FASEB J.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by VILA-CORO, A. J.
Right arrow Articles by MELLADO, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by VILA-CORO, A. J.
Right arrow Articles by MELLADO, M.
(The FASEB Journal. 1999;13:1699-1710.)
© 1999 FASEB

The chemokine SDF-1{alpha} triggers CXCR4 receptor dimerization and activates the JAK/STAT pathway

ANTONIO J. VILA-CORO, JOSÉ MIGUEL RODRÍGUEZ-FRADE, ANA MARTÍN DE ANA, MA CARMEN MORENO-ORTÍZ, CARLOS MARTÍNEZ-A1 and MARIO MELLADO

Department of Immunology and Oncology, Centro Nacional de Biotecnología, CSIC-Universidad Autónoma de Madrid, Campus de Cantoblanco, E-28049 Madrid, Spain

1Correspondence: Department of Immunology and Oncology, Centro Nacional de Biotecnología, CSIC, Universidad Autónoma de Madrid, Campus de Cantoblanco, E-28049 Madrid, Spain. E-mail cmartineza{at}cnb.uam.es


   ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
The chemokine stromal cell-derived factor (SDF-1{alpha}), the ligand for the CXCR4 receptor, induces a wide variety of effects that include calcium mobilization, chemotactic responses, bone marrow myelopoiesis, neuronal patterning, and prevention of HIV-1 infection. Nonetheless, little is known of the biochemical pathways required to achieve this variety of responses triggered after receptor–chemokine interaction. We developed a set of monoclonal antibodies that specifically recognize the CXCR4 receptor and used them to identify the signaling pathway activated after SDF-1{alpha} binding in human T cell lines. Here we demonstrate that SDF-1{alpha} activation promotes the physical association of G{alpha}i with the CXCR4. Furthermore, within seconds of SDF-1{alpha} activation, the CXCR4 receptor becomes tyrosine phosphorylated through the activation and association with the receptor of JAK2 and JAK3 kinases. After SDF-1{alpha} binding, JAK2 and JAK3 associate with CXCR4 and are activated, probably by transphosphorylation, in a G{alpha}i-independent manner. This activation enables the recruitment and tyrosine phosphorylation of several members of the STAT family of transcription factors. Finally, we have also observed SDF-1{alpha}-induced activation and association of the tyrosine phosphatase Shp1 with the CXCR4 in a G{alpha}i-dependent manner. As occurs with the cytokine receptors in response to cytokines, the CXCR4 undergoes receptor dimerization after SDF-1{alpha} binding and is a critical step in triggering biological responses. We present compelling evidence that the chemokines signal through mechanisms similar to those activated by cytokines.—Vila-Coro, A. J., Rodríguez-Frade, J. M., Martín de Ana, A., Moreno-Ortíz, M. C., Martínez-A., C., Mellado, M. The chemokine SDF-1{alpha} triggers CXCR4 receptor dimerization and activates the JAK/STAT pathway.


Key Words: chemotactic response • tyrosine phosphorylation • Shp1 • G-proteins


   INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
CHEMOKINES, A LARGE FAMILY of low molecular mass (8–10 kDa) cytokines, have a chemotactic and a pro-activating effect on different leukocyte lineages both in vitro and in vivo (1 , 2) . Chemokines have been classified into two main categories, the CXC and the CC chemokines, according to the position of their first two conserved cysteine residues. CXC chemokines, including interleukin 8 (IL-8)2 , MGSA/gro, IP-10, Mig, and stromal cell-derived factor 1{alpha} (SDF-1{alpha}), have been classically described as neutrophil chemoattractants, whereas CC chemokines, comprising monocyte chemoattractant protein-1 (MCP-1), -2, -3, -4, macrophage-inflammatory protein-1{alpha} (MIP-1{alpha}), MIP-1ß, RANTES (regulated on activation, normal T expressed and excreted), I-309, TARC, LARC, and others, mainly attract monocytes, eosinophils, and basophils; members of both families have chemotactic activity on different lymphocyte lineages (1 , 2) . Two chemokines that fall into neither category have recently been cloned. Lymphotactin is the only member of the C subfamily (3) , whereas fractalkine is a CX3C chemokine with a long mucin-like stalk and a transmembrane region (4) .

Chemokine receptors are members of the seven-transmembrane domain G-protein-coupled receptors, which have also been divided in two main subfamilies (CXCR and CCR), depending on their chemokine specificity (1 , 2 , 5) . Chemokine receptor expression is heterogeneous among different cells of the leukocyte lineage and is regulated at the transcriptional level (6) . Chemokines have also been the focus of attention since they act as receptors for different HIV-1 strains. CCR5 has been shown to function as a receptor for macrophage-tropic HIV-1 strains (7 , 8) , whereas CXCR4 acts as a receptor for T cell-tropic HIV-1 strains (9 , 10) and HIV-2 (11) ; HIV-1 strains have now been redefined as R5 and X4, depending on their ability to interact with CCR5 or CXCR4, respectively.

Although most chemokine receptors bind several chemokines, CXCR1 and CXCR4 are specific for only one physiological ligand. CXCR1 interacts with IL-8, whereas the CXC-chemokine SDF-1{alpha} is the only ligand identified so far for CXCR4 (1 , 2) . This chemokine, cloned by a gene trapping strategy, was first isolated from stromal cell culture supernatants (12) . Its chemotactic properties on peripheral blood lymphocytes (13) , CD34+ progenitor cells (14) , and pre- and pro-B cell lines (15) have been described. Knockout mice lacking the SDF-1{alpha} protein show abnormalities in B cell lymphopoiesis, bone marrow myelopoiesis, lack of blood vessel formation in the gut, and severe ventricular septal defects (16) . A similar profile of deficiencies is found in CXCR4-deficient mice (17 , 18) .

The activation signals after SDF-1{alpha} stimulation are not well defined, and various signal transduction pathways have been implicated through the association of CXCR4 receptors with guanine nucleotide binding protein (G-proteins) (19) . For example, stimulation of CXCR4 transfectants by SDF-1{alpha} results in increased phosphorylation of focal adhesion components, including the related adhesion focal tyrosine kinase (RAFTK/Pyk2), Crk, and paxillin. SDF-1{alpha}-induced activation of the p44/42 MAP kinases (Erk 1 and 2), PI3 kinase, and NF-{kappa}B (20) has also been described, implicating this chemokine in modulation of signaling molecules and transcription factors that mediate changes in the cytoskeletal apparatus and also regulate cell growth.

Activation of some STAT transcription factor family members has been described in T cells after RANTES or MIP-1{alpha} stimulation (21) . We recently demonstrated that MCP-1 and RANTES trigger tyrosine phosphorylation of their receptors and activation of the JAK/STAT pathway in a PTX-independent manner (22 , 23) . This JAK activation plays a critical downstream role for all other signaling events, including the association between the receptor and the G{alpha}i proteins (22) . Here we show that, as occurs with the cytokine receptors, CXCR4 undergoes receptor dimerization after SDF-1{alpha} binding. We then analyze SDF-1{alpha} activation of the JAK/STAT pathway, demonstrating that both JAK3 and JAK2 are activated and associated with the CXCR4. This activation enables the recruitment and tyrosine phosphorylation of several members of the STAT family of transcription factors. The phosphatase Shp1 is also activated, translocated to the membrane, and associated with the receptor as a consequence of SDF-1{alpha} activation. All together, these data demonstrate that the activation of the JAK/STAT pathway is a general signaling pathway for both CC and CXC chemokines and implicate the Shp phosphate family in the shutdown responses triggered by chemokines. Last, we present compelling evidence that the chemoattractant cytokines (chemokines) as well as the cytokines signal via mechanisms shared by these two protein families.


   MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Biological materials
MOLT4 (DSMZ ACC362) and Mono Mac 1 (DSMZ ACC252) cells were obtained from the German Collection of Microorganisms and Cell Cultures (Braunschweig, Germany); IM9 (ATCC CCL159) and Jurkat cells (ATCC TIB152) were from the American Type Culture Collection (ATCC, Manassas, Va.). Antibodies used include monoclonal horseradish peroxidase (PO) -labeled anti-PTyr (4G10) (Upstate Biotechnology, Lake Placid, N.Y.), anti-Shp1 (Transduction Laboratories, Lexington, Ky.), anti-ß2-microglobulin (PharMingen, San Diego, Calif.), rabbit anti-PTyr (Promega Corporation, Madison, Wis.), anti-JAK1, -JAK2, and -JAK3 (Upstate Biotechnology), anti-G{alpha}{iota}, -G{alpha}s, anti-STAT1 to -STAT6, and anti-Pol II (Santa Cruz Biotechnology Inc., Santa Cruz, Calif.), and anti-ß-actin (Sigma, St. Louis, Mo.).

Preparation of monoclonal antibodies (mAb)
Peptides of CXCR4 receptor amino acid sequences 25–35 and 20–37 were synthesized, coupled to keyhole limpet hemocyanin (Calbiochem, La Jolla, Calif.), and used as immunogens as described (24) . Spleen and/or lymph node cells from immunized mice were fused with the P3X63-Ag8.653 myeloma cell line (ATCC CRL 1580) following standard protocols. Supernatants were tested for antibodies in enzyme-linked immunoassay (ELISA) and positive hybridomas cloned by limiting dilution. Isotypes were determined in ELISA using PO-labeled, subclass-specific anti-mouse immunoglobulin antibody (Southern Biotechnologies Associates, Birmingham, Ala.). Monoclonal antibodies were purified by ammonium sulfate precipitation (25) and chromatography on Sephacryl S-200 (Pharmacia Biotech, Uppsala, Sweden).

Antibody capture ELISA
ELISA was performed as described previously (26) ; briefly, synthetic peptides [3 µg/ml in phosphate-buffered saline (PBS), 100 µl/well] were adsorbed to microtiter plates (Maxi-Sorb, Nunc, Denmark) after blocking, mAb were incubated, and the reaction was developed using a PO-labeled goat anti-mouse immunoglobulin antibody (GAM-PO; Tago Inc., Burlingame, Calif.) and OPD (Sigma).

Flow cytometry analysis
Cells were centrifuged (250 x g, 10 min, room temperature), plated in V-bottom 96-well plates (2.5 x 105 cells/well), and incubated with a biotin-labeled mAb (1 µg/50 µl/well for 60 min, 4°C) that had been preincubated with the immunizing peptide CXCR4 (25 26 27 28 29 30 31 32 33 34 35) , with the CCR2 (24 25 26 27 28 29 30 31 32 33 34 35 36 37 38) control peptide (10 µg/well, 60 min, 4°C), or with PBS. Cells were washed twice in PBS with 2% bovine serum albumin (BSA) and 2% fetal calf serum (FCS) and centrifuged (250 x g, 5 min, 4°C). Fluorescein isothiocyanate-labeled streptavidin (Southern Biotechnologies) was added, incubated (30 min, 4°C), and plates were washed twice. Cell-bound fluorescence was determined in a Profile XL flow cytometer at 525 nm (Coulter Electronics, Miami, Fla.).

Calcium determination
Changes in intracellular calcium concentration were monitored using the fluorescent probe Fluo-3AM (Calbiochem). Cells (2.5 x 106 cells/ml), untreated or treated for 16 h with cholera toxin (CTX; 0.4 µg/ml, Sigma), pertussis toxin (PTX; 0.1 µg/ml, Sigma), AG490, or tyrphostin A1 (both at 25 µM; Calbiochem-Novabiochem, La Jolla, Calif.), were resuspended in RPMI containing 10% FCS and 10 mM HEPES and incubated with Fluo-3AM (300 µM in DMSO, 10 µl/106 cells) for 15 min at 37°C. After incubation, cells were washed and resuspended in complete medium containing 2 mM CaCl2 and maintained at 4°C until just before SDF-1{alpha} addition to minimize membrane trafficking and eliminate spontaneous Ca2+ entry. Calcium mobilization in response to 10 nM SDF-1{alpha} (PeproTech) was determined at 37°C in an EPICS XL flow cytometer at 525 nm, and includes background level stabilization and determination of the level of probe loaded for each sample. Only samples with similar load, as assessed by determination of Ca2+ mobilization induced by a ionophore (ionomycin, Sigma, 5 µg/ml), are considered acceptable.

Cell migration
MOLT4 cells, untreated or treated for 16 h with CTX, PTX, AG490, or tyrphostin A1, as described above, were placed (0.25 x 106 cells in 0.1 ml) in the upper well of 24-well transmigration chambers (5 µM pore size; Transwell; Costar Corp., Cambridge, Mass.), and 10 nM SDF-1{alpha} (in 0.6 ml RPMI containing 0.25% BSA) was added to the lower well. Plates were incubated (120 min, 37°C) and the cells that had migrated to the lower chamber were counted as described (27) .

Immunoprecipitation, sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), and Western blot analysis
SDF-1{alpha}-stimulated cells (20 x 106) were lysed in a detergent buffer (20 mM triethanolamine pH 8.0, 300 mM NaCl, 2 mM EDTA, 20% glycerol, 1% digitonin with 10 µM sodium orthovanadate, 10 µg/ml leupeptin, and 10 µg/ml aprotinin) for 30 min at 4°C with continuous rocking, then centrifuged (15,000 x g, 15 min). The amount of protein present in the cell lysates was controlled before immunoprecipitation by using a protein detection kit (Pierce, Rockford, Ill.). Immunoprecipitation was performed essentially as described (22) . Protein extracts precleared by incubation with 20 µg of anti-mouse IgM-agarose (Sigma) or protein A-Sepharose (60 min, 4°C) and centrifuged (15,000 x g, 1 min) were immunoprecipitated with the appropriate antibody (5 µg/sample, 120 min, 4°C), followed by anti-mouse IgM-agarose or protein A-Sepharose if the first antibody was derived from rabbit serum. Immunoprecipitates or protein extracts were separated in SDS-PAGE and transferred to nitrocellulose membranes. Western blot analysis was performed as described (22) , using 2% BSA in TBS as blocking agent for the anti-phosphotyrosine analyses. When stripping was required, membranes were incubated (60 min, 60°C) with 62.5 mM Tris-HCl pH 7.8, containing 2% SDS, and 0.5% ß-mercaptoethanol. After washing with 0.1% Tween 20 in TBS for 2 h, membranes were reblocked, reprobed with the appropriate antibody, and developed as above. In all cases, protein loading was controlled by using a protein detection kit (Pierce) and, when necessary, by reprobing the membrane with the immunoprecipitating antibody.

Cross-linking
Serum-starved MOLT4 cells (15 x 106) were either unstimulated or stimulated with 10 nM SDF-1{alpha} or RANTES for 1 min at 37°C. The reaction was terminated by adding 1 ml of cold PBS, then centrifuged (150 x g, 10 min). After washing twice with cold PBS, 10 µl of 100 mM DSS (Pierce) was added for 10 min at 4°C, with continuous rocking. The reaction was terminated by addition of 1 ml of cold PBS and washed three times. The pellet was lysed for 60 min and immunoprecipitated as described above.

