude mice. AS33 cells revealed a very high differentiation status in vivo. No metastases could be observed in all three groups investigated. Ways et al. made a similar observation when they overexpressed protein kinase C-{alpha} in MCF-7 cells (61) . Their cells displayed an enhanced proliferation rate, anchorage-independent growth, dramatic morphological alterations, including loss of epithelioid appearance, comparable to the appearance of S14, and a more aggressive neoplastic phenotype in nude mice (61) . It is interesting that annexins and conventional protein kinases C (cPKCs) share common properties such as requirement for calcium and negatively charged phospholipids for translocation and activity, respectively (62) . In addition, cPKCs possess an annexin-like domain, raising the possibility of specific interaction with annexins (14 , 63) . The similar morphology of S14 cells and the PKC-{alpha}-overexpressing MCF-7 cells may, however, not be due to a direct relationship between annexins and cPKCs because Blobe et al. reported that multi-drug-resistant MCF-7 clones overexpressing PKC-{alpha} present a different morphology and different proliferation alterations (64) .

Many endo- and xenobiotics regulate the activity of their target cells via PLC, which hydrolyzes phosphatidylinositol 4,5 biphosphate (PIP2) into inositol 1,4,5 trisphospate (IP3) and diacylglycerol (65) ; the former mobilizes calcium from intracellular pools and the latter activates PKC. PLC is activated by G proteins after binding of an extracellular signaling molecule. Calcium is involved in the primary steps of the hormonal message transduction and in its regulation. Molecules that activate PLC also mobilize intracellular calcium (66) . IP3 accumulation and calcium mobilization follow the same kinetics (67 , 68) . In line with this established interrelationship between free intracellular calcium and cleavage of PIP2, a much smaller fraction of inositol phosphate was found in S14 than AS33 cells stimulated with ATP. To test whether annexin I interferes with the ligand receptor complex and disturbs by that mechanism the signal transduction, cells were stimulated with Mastoparan and Mas7. Both teradecapeptides did not overcome the inhibition of the PLC activity in S14 cells, indicating that annexin I does not interfere with receptor activation.

Not only lower IP fractions were detected in S14 cells, but also a decreased activity of PLA2 after stimulation with TNF-{alpha} and IL-1ß in the absence or presence of dexamethasone. The observation of an increased PLA2 activity in cells deprived of annexin I was confirmed by Solito et al. (69) and the inhibition of PLA2 by dexamethasone is in line with our previous observation of an enhanced group II PLA2 activity and down-regulated annexin I in adrenalectomized rats (3) . However, our findings are in contrast to those of Hayashi et al., who investigated TEA3A1 cells transfected with sense or anti-sense cDNA of annexin I and found an increased PLA2 activity in pooled overexpressors containing a glucocorticoid-inducible vector and a decreased activity in anti-sense transfected cells (70) . These findings are difficult to interpret in the light of their own former report concerning TEA3A1 cells where increased annexin I levels and reduced PLA2 activities were measured after dexamethasone treatment (71) .

Because calcium is the only potential common denominator for all the observations obtained, single-cell calcium measurements were performed. Increased annexin I levels clearly impair stimulus-evoked cellular Ca2+ homeostasis by attenuation of the Ca2+ responses. Our data might be perceived as being at variance with investigations performed by Willmott et al., who found a potentiation of store-operated calcium influx in U937 cells, the annexin I level of which was induced after incubating the cells with dexamethasone phosphate or PMA (72) . The addition of these agents is a confounding variable and therefore these data do not reflect the influence of annexin I on calcium release alone (72) .