Nuclear extract preparation
Nuclear extracts were prepared from SDF-1{alpha}-stimulated MOLT 4 cells (10 x 106). Where indicated, pervanadate was prepared by incubating equal volumes of 12 mM Na3VO4 (freshly dissolved in water, Sigma) and 12 mM H2O2 at room temperature for 20 min, then added to cells during serum starvation (60 min, final concentration of 60 µM). Briefly, cells were washed with ice-cold PBS, resuspended in 1 ml of buffer A (50 mM NaCl, 0.5 M sucrose), incubated 2 min at 4°C and pelleted (4500 x g, 3 min, 4°C). They were then resuspended in 1 ml of buffer B (50 mM NaCl, 25% glycerol), pelleted (4500 x g, 3 min, 4°C), and incubated in 60 µl of buffer C (350 mM NaCl, 25% glycerol) for 30 min at 4°C with continuous rocking. After centrifugation (20,000 x g, 20 min, 4°C), supernatants containing nuclear extracts were aliquoted and stored at -80°C. All buffers contained 0.5 mM spermidine, 0.15 mM spermine, 0.1 mM EDTA, 10 mM HEPES pH 8, 0.5 mM PMSF, 2 µg/ml leupeptin, 3 µg/ml pepstatin, 0.2 IU/ml aprotinin, 1.75 mM ß-mercaptoethanol, 1 mM orthovanadate, and 10 mM NaF.

For Western blot analysis, 20 µg of nuclear extracts for each condition, prepared as before, were separated in SDS-PAGE and transferred to nitrocellulose membranes. Western blot analysis was performed as above and developed by using anti-STAT3 and anti-STAT5b antibodies (Santa Cruz).

Electrophoretic mobility shift assay (EMSA)
Nuclear extracts (10 µg) from untreated or chemokine-treated cells were analyzed in binding reactions. Briefly, extracts were incubated with 0.5 ng of 32P-end-labeled, double-stranded oligodeoxynucleotides containing the sis-inducible element (SIE) of the c-fos promoter sequence [GGGGTGCATTTCCCGTAAATCTTGTCT] (wild type; wt-SIE); where indicated, a mutant version of this sequence was used that is unable to bind STAT proteins [GGGGTGCA TCCACCGTAAATCTTGTCT] (mut-SIE). The binding reaction was carried out in EMSA buffer for 30 min at room temperature (final volume 10 µl) with 1.5 µg of poly(dI-dC) and, where indicated, a 20-fold molar excess of unlabeled SIE or nonspecific oligonucleotide competitor. Protein–DNA complexes were resolved on a 4.5% polyacrylamide gel using 0.5x Tris borate-EDTA as running buffer. EMSA buffer contained 10 mM Tris pH 7.5, 50 mM NaCl, 1 mM dithiothreitol (DTT), 1 nM EDTA, and 5% glycerol. The amount of protein present in the nuclear extracts was controlled before Western blot or EMSA by using a protein detection kit (Pierce).


   RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
SDF-1{alpha} induces functional responses in MOLT4 cells
Anti-human CXCR4-specific mAb were developed using synthetic peptides corresponding to the amino-terminal domain of this receptor (amino acids 25–35), a sequence not present in other chemokine receptors. These mAb recognize the CXCR4 in lymphocytes derived from human PBMC and tonsils (not shown) and in various human cell lines known to express a functional CXCR4, including T (MOLT4, Jurkat), B (IM9), and monocytic cell lines (Mono Mac 1), as shown by flow cytometry (Fig. 1 A) and in Western blot analysis (Fig. 1B ). In both flow cytometry and Western blot, specific recognition could be aborted by preincubation of the mAb with the immunizing peptide, but not when a peptide corresponding to the amino-terminal domain of the CCR2 (amino acids 24–38) was used (Fig. 1A, B ).



View larger version (35K):
[in this window]
[in a new window]
 
Figure 1. CXCR4–01 mAb binds CXCR4 specifically. A) Cells as indicated were incubated with biotin-labeled CXCR4–01 monoclonal antibody, followed by FITC-labeled streptavidin. The figure shows mAb binding compared with that of a negative control (mIgM). The effect of preincubation with the immunizing peptide CXCR4 (25 26 27 28 29 30 31 32 33 34 35) or a control peptide CCR2 (24 25 26 27 28 29 30 31 32 33 34 35 36 37 38) on CXCR4–01 binding to MOLT4 cells is also shown. B) In Western blot, CXCR4–01 binding to MOLT4 cell lysates (lane A) is not displaced by the CCR2 (24 25 26 27 28 29 30 31 32 33 34 35 36 37 38) peptide (lane B), and is displaced by the immunizing CXCR4 (25 26 27 28 29 30 31 32 33 34 35) peptide (lane C). As a control, MOLT4 cell lysates were also incubated with an IgM mAb (lane D). Protein load was controlled using a protein detection kit.

In response to SDF-1{alpha}, the MOLT4 cell line mobilizes calcium, which is desensitized in response to a second stimulation (Fig. 2 A), and also triggers cell migration (Fig. 2B ). PTX treatment abrogates both calcium release (Fig. 2A ) and cell migration responses (Fig. 2B ), whereas no effect was observed after incubation with CTX (not shown). This is consistent with other studies showing that SDF-1{alpha} downstream signals are coupled to PTX-sensitive G-proteins (28) .



View larger version (26K):
[in this window]
[in a new window]
 
Figure 2. PTX treatment blocks both SDF-1{alpha}-induced Ca2+ influx and transmigration. A) SDF-1{alpha} (10 nM) -induced Ca2+ mobilization in MOLT4 cells, untreated or preincubated with PTX, was determined in a flow cytometer at 525 nm. The result of one of three experiments performed is shown. Results are expressed as a percentage of the maximum chemokine response. Equivalent Fluo-3AM loading was determined as indicated in Material and Methods. B) SDF-1{alpha}-induced chemotaxis of MOLT4 cells, untreated or pretreated with PTX, was assayed in transwell chemotaxis chambers. Cells suspended in RPMI 1640, 10% FCS were allowed to migrate for 2 h at 37°C in a 5% CO2 atmosphere. Cells migrating to the lower chamber were counted and expressed as a migration index, calculated as the x-fold increase over the negative control. C) SDF-1{alpha}-induced (10 nM) MOLT4 cell lysates were immunoprecipitated with anti-CXCR4 (CXCR4–01) or mIgM antibodies as control and the Western blot was developed with anti-G{alpha}i and -G{alpha}s antibodies. To control for CXCR4 protein loading equivalence, the blot was stripped and developed with the immunoprecipitating anti-CXCR4 antibody.

Using the CXCR4-specific mAb CXCR4–01, we analyzed the physical association between the CXCR4 receptor and the G{alpha}i subunit of the heterotrimeric Gi protein in response to ligand binding. A CXCR4 receptor-associated G{alpha}i protein was immunoprecipitated and detected in Western blot using an anti-G{alpha}i-specific antibody (Fig. 2C ). This association is initiated within 60 s of SDF-1{alpha} triggering and persists for 5 min after chemokine binding. When the same assay was performed using anti-G{alpha}s-specific antibody, however, no association was found, indicating the specificity of association of the G{alpha}i with the CXCR4 receptor. We therefore conclude that the CXCR4 receptor regulates calcium release and couples to the G{alpha}i protein in MOLT4 cells after SDF-1{alpha} binding.

SDF-1{alpha} induces tyrosine phosphorylation of the CXCR4 receptor
When SDF-1{alpha}-activated MOLT4 cell lysates were immunoprecipitated with anti-PTyr and Western blots developed with anti-CXCR4 receptor antibodies (Fig. 3 A, upper panel), or precipitated with anti-CXCR4 and developed with anti-PTyr antibody (Fig. 3A , lower panel), the same phosphorylated 40 kDa band was observed in both cases, confirming tyrosine phosphorylation of the CXCR4 on SDF-1{alpha} stimulation. No differences were observed in the amount of CXCR4 in each lane (Fig. 3A , lower panel) when the same membrane was stripped and reblotted with anti-CXCR4 antibody. An increase in CXCR4 receptor phosphorylation is seen as early as 60 s after SDF-1{alpha} stimulation; phosphorylation persists for 5 min, decreasing thereafter. We have observed residual phosphorylation of CXCR4 in untreated cells (Fig. 3A ), the significance of which is discussed below.



View larger version (46K):
[in this window]
[in a new window]
 
Figure 3. SDF-1{alpha} induces tyrosine phosphorylation of the CXCR4 and JAK activation. A) SDF-1{alpha} (10 nM) -induced MOLT4 cell lysates were immunoprecipitated with anti-PTyr antibodies and developed in Western blot with anti-CXCR4 mAb (CXCR4–01) (upper panel) or immunoprecipitated with CXCR4–01 mAb and developed with anti-PTyr (lower panel). As a control, an unstimulated, unprecipitated MOLT4 lysate and an SDF-1{alpha}-induced MOLT4 cell lysate immunoprecipitated with control rabbit IgG (rIgG, upper panel) or mouse IgM (mIgM, lower panel) were analyzed in Western blot with CXCR4–01 mAb. CXCR4 protein loading in CXCR4 immunoprecipitates was controlled by reprobing the membrane with CXCR4–01. B) Cells stimulated as in panel A were immunoprecipitated with anti-CXCR4 mAb or mouse IgM as a control and tested in Western blot with anti-JAK1, -JAK2, or -JAK3 antibodies, as indicated. Equivalent receptor loading was controlled by reprobing each membrane with CXCR4–01 mAb. As a positive control, unprecipitated MOLT4 cell lysates were tested in Western blot with anti-JAK antibody. C) SDF-1{alpha} (10 nM) -induced MOLT4 cell lysates were immunoprecipitated with anti-PTyr antibodies and analyzed in Western blot with anti-JAK2 and -JAK3 antibodies. Equivalent protein loading in each lane was controlled as described in Materials and Methods.

SDF-1{alpha} induces rapid JAK activation and association with the CXCR4 in a PTX-independent manner
As we described previously, the JANUS kinase family member JAK2 is responsible for CCR2 receptor phosphorylation (22) . To identify the kinase responsible for the rapid Tyr phosphorylation of the CXCR4 chemokine receptor, SDF-1{alpha}-stimulated MOLT4 cell lysates were immunoprecipitated with anti-CXCR4 or with anti-ß2-microglobulin as an isotype-matched antibody control. Anti-JAK2 antibodies identified a 130 kDa protein in the anti-CXCR4 immunoprecipitate (Fig. 3B ). Whereas only JAK2 associates with the CCR2 in MCP-1-stimulated Mono Mac 1 cells, when MOLT4 cells were activated by SDF-1{alpha} not only JAK2, but also JAK3, associated with CXCR4. JAK association with the CXCR4 receptor occurs as early as 60 s after SDF-1{alpha} stimulation (Fig. 3B ); small amounts of both JAKs also associated with the CXCR4 receptor in the absence of exogenous SDF-1{alpha}, consistent with the lower level of receptor phosphorylation in the absence of exogenous ligand in MOLT4 cells. Results of immunoprecipitation of cell lysates with isotype-matched control antibodies (Fig. 3B) rule out nonspecific protein association with membrane components under these experimental conditions. The rapid association of both of these JAKs with the CXCR4 receptor suggests a role for this tyrosine kinase in early receptor phosphorylation after ligand stimulation. Although JAK1 is present in MOLT4 cells, it was not found to be associated with the CXCR4 receptor after chemokine activation (Fig. 3B ). JAK2 and JAK3 association correlates with their tyrosine phosphorylation after SDF-1{alpha} stimulation (Fig. 3C ), again demonstrating JAK pathway activation in SDF-1{alpha}-mediated signaling.

To identify downstream events related to the JAK pathway, we analyzed JAK kinase-activated STAT transcription factors in anti-CXCR4 immunoprecipitates, since STAT activation and association with CCR2 and CCR5 has been described previously (21 22 23) . STAT1, 2, 3, and 5, but not STAT4 or 6, associate with the receptor complex in response to SDF-1{alpha} (Fig. 4 A). The association of each STAT correlates in time with JAK phosphorylation and binding. Furthermore, these STATs are tyrosine phosphorylated, indicating their activation (Fig. 4B ). The early SDF-1{alpha}-triggered tyrosine phosphorylation of the CXCR4 receptor is independent of PTX-sensitive G-proteins. When cells are PTX treated, the CXCR4 receptor is continuously phosphorylated, as detected by immunoprecipitation with either anti-PTyr or anti-CCR4 antibodies (Fig. 5 A). Under the same conditions, both JAK2 and JAK3 associate with SDF-1{alpha}-activated CXCR4, much as occurs when cells are not PTX treated (Fig. 5B ). Nevertheless, neither JAK2 nor JAK3 dissociate the receptor in PTX-treated cells (Fig. 5B ). These data clearly resemble the results obtained after CCR2 receptor stimulation by MCP-1, where PTX treatment blocks JAK kinase dissociation from the receptor (22) . This implies that PTX-sensitive G-protein activation is important in the recycling of the JAK/STAT receptor complex and assigns a potential role to Gi pathway-related components in the control of this recycling.



View larger version (74K):
[in this window]
[in a new window]
 
Figure 4. SDF-1{alpha} induces STAT association with the CXCR4 receptor and STAT phosphorylation. A) SDF-1{alpha} (10 nM) -stimulated MOLT4 cell lysates were precipitated with CXCR4–01 mAb and analyzed in Western blot with anti-STAT antibodies, as indicated (left panel). CXCR4 loading was controlled by reprobing the membrane with CXCR4–01 mAb (right panel); as a positive control, unprecipitated MOLT4 cell lysates were tested with anti-STAT antibodies. B) STAT2 phosphorylation was determined in stimulated cell lysates immunoprecipitated with anti-PTyr or control rIgG and assayed in Western blot with anti-STAT2 antibodies. Unprecipitated MOLT4 cell lysates were assayed with anti-STAT2 antibody as positive control. Equivalent protein loading was controlled as described in Materials and Methods.



View larger version (39K):
[in this window]
[in a new window]
 
Figure 5. CXCR4 phosphorylation and JAK association with CXCR4 is PTX independent. A) PTX-pretreated MOLT4 cells were stimulated with 10 nM SDF-1{alpha}, lysed, and immunoprecipitated with anti-PTyr or control rIgG. The Western blot was developed with CXCR4–01 mAb. As a positive control, unprecipitated MOLT4 cell lysates were immunoblotted with CXCR4–01 mAb. Equal protein loading in each lane was controlled as described in Materials and Methods. B) PTX-pretreated MOLT4 cells were stimulated with 10 nM SDF-1{alpha}, lysed, immunoprecipitated, and immunoblotted as in Fig. 3 B.

Despite the rapid and transient JAK-mediated CXCR4 tyrosine phosphorylation, phosphorylated CXCR4 can be observed long after maximum JAK association. This implies that other tyrosine kinases may be implicated in Tyr phosphorylation of the chemokine receptors at later times after chemokine binding; in fact, RANTES activation of human T cells promotes the activation of p125FAK and ZAP-70 (29) .