Reduced Ca2+ response could be due to depleted Ca2+ stores. Indirect measurements using thapsigargin revealed that the filling state of the intracellular IP3-sensitive calcium pool was similar in non-transfected, sense- and anti-sense-transfected cells. Thus, neither higher nor lower levels of annexin I seem to affect intrastore Ca2+. The results point to impaired cell Ca2+ homeostasis when cellular annexin I levels vary. Among the signaling events downstream of G-protein receptor, activation of PLC activity (73) and IP3-ligand-gated Ca2+ release show clear Ca2+ dependence (74) . In principle, a reduced Ca2+ signal can be the consequence of slower signal onset correlating with slower second messenger production or with faster Ca2+ sequestration. The idea, that part of the annexin I function lies in delivering extra binding sites to Ca2+ ions allowing attenuation of fast Ca2+ responses seems obvious, might, however, not be relevant because of the high Kd value of annexin I for calcium binding. We favor the hypothesis that increased annexin I levels indirectly decrease Ca2+ release from IP3-sensitive Ca2+ stores. This can be mainly due to reduced PLC activity. Because PLC activity is Ca2+ dependent, it is either Ca2+ itself bound to additionally expressed annexin I and not to PLC or sequestration of PLC molecules to annexin that cause less IP3 synthesis, subsequently leading to decreased IP3-evoked Ca2+ release. We do not assume that annexin I interferes directly with IP3-receptor channels or Ca2+ re-uptake mechanisms to intracellular Ca2+ stores as evidenced by the Ca2+ responses after thapsigargin and ionomycin addition, respectively.

In conclusion, constitutive annexin I levels define a steady-state equilibrium for normal Ca2+ release function from IP3-sensitive Ca2+ stores. Increased or decreased levels impair this equilibrium state, causing altered strength of Ca2+ release. The present results argue for annexin I expression levels playing a regulatory role in the effectiveness of agonist-induced signal transduction by negatively modulating PLC activity and subsequently affecting downstream Ca2+-dependent reactions.


   ACKNOWLEDGMENTS
 
This work was supported by Swiss National Foundation for Scientific Research Grants 32–40 492.94, 3200–050820.97 (B. F. and F. F.), and 41–40483.94 (B. F. X. R.).


   FOOTNOTES
 
Received for publication May 13, 1999. Revised for publication August 9, 1999.


   REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 

  1. Moss, S. E. (1992) The Annexins Res. Monograph, Portland Press London.
  2. Raynal, P., Pollard, H. B. (1994) Annexins: the problem of assessing the biological role for a gene family of multifunctional calcium- and phopholipid-binding proteins. Biochim. Biophys. Acta 1197,63-93[Medline]
  3. Vishwanath, B. S., Frey, F. J., Bradbury, M., Dallman, M. F., Frey, B. M. (1992) Adrenalectomy decreases lipocortin-1 messenger ribonucleic acid and tissue protein content in rats. Endocrinol 130,585-591[Abstract/Free Full Text]
  4. Schlaepfer, D. D., Haigler, H. T. (1987) Characterization of calcium-dependent phospholipid binding and phosphorylation of lipocortin 1. J. Biol. Chem. 262,6931-6938[Abstract/Free Full Text]
  5. Geisow, M. J., Fritsche, U., Hexham, J. M., Dash, B., Johnson, T. (1986) A consensus amino-acid sequence repeat in Torpedo and mammalian Ca2+-dependent membrane-binding proteins. Nature (London) 320,636-638[Medline]
  6. Flower, R. J. (1988) Lipocortin and the mechanism of action of the glucocorticoids. Br. J. Pharmacol. 94,987-1001[Medline]
  7. Schlaepfer, D. D., Haigler, H. T. (1990) Expression of annexins as a function of cellular growth state. J. Cell Biol. 111,229-238[Abstract/Free Full Text]
  8. Tait, J. F., Sakata, M., McMullen, B. A., Miano, C. H., Funakoshi, T., Hendrickson, L., Fujikawa, K. (1988) Placental anticoagulant proteins: isolation and characterization of four members of the lipocortin familiy. Biochemistry 27,6268-6276[Medline]
  9. Violette, S. M., King, I., Browning, J. L., Pepinsky, R. B., Wallner, B. P., Sartorelli, A. C. (1990) Role of lipocortin 1 in the glucocorticoid induction of the terminal differentiation of a human squamous carcinoma. J. Cell. Physiol. 142,70-77[Medline]
  10. Burgoyne, R. D. (1988) Calpactin in exocytosis?. Nature (London) 331,20[Medline]
  11. Roy-Choudhury, S., Mishra, V. S., Low, M. G., Das, M. (1988) A phospholipid is the membrane anchoring domain of a protein growth factor of molecular mass 34kDa in placental trophoblasts. Proc. Natl. Acad. Sci. USA 85,2014-2018[Abstract/Free Full Text]
  12. Croxtall, J. D., Choudhury, Q., Tokumoto, H., Flower, R. J. (1995) Lipocortin 1 and the control of arachidonic acid release in cell signalling. Biochem. Pharmacol. 50,465-474[Medline]
  13. Pepinsky, R. B., Sinclair, L. K. (1986) Epidermal growth factor-dependent phosphorylation of lipocortin. Nature (London) 321,81-84[Medline]
  14. Brownawell, A. M., Creutz, C. E. (1996) Calcium-dependent binding of the plasma protein apolipoprotein A-I to two members of the annexin family. Biochemistry 35,6839-6845[Medline]
  15. Buckingham, J. C., Flower, R. J. (1997) Lipocortin 1: a second messenger of glucocorticoid action in the hypothalamo-pituitary-adrenocortical axis. Mol. Med. Today 7,296-302
  16. Tharin, S., Hamel, P. A., Conway, E. M., Michalak, M., Opas, M. (1996) Regulation of calcium binding proteins calreticulin and calsequestrin during differentiation in the myogenic cell line L6. J. Cell. Physiol. 166,547-560[Medline]
  17. Krause, K. H., Michalak, M. (1997) Calreticulin. Cell 89,439-443
  18. Kozak, M. (1987) An analysis of 5'-noncoding sequences from 699 vertebrate messenger RNAs. Nucleic. Acids Res. 15,8125-8148[Abstract/Free Full Text]
  19. Frey, B. M., Frey, F. J., Lingappa, V. R., Trachsel, H. (1991) Expression of human recombinant lipocortin 1 in a wheat-germ cell-free system and Xenopus oocytes. Biochem. J. 275,219-225
  20. Hoffman, R. (1979) Photomicrography using the modulation contrast system. J. Biol. Photogr. Assoc. 47,111-116[Medline]
  21. Escher, G., Galli, I., Vishwanath, B. S., Frey, B. M., Frey, F. J. (1997) Tumor necrosis factor alpha and interleukin 1ß enhance the cortisone/cortisol shuttle. J. Exp. Med. 186,189-198[Abstract/Free Full Text]
  22. Berridge, M. J., Downes, C. P., Hanley, M. R. (1982) Lithium amplifies agonist-dependent phosphatidylinositol responses in brain and salivary glands. Biochem. J. 206,587-595[Medline]
  23. Miller, S. A., Dykes, D. D., Polesky, H. F. (1988) A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic. Acids Res. 16,1215[Free Full Text]
  24. Chomczynski, P., Sacchi, N. (1987) Single-step method of RNA isolation by acid guanidium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162,156-159[Medline]
  25. McLeod, J. D., Goodall, A., Jelic, P., Bolton, C. (1995) Changes in the cellular distribution of lipocortin-1 (annexin-1) in C6 glioma cells after exposure to dexamethasone. Biochem. Pharmacol. 50,1103-1107[Medline]
  26. Lakshmi, V., Monder, C. (1985) Extraction of 11ß-hydroxysteroid dehydrogenase from rat liver microsomes by detergents. J. Steroid Biochem. 22,331-340[Medline]
  27. Albitson, A. L., Obeyesekere, V. R., Smith, R. E., Krozowski, Z. (1994) Cloning and tissue distribution of the human 11ß-hydroxysteroid dehydrogenase type 2 enzyme. Mol. Cell. Endocrinol. 105,R11-R17[Medline]