To determine the functional significance of JAK/STAT pathway activation by SDF-1{alpha}, MOLT4 cells were treated overnight with the specific JANUS kinase inhibitor AG490 (25 µM) (30) prior to determination of SDF-1{alpha}-mediated Ca2+ mobilization and cell migration. This treatment completely blocks the SDF-1{alpha}-mediated CXCR4 effects (Fig. 6 A, B), as compared with cells treated with tyrphostin A1 (Calbiochem-Novabiochem), indicating a functional role for ligand-induced JAK activation upstream of G-protein-related pathways. Tyrphostin treatment was not toxic to MOLT4 cells, as shown by cell cycle analysis using propidium iodide incorporation (not shown).



View larger version (29K):
[in this window]
[in a new window]
 
Figure 6. Tyrphostin AG490 treatment blocks both SDF-1{alpha}-induced Ca2+ influx and transmigration. A) SDF-1{alpha} (10 nM) -induced Ca2+ mobilization in MOLT4 cells, preincubated with AG490 or tyrphostin A1, was determined in a flow cytometer at 525 nm; the result of one of three experiments is shown. Results are expressed as percentage of the maximum chemokine response. Equivalent Fluo-3AM loading was determined as indicated in Material and Methods. B) SDF-1{alpha} (10 nM) -induced chemotaxis of MOLT4 cells, untreated or pretreated with AG490 or tyrphostin A1, was assayed in transwell chemotaxis chambers. Cells suspended in RPMI 1640 containing 10% FCS were allowed to migrate for 2 h at 37°C in a 5% CO2 atmosphere. Cells migrating to the lower chamber were counted and expressed as a migration index, calculated as the x-fold increase over the negative control.

SDF-1{alpha}-induced STAT translocation to the nucleus is blocked by phosphotyrosine phosphatase activity
To further assess the role of the JAK/STAT pathway in chemokine signaling, we analyzed the nuclear translocation of activated STAT3 and STAT5 and their capacity to bind specific DNA sequences after chemokine activation. Nuclear extracts of SDF-1{alpha}-stimulated MOLT4 cells were analyzed in Western blot using anti-STAT3 and anti-STAT5b antibodies, and no nuclear translocation was observed at any of the time points analyzed (Fig. 7 A). As expected, no SIE binding activity was detected, measured by EMSA after chemokine treatment (Fig. 7B ). Protein levels in the nuclear extracts were controlled using a protein detection kit. Nuclear extracts were controlled in Western blot using anti-Pol II antibody as nuclear marker and were free of cytoplasmic contamination, confirmed by developing with an anti-ß-actin cytoplasmic marker antibody (not shown).



View larger version (50K):
[in this window]
[in a new window]
 
Figure 7. SDF-1{alpha}-induced STAT translocation to the nucleus is reduced by a phosphotyrosine phosphatase activity. A) MOLT4 cells, untreated or pretreated with pervanadate, were stimulated at the times indicated with SDF-1{alpha} (10 nM) and nuclear extracts were analyzed in Western blot using anti-STAT5 (upper panel) or anti-STAT3 (lower panel) antibodies. Equivalent protein loading was controlled as described in Materials and Methods. B) Nuclear extracts from cells treated as in panel A were incubated with 32P-end-labeled wt-SIE (0.5 ng) in EMSA buffer. Where indicated, a 20-fold molar excess of unlabeled wt-SIE or mut-SIE oligonucleotide was added. The arrow indicates the SIE binding complex that is not inhibited by nonspecific, unlabeled mut-SIE, but is inhibited by unlabeled wt-SIE.

In a growth hormone-stimulated female rat hepatocyte model, it has recently been shown that a possible cause of the lack of STAT translocation to the nucleus is the presence of enhanced phosphotyrosine phosphatase activity. To rule out this possibility, we tested the effect of the phosphotyrosine phosphatase inhibitor pervanadate (31) on SDF-1{alpha}-stimulated MOLT4 cells. SDF-1{alpha}-mediated STAT3 and STAT5 translocation to the nucleus was observed after pervanadate treatment, with a maximum effect at 30 min after stimulation (Fig. 7A ); the same result was obtained when SIE binding activity was evaluated (Fig. 7B ). Treatment with pervanadate alone slightly increased basal STAT3 and STAT5 translocation levels (Fig. 7A, B ). This down-regulation of STAT3 and STAT5 nuclear translocation and activation suggests that phosphotyrosine phosphatase activity is involved in CXCR4/JAK/STAT pathway regulation.

SDF-1{alpha} induces Shp1 activation and association with the CXCR4 in a PTX-dependent manner
Protein phosphatases are critical in the regulation of signal transduction pathways mediated by tyrosine phosphorylation (32) . Using SDF-1{alpha}-activated MOLT4 cell lysates, we show that Shp1, a cytoplasmic tyrosine phosphatase with two SH2 domains, is activated and associated with CXCR4. We demonstrate physical association between the CXCR4 receptor and the Shp1 phosphatase by immunoprecipitating with the CXCR4–01 mAb and developing Western blots with anti-Shp1 antibodies (Fig. 8 ). This association is initiated within 5 min of SDF-1{alpha}-triggering and reaches a maximum at 15 min after chemokine binding. Immunoprecipitation of cell lysates with isotype-matched control antibodies to ß2-microglobulin or to other membrane proteins did not reveal the presence of Shp1 (Fig. 8) , ruling out nonspecific protein association with membrane components under these experimental conditions. SDF-1{alpha}-induced association of Shp1 to the CXCR4 receptor is blocked by PTX treatment, indicating that Shp1 association requires G{alpha}i activation and is probably implicated in the control of JAK2/JAK3 activation (Fig. 8) .



View larger version (30K):
[in this window]
[in a new window]
 
Figure 8. SDF-1{alpha} induces Shp1 activation and association with CXCR4 in a PTX-dependent manner. Untreated and PTX-pretreated MOLT4 cells were stimulated with 10 nM SDF-1{alpha}, lysed, immunoprecipitated with CXCR4–01 mAb or control IgM, and Western blotted with anti-Shp1 mAb. As a positive control, MOLT4 cell lysates were blotted with anti-Shp1. Equivalent receptor loading was controlled by reprobing membranes with CXCR4–01 mAb.

SDF-1{alpha} induces CXCR4 dimerization
Similar to growth factor-induced dimerization of tyrosine kinase receptors, CC chemokine receptors undergo dimerization in response to their ligands (23 , 33) . We then tested whether SDF-1{alpha}, a CXC chemokine, triggers CXCR4 dimerization. DSS-mediated cross-linking in MOLT4 cells was performed after SDF-1{alpha} and RANTES stimulation. In CXCR4 immunoprecipitates of chemokine-stimulated cell lysates, we observed a high molecular weight receptor species only when cells were stimulated with SDF-1{alpha} (Fig. 9 ). This band corresponds to the expected molecular weight of two CXCR4 molecules, as assessed by immunoprecipitation with anti-CXCR4 antibodies and Western blot developed with anti-CXCR4 antibodies. CXCR4 does not appear in RANTES-stimulated, cross-linked cell lysates immunoprecipitated with the same anti-CXCR4 antibody (Fig. 9) . These results indicate that the CXC chemokine SDF-1{alpha}, like the CC chemokines RANTES and MCP-1 and similar to some members of the large cytokine family, can trigger receptor dimerization, followed by recruitment of tyrosine kinases that phosphorylate both the receptor and the STAT transcription factors.