  28. Vishwanath, B. S., Frey, F. J., Bradbury, M. J., Dallmann, M. F., Frey, B. M. (1993) Glucocorticoid deficiency increases phospholipase A2 activity in rats. J. Clin. Invest. 92,1974-1980
  29. Reber, B. F. X., Reuter, H. (1991) Dependence of cytosolic calcium in differentiating rat pheochromocytoma cells on calcium channels and intracellular stores. J. Physiol. 435,145-162[Abstract/Free Full Text]
  30. Grynkiewicz, G., Poenie, M., Tsien, R. Y. (1985) A new generation of Ca2+ indicators with greatly improved fluorescence properties. J. Biol. Chem. 260,3340-3450
  31. Peers, S. H., Smillie, F., Elderfield, A. J., Flower, R. J. (1993) Glucocorticoid and non-glucocorticoid induction of lipocortins (annexins) 1 and 2 in rat peritoneal leucocytes in vivo. Br. J. Pharmacol. 108,66-72[Medline]
  32. Parente, L., Solito, E., Giannessi, P., Paggiari, P., Sicari, R., De Caterina, R. (1992) Inhibition of eicosanoid formation and lipocortin induction by glucocorticoids in human cell lines and in patients with inflammatory lung disease. Pharmacol. Res. 26(Suppl. 2),44-45
  33. Perretti, M., Flower, R. J. (1993) Modulation of IL-1-induced neutrophil migration by dexamethasone and lipocortin 1. J. Immunol. (USA) 150,992-999
  34. Comera, C., Russo-Marie, F. (1995) Glucocorticoid-induced annexin 1 secretion by monocytes and peritoneal leukocytes. Br. J. Pharmacol. 115,1043-1047[Medline]
  35. Wu, C. C., Croxtall, J. D., Perretti, M., Bryant, C. E., Thiemermann, C., Flower, R. J., Vane, J. R. (1995) Lipocortin 1 mediates the inhibition by dexamethasone of the induction by endotoxin of nitric oxide synthase in the rat. Proc. Natl. Acad. Sci. USA 92,3473-3477[Abstract/Free Full Text]
  36. White, P. C., Mune, T., Agarwal, A. K. (1997) 11ß-hydroxysteroid dehydrogenase and the syndrome of apparent mineralocorticoid excess. Endocr. Rev. 18,135-156[Abstract/Free Full Text]
  37. Broennegard, M., Andersson, O., Edwall, D., Lund, J., Norstedt, G., Carlstedt-Duke, J. (1988) Human calpactin II (lipocortin I) messenger ribonucleic acid is not induced by glucocorticoids. Mol. Endocrinol. 2,732-739[Abstract/Free Full Text]
  38. Bienkowski, M. J., Petro, M. A., Robinson, L. J. (1989) Inhibition of thromboxane synthesis in U973 cells by glucocorticoids. J. Biol. Chem. 264,6536-6544[Abstract/Free Full Text]
  39. Fairchild, C. R., Moscow, J. A., O’Brien, E. E., Cowan, K. H. (1990) Multidrug resistance in cells transfected with human genes encoding a variant P-glycoprotein and glutathione S-transferase-pi. Mol. Pharmacol. 37,801-809[Abstract]
  40. Donnelly, S. R., Moss, S. E. (1998) Functional analysis of the human annexin I and VI gene promoters. Biochem. J. 332,681-687
  41. Gunteski-Hamblin, A. M., Song, G., Walsh, R. A., Frenzke, M., Boivin, G. P., Dorn, G. W., 2nd, Kaetzel, M. A., Horseman, N. D., Dedman, J. R. (1996) Annexin VI overexpression targeted to heart alters cardiomyocyte function in transgenic mice. Am. J. Physiol. 270,H1091-H1100[Abstract/Free Full Text]
  42. Graham, M. E., Gerke, V., Burgoyne, R. D. (1997) Modification of annexin II expression in PC12 cell lines does not affect Ca2+-dependent exocytosis. Mol. Biol. Cell 8,431-442[Abstract]
  43. Pokutta, S., Herrenknecht, K., Kemler, R., Engel, J. (1994) Conformational changes of the recombinant extracellular domain of E-cadherin upon calcium binding. Eur. J. Biochem. 223,1019-1026[Medline]
  44. Nagar, B., Overduin, M., Ikura, M., Rini, J. M. (1996) Structural basis of calcium-induced E-cadherin rigidification and dimerization. Nature (London) 380,360-364[Medline]
  45. Hunt, N. C., Douglas-Jones, A. G., Jasani, B., Morgan, J. M., Pignatelli, M. (1997) Loss of E-cadherin expression associated with lymph node metastases in small breast carcinomas. Virchows Arch 430,285-289[Medline]
  46. Chen, H., Paradies, N. E., Fedor-Chaiken, M., Brackenbury, R. (1997) E-cadherin mediates adhesion and suppresses cell motility via distinct mechanisms. J. Cell Sci. 110,345-356[Abstract]
  47. Bracke, M. E., Charlier, C., Bruyneel, E. A., Labit, C., Mareel, M. M., Castronovo, V. (1994) Tamoxifen restores E-cadherin function in human breast cancer MCF-7/6 cells and suppresses their invasive phenotype. Cancer Res 54,4607-4609[Abstract/Free Full Text]
  48. Charlier, C., Bruyneel, E., Lechanteur, C., Bracke, M., Mareel, M., Castronovo, V. (1996) Enhancement of tamoxifen-induced E-cadherin function by Ca2+ channel antagonists in human breast cancer MCF7/6 cells. Eur. J. Pharmacol. 317,413-416[Medline]
  49. Jiang, W. G. (1996) E-cadherin and its associated protein catenins, cancer invasion and metastasis. Br. J. Surg. 83,437-446[Medline]
  50. Zschiesche, W., Schonborn, I., Behrens, J., Herrenknecht, K., Hartveit, F., Lilleng, P., Birchmeier, W. (1997) Expression of E-cadherin and catenins in invasive mammary carcinomas. Anticancer Res 17,561-567[Medline]
  51. Vermeulen, S. J., Bruyneel, E. A., van Roy, F. M., Mareel, M. M., Bracke, M. E. (1995) Activation of the E-cadherin/catenin complex in human MCF-7 breast cancer cells by all-trans-retinoic acid. Br. J. Cancer 72,1447-1453[Medline]