View larger version (50K):
[in this window]
[in a new window]
 
Figure 9. SDF-1{alpha} induces CXCR4 dimerization. MOLT4 cells were unstimulated (lane A) or stimulated for 60 s with 10 nM SDF-1{alpha} (lane B) or 10 nM RANTES (lane C) at 37°C and cross-linked using 1 mM DSS, as described in Materials and Methods. Cell lysates were immunoprecipitated with CXCR4–01 mAb, electrophoresed, and transferred to nitrocellulose membranes. The Western blot was analyzed with CXCR4–01 mAb. As a positive control, MOLT4 cell lysates were immunoblotted with CXCR4–01 mAb. Arrows indicate the monomer (40 kDa) and the dimer (80 kDa). Equal protein loading in each lane was controlled as described in Materials and Methods.


   DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Chemokine receptors consist of single polypeptide chains containing seven membrane-spanning stretches of {alpha} helices. These proteins have an extracellular amino-terminal portion and three extracellular loops implicated in receptor–agonist interaction, as well as a cytoplasmic carboxyl-terminal domain and three intracellular loops that interact cooperatively to bind and activate G-proteins (34) . Most G-protein-coupled receptors have single conserved cysteine residues in the extracellular loops, believed to form a disulfide bond that stabilizes the functional protein structure. Despite growing interest in and information on the chemokines and their receptors, the complex rules that govern chemokine receptor triggering remain unclear. In vivo, this process probably involves a dynamic relationship including chemokine, receptor and the receptor-linked cytoplasmic G-protein complex, although many of the molecular events after chemokine receptor triggering remain to be defined.

SDF-1{alpha} was first isolated from stromal cell culture supernatants. It is a potent chemoattractant for several leukocyte populations and binds specifically to the ubiquitous CXC receptor CXCR4. In CXCR4-expressing cells, SDF-1{alpha} binding promotes Ca2+ mobilization and cell transmigration, processes that are blocked by PTX treatment but not by CTX.

Here we describe the characterization of mAb specific for the CXCR4 chemokine receptor and their use in the identification of signaling pathways activated after SDF-1{alpha} binding to the receptor in the MOLT4 human T cell line. Considerable data are available on SDF-1{alpha} activity, including its role in HIV-1 pathogenesis and its function in the development of the immune, circulatory, and central nervous systems as defined in SDF-1{alpha} and CXCR4 knockout mice. Nonetheless, little is known about the signals required for the regulation of such a wide array of activities. Several observations indicate the triggering of multiple signaling pathways through chemokine receptors, including G-protein-mediated pathways, MAP kinases, PI3K, tyrosine, and serine/threonine kinases. CXCR4-mediated responses are PTX sensitive, indicating a role for Gi in this signaling. Here we demonstrate that after SDF-1{alpha} binding, Gi, but not Gs associates rapidly (within 60 s) to CXCR4. This confirms previous data indicating that other chemokine receptors such as IL-8 receptors or CCR2, bind G{alpha}i in response to their respective ligands, IL-8 (35) and MCP-1 (22) .

It has recently been shown that RANTES induces activation and assembly of macromolecular focal adhesion complexes and provokes T lymphocyte homotypic adhesion by phosphorylation and association of p125FAK and ZAP-70 (29) . Stimulation with SDF-1{alpha} also promotes increased phosphorylation of focal adhesion components, including the p125FAK-related adhesion focal tyrosine kinase (RAFTK/Pyk2), Crk, and paxillin (36) . Furthermore, we have recently shown the tyrosine phosphorylation of two members of the CC receptor family, CCR2 and CCR5, in response to their respective ligands (MCP-1 and RANTES) and the critical role of JAK/STAT pathway activation in later chemokine signaling events (22 , 23) . The activation in T cells of different STATs by RANTES and MIP-1{alpha} has also been reported (21) .

Here we extend these results and demonstrate the tyrosine phosphorylation of a member of CXC receptor family, CXCR4. CXCR4 is Tyr phosphorylated in response to SDF-1{alpha}. Several assays performed to identify the kinase responsible for CXCR4 receptor phosphorylation led to the conclusion that the JANUS kinase family members JAK2 and JAK3, but not JAK1, cause early receptor activation. Both JAK2 and JAK3 association with the CXCR4 occurs even in the presence of PTX, indicating no Gi participation in this process. Their dissociation was not observed in the presence of PTX, however, suggesting active participation of Gi pathways in uncoupling JAK members from the receptor. In response to SDF-1{alpha}, both JAK2 and JAK3 are phosphorylated as soon as 60 s after binding, indicating that their activation is simultaneous with their aggregation with CXCR4. This suggests differential usage of the JANUS kinase family members, depending on the chemokine receptor and the cell line studied.

Several STAT transcriptional factors, including STAT1, -2, -3, and -5, but not STAT4 or -6, are associated with the CXCR4 after SDF-1{alpha} activation, concurring with the role assigned to the JAK tyrosine kinases in transducing signals from hematopoietic growth factor receptors (37) . In these receptors, the activation and association of JAK kinase with the receptor creates docking sites for SH2-containing proteins such as STAT, leading to their phosphorylation and activation of gene transcription. This is not a unique feature of chemokine receptors, since other GPCR also activate STAT transcription factors. This is the case for a skeletal muscle serotonin 5-HT2A receptor (38) , the angiotensin II AT1 receptor (39) , and the cAR1 chemotactic receptor of Dictyostelium, in which G-protein-independent STAT activation has been demonstrated (40) . This observation agrees with the fact that JAK/STAT pathway activation by chemokines is not blocked by PTX pretreatment, indicating a G-protein-independent pathway. Nevertheless, in both Dictyostelium and chemokine receptors, the G-protein may have a role in regulating JAK/STAT activation in a yet unknown way. Together, these results indicate that chemokine-mediated activation of G-protein-coupled receptors leads to signal transduction, which invokes intracellular phosphorylation intermediates used by other cytokine receptors.

SDF-1{alpha}-induced G-protein-mediated physiological effects are abrogated after treatment of MOLT4 cells with the JAK-specific inhibitor AG490. This is not the case when cells are treated with other tyrphostins, indicating that G-protein-mediated responses through this receptor are dependent on JAK kinase activity. These results confirm, and extend to the CXCR4, the data obtained for MCP-1-activated CCR2 (22) , in which conformational changes in the receptor promoted by both ligand interaction and JAK tyrosine kinase association are required for G{alpha}i protein association with its binding site.

Although receptor association and phosphorylation of STAT proteins are detected after SDF-1{alpha} activation, neither translocation to the nucleus nor SIE binding activity are observed, probably due the low efficiency of STAT phosphorylation. Only weak phosphorylation is detected after chemokine activation as compared with that observed using cytokines, with which the JAK/STAT pathway has classically been studied (41) . These data suggest a control mechanism that implicates phosphotyrosine phosphatase activity, as has been shown for the down-regulation of liver JAK2-STAT5b signaling by continuous growth hormone stimulation (42) . In the case of chemokine-activated STAT, this dephosphorylation does not occur in the nucleus, since no STATs are detected in Western blot analysis of SDF-1{alpha}-stimulated MOLT4 nuclear extracts. The down-regulation of the JAK/STAT pathway by dephosphorylation was confirmed when, prior to SDF-1{alpha} stimulation, MOLT4 cells were treated with pervanadate, a phosphotyrosine phosphatase inhibitor. Under these conditions, the chemokine increases STAT translocation to the nucleus, implicating phosphotyrosine phosphatase activity in the control of this pathway.