  52. Aghib, D. F., McCrea, P. D. (1995) The E-cadherin complex contains the src substrate p120. Exp. Cell Res. 218,359-369[Medline]
  53. Gilmore, A. P., Romer, L. H. (1996) Inhibition of focal adhesion kinase (FAK) signaling in focal adhesions decreases cell motility and proliferation. Mol. Biol. Cell 7,1209-1224[Abstract]
  54. Weiner, T. M., Liu, E. T., Craven, R. J., Cance, W. G. (1993) Expression of focal adhesion kinase gene and invasive cancer. Lancet 342,1024-1025[Medline]
  55. Owens, L. V., Xu, L., Craven, R. J., Dent, G. A., Weiner, T. M., Kornberg, L., Liu, E. T., Cance, W. G. (1995) Overexpression of the focal adhesion kinase (p125FAK) in invasive human tumors. Cancer Res 55,2752-2755[Abstract/Free Full Text]
  56. Cary, L. A., Chang, J. F., Guan, J. L. (1996) Stimulation of cell migration by overexpression of focal adhesion kinase and its association with Src and Fyn. J. Cell Sci. 109,1787-1794[Abstract]
  57. Reinhard, M., Halbrugge, M., Scheer, U., Wiegand, C., Jockusch, B. M., Walter, U. (1992) The 46/50 kDa phosphoprotein VASP purified from human platelets is a novel protein associated with actin filaments and focal contacts. EMBO J 11,2063-2070[Medline]
  58. Brindle, N. P., Holt, M. R., Davies, J. E., Price, C. J., Critchley, D. R. (1996) The focal-adhesion vasodilator-stimulated phosphoprotein (VASP) binds to the proline-rich domain in vinculin. Biochem. J. 318,753-757
  59. Rodriguez Fernandez, J. L., Geiger, B., Salomon, D., Sabanay, I., Zoller, M., Ben-Zeíev, A. (1992) Suppression of tumorigenicity in transformed cells after transfection with vinculin cDNA. J. Cell Biol. 119,427-438[Abstract/Free Full Text]
  60. Coll, J. L., Ben-Zeíev, A., Ezzell, R. M., Rodriguez Fernandez, J. L., Baribault, H., Oshima, R. G., Adamson, E. D. (1995) Targeted disruption of vinculin genes in F9 and embryonic stem cells changes cell morphology, adhesion and locomotion. Proc. Natl. Acad. Sci. USA 92,9161-9165[Abstract/Free Full Text]
  61. Ways, D. K., Kukoly, C. A., deVente, J., Hooker, J. L., Bryant, W. O., Posekany, K. J., Fletcher, D. J., Cook, P. P., Parker, P. J. (1995) MCF-7 breast cancer cells transfected with protein kinase C-{alpha} exhibit altered expression of other protein kinase C isoforms and display a more aggressive neoplastic phenotype. J. Clin. Invest. 95,1906-1915
  62. Bazzi, M. D., Nelsestuen, G. L. (1993) Protein kinase C and annexins: unusual calcium response elements in the cell. Cell. Signal. 5,357-365[Medline]
  63. Dubois, T., Oudinet, J. P., Mira, J. P., Russo-Marie, F. (1996) Annexins and protein kinases C. Biochim. Biophys. Acta 1313,290-294[Medline]
  64. Blobe, G. C., Sachs, C. W., Khan, W. A., Fabbro, D., Stabel, S., Wetsel, W. C., Obeid, L. M., Fine, R. L., Hannun, Y. A. (1993) Selective regulation of expression of protein kinase C (PKC) isoenzymes in multidrug-resistant MCF-7 cells. Functional significance of enhanced expression of PKC alpha. J. Biol. Chem. 268,658-664[Abstract/Free Full Text]
  65. Berridge, M. J. (1987) Inositol trisphosphate and diacylglycerol: two interacting second messengers. Annu. Rev. Biochem. 56,159-193[Medline]
  66. Mitchell, R. H. (1975) Inositol phospholipids and cell surface receptor function. Biochim. Biophys. Acta 415,81-147[Medline]
  67. Mouillac, B., Balestre, M. N., . Guillon,G (1989) Transient inositol (1,4,5) trisphosphate accumulation under vasopressin stimulation in WRK1 cells: correlation with intracellular calcium mobilization. Biochem. Biophys. Res. Commun. 159,953-960[Medline]
  68. Guillon, G., Mouillac, B., Berrada, R., Balestre, M. N., Lombard, C. (1989) Properties of membranous phospholipase C from WRK1 cell: sensitivity to guanylnucleotides and bacterial toxins. Cell Signal 1,541-552[Medline]
  69. Solito, E., Raguenes-Nicol, C., de Coupade, C., Bisagni-Faure, A., Russo-Marie, F. (1998) U937 cells deprived of endogenous annexin I demonstrate an increased PLA2 activity. Br. J. Pharmacol. 124,1675-1683[Medline]
  70. Hayashi, J., Liu, P., Ferguson, S. E., Wen, M., Sakata, T., Teroka, H., Drinker Riley, H., III (1993) Arachidonic acid metabolism in cells transfected with sense and anti-sense cDNA to annexin 1. Biochem. Mol. Biol. Int. 31,143-151[Medline]
  71. Piltch, A., Sun, L., Fava, R. A., Hayashi, J. (1989) Lipocortin-independent effect of dexamethasone on phospholipase activity in a thymic epithelial cell line. Biochem. J. 261,395-400[Medline]
  72. Willmott, N. J., Choudhury, Q., Flower, R. J. (1997) Effects of dexamethasone and phorbol ester on P2 receptor coupled Ca2+ signalling and lipocortin 1 presentation in U937 cells. Br. J. Pharmacol. 122,1055-1060[Medline]
  73. Buckland, A. G., Wilton, D. C. (1998) Inhibition of human cytosolic phospholipase A2 by human annexin V. Biochem. J. 329,369-372
  74. Bezprozvanny, I., Watras, J., Ehrlich, B. E. (1991) Bell-shaped calcium response curves of Ins (1,4,5)P3-and calcium-gated channels from endoplasmic reticulum of cerebellum. Nature (London) 351,751-754[Medline]



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
Z. Wu and W. D. Bowen
Role of Sigma-1 Receptor C-terminal Segment in Inositol 1,4,5-Trisphosphate Receptor Activation: CONSTITUTIVE ENHANCEMENT OF CALCIUM SIGNALING IN MCF-7 TUMOR CELLS
J. Biol. Chem., October 17, 2008; 283(42): 28198 - 28215.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
S Greco, C Storelli, and S Marsigliante
Protein kinase C (PKC)-{delta}/-{varepsilon} mediate the PKC/Akt-dependent phosphorylation of extracellular signal-regulated kinases 1 and 2 in MCF-7 cells stimulated by bradykinin
J. Endocrinol., January 1, 2006; 188(1): 79 - 89.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
M. N. Kundranda, M. Henderson, K. J. Carter, L. Gorden, A. Binhazim, S. Ray, T. Baptiste, M. Shokrani, M. L. Leite-Browning, W. Jahnen-Dechent, et al.
The Serum Glycoprotein Fetuin-A Promotes Lewis Lung Carcinoma Tumorigenesis via Adhesive-Dependent and Adhesive-Independent Mechanisms
Cancer Res., January 15, 2005; 65(2): 499 - 506.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
D. H. Nguyen, H. Toshida, J. Schurr, and R. W. Beuerman
Microarray analysis of the rat lacrimal gland following the loss of parasympathetic control of secretion
Physiol Genomics, June 17, 2004; 18(1): 108 - 118.
[Abstract] [Full Text] [PDF]