The implication of a phosphatase in JAK/STAT regulation and the data indicating that JAK activation, but not its dissociation from the CXCR4, is GI independent, led us to analyze the proteins potentially involved in this regulation. We found that the Shp1 phosphatase aggregates with CXCR4 after SDF-1{alpha} binding, with a time course that coincides with JAK dissociation from the receptor. When cells are PTX treated, Shp1 does not associate with the receptor. Both JAK dissociation and Shp1 association with the receptor require activation of the Gi pathway and suggest possible Gi-dependent regulation of JAK/STAT pathways by Shp1. The induction of Shp1 may therefore provide a negative feedback mechanism that contributes to the termination of SDF-1{alpha}-induced JAK/STAT signaling. Tyrosine phosphatases have recently been implicated in the control of the JAK/STAT pathway, which is activated after the stimulation of a G-protein-coupled receptor (43) . Activation of Shp phosphatases has also been described, showing that abrogation of Shp2 activation leads to elevated and prolonged STAT1 and STAT3 activation (44) . The identification of JAK/STAT signaling and its regulation by Shp1 as a primary event triggered by chemokines of the CC and CXC families have important implications, since chemokines could use alternative pathways that would permit precise responses to stimuli, depending on the cell type and differentiation status.

We also demonstrate that, as is the case for the CC chemokine receptors CCR2 and CCR5 after binding of their ligands, CXCR4 undergoes dimerization after SDF-1{alpha} binding. We have observed chemokine-induced dimerization of CCR receptors (23 , 33) , and direct interaction between two CCR5 molecules has also been demonstrated by Benkirane et al. (45) , even in the absence of ligand stimulation. Our data now extend this observation and clearly show that ligand activation also promotes dimerization in members of the CXCR receptor family. The functional significance of dimerization was suggested by Hebert et al. (46) , who, using the epitope tagging approach, showed that agonist stimulation of the ß2-adrenergic receptor stabilized the dimeric state of the receptor. Receptor clustering is known to occur during the initiation of ligand-induced internalization, although we have recently described a mutant CCR2 form, CCR2bY139F (33) , which dimerizes in response to MCP-1 but is not internalized. This CCR2b mutant acts as a CCR2b dominant negative mutant, blocking chemokine responses by forming nonproductive complexes with partners containing the functional domain, and demonstrating the biological requirement for dimerization in chemokine responses. This conclusion is also reached in the case of the adrenergic receptor (46) , in which dimerization is observed using purified receptors, clearly indicating that dimerization is an internalization-independent phenomenon.

This dimerization model provides a context in which to understand the ability of different chemokine-like ligands to act as agonists or antagonists. Our results identify a novel molecular mechanism that may underlie chemokine responses, revealing new possibilities for the characterization of transcriptional activation in early genes, as well as having implications in HIV-1 prevention. Recent reports indicate that heterodimerization between CCR5 and its mutant, CCR5{Delta}32, is a molecular explanation of the delayed onset of AIDS in heterozygous CCR5/CCR5{Delta}32 individuals (47) . Our results also extend the model of cytokine receptor signaling to the chemokines, which are functionally related molecules, although they use structurally unrelated receptors. This model of chemokine responses links the pathways implicated in Tyr kinase activation with the G-proteins and assigns to the latter an important role in control of the former.


   ACKNOWLEDGMENTS
 
We thank I. López-Vidriero for help with flow cytometry, L. Gómez for help with animal work, and C. Bastos and C. Mark for secretarial and editorial assistance, respectively. This work was partially supported by grants from the Spanish CICyT and the Comunidad de Madrid. The Department of Immunology and Oncology was founded and is supported by the Spanish Research Council (CSIC) and Pharmacia & Upjohn.


   FOOTNOTES
 
2 Abbreviations: BSA, bovine serum albumin; ELISA, enzyme-linked immunoassay; EMSA, electrophoretic mobility shift assay; FCS, fetal calf serum; G-protein, guanine nucleotide binding protein; IL, interleukin; mAb, monoclonal antibody(ies); MCP-1, monocyte chemoattractant protein-1; MIP-1{alpha}, macrophage-inflammatory protein-1{alpha}; PBS, phosphate-buffered saline; PO, monoclonal horseradish peroxidase; RANTES, regulated on activation, normal T expressed and excreted; SDF, stromal cell-derived factor; SDS-PAGE, sodium dodecyl sulfate-polyacrylamide gel electrophoresis; SIE, sis-inducible element.

Received for publication November 16, 1998. Revised for publication April 22, 1999.


   REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 

  1. Baggiolini, M., Dewald, B., Moser, B. (1997) Human chemokines: an update. Annu. Rev. Immunol. 15,675-705[Medline]
  2. Rollins, B. J. (1997) Chemokines. Blood 90,909-928[Free Full Text]
  3. Kennedy, J., Kelner, G. S., Kleyensteuber, S., Schall, T. J., Weiss, M. C., Yssel, H., Schneider, P. V., Cocks, B. G., Bacon, K. B., Zlotnik, A. (1995) Molecular cloning and functional characterization of human lymphotactin. J. Immunol. 155,203-209[Abstract]
  4. Bazan, J. F., Bacon, K. B., Hardiman, G., Wang, W., Soo, K., Rossi, D., Freaves, D. R., Zlotnik, A., Schall, T. J. (1997) A new class of membrane-bound chemokine with a CX3C motif. Nature (London) 385,640-644[Medline]
  5. Murphy, P. M. (1994) The molecular biology of leukocyte chemoattractant receptors. Annu. Rev. Immunol. 12,593-633[Medline]
  6. Loetscher, P., Seitz, M., Baggiolini, M., Moser, B. (1996) Interleukin-2 regulates CC chemokine receptor expression and chemotactic responsiveness in T lymphocytes. J. Exp. Med. 184,569-577[Abstract/Free Full Text]
  7. Doranz, B. J., Rucker, J., Yi, Y., Smyth, R. J., Samson, M., Peiper, S. C., Parmentier, M., Collman, R. G., Doms, R. W. (1996) A dual-tropic primary HIV-1 isolate that uses fusin and the ß-chemokine receptors CKR-5, CKR-3, and CKR-2b as fusion cofactors. Cell 85,1149-1158[Medline]
  8. Alkhatib, G., Combadiere, C., Broder, C. C., Feng, Y., Kennedy, P. E., Murphy, P. M., Berger, E. A. (1996) CC CKR5: A RANTES, MIP-1{alpha}, MIP-1ß receptor as a fusion cofactor for macrophage-tropic HIV-1. Science 272,1955-1958[Abstract]
  9. Bleul, C. C., Farzan, M., Choe, H., Parolin, C., Clark-Lewis, I., Sodroski, J., Springer, T. A. (1996) The lymphocyte chemoattractant SDF-1 is a ligand for LESTR/fusin and blocks HIV-1 entry. Nature (London) 382,829-832[Medline]
  10. Oberlin, E., Amara, A., Bachelerie, F., Bessia, C., Virelizier, J. L., Arenzana-Seisdedos, F., Schwartz, O., Heard, J. M., Clark-Lewis, I., Legler, D. F., Loetscher, M., Baggiolini, M., Moser, B. (1996) The CXC chemokine SDF-1 is the ligand for LESTR/fusin and prevents infection by T-cell-line-adapted HIV-1. Nature (London) 382,833-835[Medline]
  11. Endres, M. J., Clapham, P. R., Marsh, M., Ahuja, M., Davis Turner, J., McKnight, A., Thomas, J. F., Stoebenau-Haggarty, B., Choe, S., Vance, P. J., Wells, T. C., Power, C. A., Sutterwala, S. S., Doms, R. W., Landau, N. R., Hoxie, J. A. (1996) CD4-independent infection by HIV-2 is mediated by fusin/CXCR4. Cell 87,745-756[Medline]
  12. Nagasawa, T., Kikutani, H., Kishimoto, T. (1994) Molecular cloning and structure of a pre-B-cell growth-stimulating factor. Proc. Natl. Acad. Sci. USA 91,2305-2309[Abstract/Free Full Text]
  13. Bleul, C. C., Fuhlbrigge, R. C., Casasnovas, J. M., Aiuti, A., Springer, T. A. (1996) A highly efficacious lymphocyte chemoattractant, stromal cell-derived factor 1 SDF-1. J. Exp. Med. 184,1101-1109[Abstract/Free Full Text]
  14. Aiuti, A., Webb, I. J., Bleul, C., Springer, T. A., Gutierrez-Ramos, J. C. (1997) The chemokine SDF-1 is a chemoattractant for human CD34+ hematopoietic progenitor cells and provides a new mechanism to explain the mobilization of CD34+ progenitors to peripheral blood. J. Exp. Med. 185,111-120[Abstract/Free Full Text]
  15. D'Apuzzo, M., Rolink, A., Loetscher, M., Hoxie, J. A., Clark-Lewis, I., Melchers, F., Baggiolini, M., Moser, B. (1997) The chemokine SDF-1, stromal cell-derived factor 1, attracts early stage B cell precursors via the chemokine receptor CXCR4. Eur. J. Immunol. 27,1788-1793[Medline]
  16. Nagasawa, T., Hirota, S., Tachibana, K., Takakura, N., Nishikawa, S., Kitamura, Y., Yoshida, N., Kikutani, H., Kishimoto, T. (1996) Defects of B cell lymphopoiesis and bone marrow myelopoiesis in mice lacking the CXC chemokine PBSF/SDF-1. Nature (London) 382,635-638[Medline]
  17. Zou, Y-R., Kottmann, A. H., Kuroda, M., Taniuchi, I., Littman, D. R. (1998) Function of the chemokine receptor CXCR4 in haematopoiesis and in cerebellar development. Nature (London) 393,595-599[Medline]
  18. Tachibana, K., Hirota, S., Iizasa, H., Yoshida, H., Kawabata, K., Kataoka, Y., Kitamura, Y., Matsushima, K., Yoshida, N., Nishikawa, S., Kishimoto, T., Nagasawa, T. (1998) The chemokine receptor CXCR4 is essential for vascularization of the gastrointestinal tract. Nature (London) 393,591-594[Medline]
  19. Bokoch, G. M. (1995) Chemoattractant signaling and leukocyte activation. Blood 86,1649-1660[Free Full Text]
  20. Ganju, R. K., Brubaker, S. A., Meyer, J., Dutt, P., Yang, Y., Qin, S., Newman, W., Groopman, J. E. (1998) The {alpha}-chemokine, stromal cell-derived factor-1a, binds to the transmembrane G-protein-coupled CXCR4 receptor and activates multiple signal transduction pathways. J. Biol. Chem. 273,23169-23175[Abstract/Free Full Text]
  21. Wong, M., Fish, E. N. (1998) RANTES and MIP-1{alpha} activate STATs in T cells. J. Biol. Chem. 273,309-314[Abstract/Free Full Text]
  22. Mellado, M., Rodríguez-Frade, J. M., Aragay, A., del Real, G., Martín, A. M., Vila-Coro, A. J., Serrano, A., Mayor, F., Jr, Martínez-A, C. (1998) The chemokine monocyte chemotactic protein 1 (MCP-1) triggers Janus kinase 2 activation and tyrosine phosphorylation of the CCR2b receptor. J. Immunol. 161,805-813[Abstract/Free Full Text]
  23. Rodríguez-Frade, J. M., Vila-Coro, A., Martín de Ana, A., Nieto, M., Sánchez-Madrid, F., Proudfoot, A. E. I., Wells, T. N. C., Martínez-A, C., Mellado, M. (1999) Similarities and differences in RANTES- and (AOP)-RANTES-triggered signals: implications for chemotaxis. J. Cell Biol. 144,755-765[Abstract/Free Full Text]
  24. Mellado, M., Rodriguez-Frade, J. M., Kremer, L., Martínez-A, C. (1996) Characterization of monoclonal antibodies specific for the human growth hormone 22K and 20K isoforms. J. Clin. Endocrinol. Metab. 18,1613-1618
  25. Harlow, E., Lane, D. (1988) Storing and purifying antibodies. Antibodies: A Laboratory Manual ,298 Cold Spring Harbor Press N.Y..
  26. Mellado, M., Kremer, L., Mañes, S., Martínez-A., C., Rodríguez-Frade, J. M. (1997) Characterization of antigen-antibody and ligand-receptor interactions. Lefkovits, I. eds. Immunological Methods Manual ,1145 Academic Press Ltd. London.
  27. Frade, J. M. R., Llorente, M, Mellado, M., Alcamí, J., Gutierrez-Ramos, J. C., Zaballos, A., del Real, G., Martínez-A, C. (1997) The amino-terminal domain of the CCR2 chemokine receptor acts as coreceptor for HIV-1 infection. J. Clin. Invest. 100,1-6[Medline]
  28. Arai, H., Charo, I. F. (1996) Differential regulation of G-protein-mediated signaling by chemokine receptors. J. Biol. Chem. 271,21814-21819[Abstract/Free Full Text]
  29. Bacon, K. B., Szabo, M. C., Yssel, H., Bolen, J. B., Schall, T. J. (1996) RANTES induces tyrosine kinase activity of stably complexed p125FAK and ZAP-70 in human T cells. J. Exp. Med. 184,873-882[Abstract/Free Full Text]
  30. Meydan, N., Grunberger, T., Dadi, H., Shahar, M., Arpaia, E., Lapidot, Z., Leeder, J. S., Freedman, M., Cohen, A., Gazit, A., Levitzki, A., Roifman, C. M. (1996) Inhibition of acute lymphoblastic leukaemia by a Jak-2 inhibitor. Nature (London) 379,645-648[Medline]
  31. Petricoin, E., 3rd, David, M., Igarashi, K., Benjamin, C., Ling, L., Goelz, S., Finbloom, D. S., Larner, A. C. (1996) Inhibition of alpha interferon but not gamma interferon signal transduction by phorbol esters is mediated by a tyrosine phosphatase. Mol. Cell. Biol. 16,1419-1424[Abstract]
  32. Yu, D., Qu, C., Henegariu, O., Lu, X., Feng, G. (1998) Protein-tyrosine phosphatase Shp-2 regulates cell spreading, migration, and focal adhesion. J. Biol. Chem. 273,21125-21131[Abstract/Free Full Text]
  33. Rodriguez-Frade, J. M., Vila-Coro, A., Martin de Ana, A., Albar, J. P., Martínez-A, C., Mellado, M. (1999) Monocyte chemoattractant protein-1 induces functional responses through CCR2 dimerization. Proc. Natl. Acad. Sci. USA 96,3628-3633[Abstract/Free Full Text]
  34. Monteclaro, F. S., Charo, I. F. (1996) The amino-terminal extracellular domain of the MCP-1 receptor, but not the RANTES/MIP-1{alpha} receptor, confers chemokine selectivity. Evidence for a two-step mechanism for MCP-1 receptor activation. J. Biol. Chem 271,19084-19092[Abstract/Free Full Text]
  35. Damaj, B. B., McColl, S. R., Neote, K., Songquing, N., Ogborn, K. T., Hebert, C. A., Naccache, P