Home page
Arch Otolaryngol Head Neck SurgHome page
J. P. Rodrigo, J. M. Garcia-Pedrero, M. V. Gonzalez, M. P. Fernandez, C. Suarez, and A. Herrero
Expression of Annexin A1 in Normal and Chronically Inflamed Nasal Mucosa
Arch Otolaryngol Head Neck Surg, February 1, 2004; 130(2): 211 - 215.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. ProteomicsHome page
S. Desrivieres, T. Prinz, N. Castro-Palomino Laria, M. Meyer, G. Boehm, U. Bauer, J. Schafer, T. Neumann, C. Shemanko, and B. Groner
Comparative Proteomic Analysis of Proliferating and Functionally Differentiated Mammary Epithelial Cells
Mol. Cell. Proteomics, October 1, 2003; 2(10): 1039 - 1054.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
S.-H. Liu, C.-Y. Lin, S.-Y. Peng, Y.-M. Jeng, H.-W. Pan, P.-L. Lai, C.-L. Liu, and H.-C. Hsu
Down-Regulation of Annexin A10 in Hepatocellular Carcinoma Is Associated with Vascular Invasion, Early Recurrence, and Poor Prognosis in Synergy with p53 Mutation
Am. J. Pathol., May 1, 2002; 160(5): 1831 - 1837.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
V. Gerke and S. E. Moss
Annexins: From Structure to Function
Physiol Rev, April 1, 2002; 82(2): 331 - 371.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
J. S. Kang, B. F. Calvo, S. J. Maygarden, L. S. Caskey, J. L. Mohler, and D. K. Ornstein
Dysregulation of Annexin I Protein Expression in High-Grade Prostatic Intraepithelial Neoplasia and Prostate Cancer
Clin. Cancer Res., January 1, 2002; 8(1): 117 - 123.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by FREY, B. M.
Right arrow Articles by FREY, F. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by FREY, B. M.
Right arrow Articles by FREY, F. J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS