FASEB J.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by BULFONE-PAUS, S.
Right arrow Articles by KRAUSE, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by BULFONE-PAUS, S.
Right arrow Articles by KRAUSE, H.
(The FASEB Journal. 1999;13:1575-1585.)
© 1999 FASEB

Death deflected: IL-15 inhibits TNF-{alpha}-mediated apoptosis in fibroblasts by TRAF2 recruitment to the IL-15R{alpha} chain

SILVIA BULFONE-PAUS*1, ELENA BULANOVA*, THOMAS POHL*, VADIM BUDAGIAN*, HORST DÜRKOP{dagger}, RENÉ RÜCKERT*, ULRICH KUNZENDORF{ddagger}, RALF PAUSß and HANS KRAUSE£

* Institute of Immunology,
Department of Urology,
{dagger} Department of Pathology, University Hospital Benjamin Franklin, Free University, Berlin, Germany;
§ Department of Dermatology, University Hospital Eppendorf, University of Hamburg, Germany; and
{ddagger} Department of Internal Medicine IV, Friedrich-Alexander-University, Erlangen, Germany

1Correspondence: Institute of Immunology, University Hospital Benjamin Franklin. Free University Berlin, Hindenburgdamm 30, D-12200 Berlin, Germany. E-mail: bulfone{at}zedat.fu-berlin.de


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Interleukin-15 (IL-15) is a potent inhibitor of several apoptosis pathways. One prominent path toward apoptosis is the ligand-induced association of TNF receptor 1 (TNFR1) with death domain adaptor proteins. Studying if and how IL-15 blocks TNFR1-mediated apoptosis in a murine fibroblast cell line (L929), we show here that IL-15 blocks TNFR1-induced apoptosis via IL-15R{alpha} chain signaling. The intracellular tail of IL-15R{alpha} shows sequence homologies to the TRAF2 binding motifs of CD30 and CD40. Most important, binding of IL-15 to IL-15R{alpha} successfully competes with the TNFR1 complex for TRAF2 binding, which may impede assembly of key adaptor proteins to the TNFR1 complex, and induces I{kappa}B{alpha} phosphorylation. Thus, IL-15R{alpha} chain stimulation is a powerful deflector of cell death very early in the apoptosis signaling cascade, while TNF-{alpha} and IL-15 surface as major opponents in apoptosis control.—Bulfone-Paus, S., Bulanova, E., Pohl, T., Budagian, V., Dürkop, H., Rückert, R., Kunzendorf, U., Paus, R., Krause, H. Death deflected: IL-15 inhibits TNF-{alpha}-mediated apoptosis in fibroblasts by TRAF2 recruitment to the IL-15R{alpha} chain.


Key Words: cell death • TNFR1 • L929 • I{kappa}B


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
INTERLEUKIN 15 (IL-15)2 belongs to the four-helix bundle cytokine family (1 2 3 4) and uses the IL-2 receptor ß and {gamma} chains as components of the trimolecular IL-15 receptor (IL-15R) complex, despite the absence of sequence homologies with IL-2. In addition, IL-15 binds to a distinct receptor chain (IL-15R{alpha}) (5 6 7) . The functional activities of IL-15 partially overlap with those of IL-2 since (like IL-2) IL-15 is a potent growth factor for T, B, and natural killer (NK) cells, a T cell chemoattractant, an enhancer of the cytolytic function of effector T and NK cells, and a potent inducer of interferon-{gamma} (IFN-{gamma}) production by NK cells (1 , 2 , 6 , 8 , 9) . However, there is increasing appreciation that these interleukins differ in their spectrum of target cells (4 , 10) ; for example, IL-15 and its receptor are expressed by a much wider variety of cell types than IL-2 and, unlike IL-2, IL-15 is actively secreted under unusually tight controls, most prominently by monocytes/macrophages (11) .

Recently we described an additional functional role of IL-15 that is of general biological importance: its properties as a potent inhibitor of apoptosis in vitro on activated human T and B cells, as well as in vivo, where it protects mice from Fas-induced lethal hepatic failure and multi-system apoptosis and from chemotherapy-induced epithelial cell apoptosis (12 , 13) .

Ordinarily apoptosis appears to be triggered by signaling via members of the tumor necrosis factor (TNF) receptor family (Fas, TNFR1, DR3) (14 15 16 17 18 19) . Besides Fas, the other major signaling pathway for inducing apoptosis in multiple cell types operates via stimulation of the TNF-{alpha} receptor type 1 (TNFR1, p55) (18 , 20) .

TNF-{alpha} elicits a wide spectrum of biological effects as the result of complex signaling events that are initiated through trimerization of two distinct transmembrane receptors: TNFR1 (p55) and TNFR2 (p75). Apoptosis is mainly induced through TNFR1 via the intracellular `death domain' (DD), a ~80 amino acid domain found in the cytoplasmic region of TNFR1, Fas, and DR3. Aggregation of the receptors by the trimeric ligand orients the DD in a conformation that recruits adaptor proteins. The adaptor proteins also contain a DD and associate with the receptor through a homotypic DD interaction (14 , 21 22 23) .

Recently, downstream signal-transducing proteins and receptor-associated proteins that couple the TNFR1 receptor to the signaling cascade for the generation of cellular responses have been identified: TRADD (TNFR1-associated death domain protein) (18 , 19 , 24 , 25) , FADD (Fas-associated protein with death domain) (26 , 27) , RIP (receptor interacting protein) (28 , 29) , and TRAF2 (TNFR-associated factor) (30 , 31) . FADD is part of the inducible Apo1/Fas death-inducing signaling complex and is believed to represent the physical link to apoptosis-executing proteases of the caspase family (26 , 27) .

There are several lines of evidence that two TNFR1-signaling cascades bifurcate at TRADD: one induces NF-{kappa}B activity, which may promote cell survival (32 33 34) ; the other induces apoptosis via FADD and the caspase machinery. RIP is recruited to the TNFR1 complex with bifunctional activities, since it may promote either cell death or NF-{kappa}B activation (21 22 23) . TRAF2 interacts with TRADD and RIP through homotypic TRAF domain interactions and is involved in the TNF-dependent activation of NF-{kappa}B (25) . TRAF2 appears to be involved in TNF-mediated NF-{kappa}B activation and in signaling through the stress-activated protein kinase or c-Jun amino-terminal kinase, both of which may be instrumental to rescuing cells from programmed cell death (25 , 35) .

Since TNF-{alpha} is recognized as a major stimulus for inducing apoptosis in many cell types (15 , 16 , 30 , 36 , 37) , we wanted to study whether IL-15 and TNF-{alpha} are opposing forces in the cytokine network with respect to apoptosis control (38 , 39) . Also, the by now comparatively well-defined biochemistry of TNF-{alpha}-induced apoptosis, namely, the role of adaptor proteins in TNFR1-mediated cell death (18 , 19 , 40) , promised to help elucidate potential molecular pathways of apoptosis inhibition by IL-15.

Therefore, the ability of IL-15 to block TNFR1-mediated proapoptotic signaling in a murine fibroblast cell line (L929), which is highly sensitive to TNF-{alpha}-induced apoptosis (41 , 42) , was examined. The data reported here suggest that IL-15 deflects TNF-{alpha}-mediated apoptosis in these fibroblasts in vitro by inhibiting the TNFR1 adaptor protein assembly and by recruiting the TNFR1-associated protein TRAF2 to the IL-15R{alpha} chain.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Cell culture and cytokines
L929 mouse fibroblast cells (41) were cultured in RPMI 1640 supplemented with 10% heat-inactivated fetal calf serum (FCS), 2 mM L-glutamine, 100 µg/ml streptomycin, and 100 µg/ml penicillin G (Gibco BRL, Grand Island, N.Y.) at 37°C with 5% CO2. Human recombinant TNF-{alpha} and IL-15 were purchased from Genzyme (Cambridge Mass.). L929 cells were stimulated with 10 ng/ml TNF-{alpha}, 10 ng/ml IL-15, 10 ng/ml IL-2, or a combination of the cytokines.

Flow cytometric analysis
For fluorescein-activated cell sorter (FACS) analysis, 1 x 106 L929 cells were incubated for 30 min on ice with the biotinylated fusion proteins IL-2-IgG2b (43) and IL-15-IgG2b (12) , with biotinylated mouse IgG2b (49.2), or with the following FITC- or PE-conjugated antibodies: anti-IL-2Rß chain (TM-ß1), anti-IL-2R{gamma} chain (TUGm2), or control IgM (R3–34) (all antibodies were purchased from Pharmingen, Hamburg, Germany). When biotinylated fusion proteins were used, cells were further incubated with streptavidin-PE (Pharmingen). After incubation, the cells were washed and analyzed by a FACS-Sort (Becton Dickinson, Heidelberg, Germany) (12) . Flow cytometric analysis of propidium iodide (PI) -stained L929 cells was performed as described (44) .

Reverse transcriptase-polymerase chain reaction (RT-PCR)
Cellular RNA was extracted by using the RNA Clean reagent (AGS GmbH) according to the manufacturer's instructions. A 5 µg aliquot of total cellular RNA was reverse transcribed using random hexanucleotides as primers and SUPERSCRIPT II preamplification kit (Gibco BRL). cDNA was amplified in a 20 µl PCR reaction mixture containing 250 µM dNTPs, 200 nM primers, 2 µl 10-fold PCR buffer, and 1 U Taq DNA polymerase (`Amplitaq', Perkin Elmer/Cetus, Emeryville, Calif.). The primers used were: mIL-15R{alpha} sense 5' AACATCCACCCTGATTGAGTGT 3', antisense 5' GTTTCCATGGTTTCCACCTCAA 3'; mIL-2R{alpha} sense 5' GGATCCAAGATGGAGCCACGCTTGCTGACG 3', antisense 5' AAGCTTTCAATACTCCATAGTGAGCACAAATGTCACC 3'; mIL-2Rß sense 5' GTCGACGCTCCTCTCAGCTGTGATGGCTACCATA 3', antisense 5' GGATCCCAGAAGACGTCTACGGGCCTCAAATTCCAA 3'; mIL-2R{gamma} sense 5' GTCGACAGAGCAAGCACCATGTTGAAACTA 3', antisense 5' GGATCCTGGGATCACAAGATTCTGTAGGTT 5'; ß-actin sense 5' GTGGGG CGCCCCAGGCACCA 3', antisense 5' CTCCTTAATGTCACGCACGATTTC 3'. All primers used were generated by and purchased from TIB Molbiol (Berlin). Samples were amplified in a DNA Thermocycler (Perkin Elmer/Cetus) for 35 cycles. Each cycle consisted of denaturation at 94°C for 1 min, annealing at 60°C for 2 min, and extension at 72°C for 2 min. Aliquots of PCR products were then electrophoresed on 1.5% agarose gel and visualized by ethidium bromide staining. ß-actin message expression was used to normalize the cDNA amount to be used; a mock PCR (without cDNA) was included to exclude contamination in all experiments.

Apoptosis assay
For analysis of DNA laddering, 1 x 106 cells were used as described previously (12) . Briefly, cells were pelleted by centrifugation 200 x g for 10 min at 4°C. Cell pellets were resuspended in 20 µl of lysis buffer (10 mM EDTA, 50 mM Tris-HCl, pH 8.0, 0.5% sodium lauryl sarcosinate, and 0.5 mg/ml proteinase K) and incubated for 1 h at 50°C. 10 µl of 0.5 mg/ml RNaseA was added to each sample, followed by incubation at 50°C for an additional hour. A 5 µl loading buffer (50% glycerin, 1 mM EDTA, 0.04% bromophenol blue) was mixed with 10 µl of each sample before loading onto the dry wells of a 2% agarose gel containing 0.1 µg/ml ethidium bromide.

Expression vectors and transfections
To construct the pcDNA3-mIL-15R{alpha} and TRAF2-expressing vectors, RNA was prepared from mouse splenocytes after 48 h concanavalin A stimulation (10 µg/ml), reverse transcribed with random priming, and mIL-15R{alpha} cDNA was amplified with mIL-15R{alpha}-specific oligos with restriction enzyme sites for cloning into pcDNA3(±) (Invitrogen, Leek, The Netherlands): IL-15R{alpha} sense (BamHI) 5'-GGGGATCCTTGGCCATGGCC TCGCCG-3'; IL-15R{alpha} antisense (EcoRI) 5'-CTGAATTCGTGTGGTTAGGCTCC TGT-3'; TRAF2 sense (BamHI) 5'-GTGGGGGATCCAACTCACATGGCTGCA-3'; TRAF2 antisense (XbaI) 5'-CTTATCTAGAGTGGCTAGAGCTCTG-3'. L929 cells were transiently transfected withTRAF2 or IL-15R{alpha} in sense (+) or antisense orientation (-) cDNA by the DEAE method as described (42) .

Immunoprecipitation and Western blotting
L929 cells were lysed in 100 µl Brij 96 extraction buffer (1% Brij, 20 mM Tris-Cl, pH 7.4, 75 mM NaCl, 1 mM EDTA, 1 mM sodium vanadate, 20 µg/ml aprotinin, 10 µg/ml pepstatin) and incubated for 15 min on ice. 100 micrograms of total proteins were mixed with 20 µl electrophoresis sample buffer (62.5 mM Tris-HCL, pH 8.0, 1% glycerol, 2% sodium dodecyl sulfate (SDS), 5% ß-mercaptoethanol, 0.01% bromophenol blue), separated by 10–15% SDS-polyacrylamide gel electrophoresis (SDS-PAGE), and transferred to a nitrocellulose membrane in buffer containing 25 mM Tris, 192 mM glycine, 1% SDS, and 20% methanol at 150 V for 40 min. Blots were blocked for 1 h in phosphate-buffered saline (PBS) with 0.05% Tween-20 (PBS-T) and 3% BSA (Sigma), then probed for 1 h with the following antibodies: anti-TRADD, anti-FADD, anti-RIP, anti-TRAF2, anti-IL-15R{alpha}, and anti-I{kappa}B{alpha} (Santa Cruz Biotechnology, Calif.) diluted 1:200 in PBS-T. After washing with PBS-T, blots were incubated for 1 h at room temperature with the secondary antibodies: anti-goat or anti-rabbit Ig horseradish peroxidase (Amersham International, Slough, U.K.) diluted at 1:1000. Visualization of immune complexes was carried out by an enhanced chemiluminescence (ECL) method using ECL Western blotting detection regents (Amersham International) according to the manufacturer's instructions. Stripping of blots was performed in 62.5 mM Tris-HCl buffer containing 2% SDS and 100 mM ß-mercaptoethanol at 4°C overnight. For immunoprecipitation, 500 µg of proteins was incubated overnight at 4°C with 5 µg hamster anti-TNFR1 (Genzyme), 10 µg goat anti-IL-15R{alpha}, or 10 µg rabbit anti-TRAF2 antibodies in 500 µl lysis buffer. Hamster, goat, or rabbit IgG were used as isotype-matched controls. Forty microliters of a 1:1 slurry of streptavidin-agarose (Pierce Chemical Company, Rockford, Ill.) were added to each sample and incubated for another hour at room temperature. The agarose beads were washed twice with 1 ml lysis buffer. Bound proteins were eluted by boiling for 5 min in electrophoresis sample buffer, resolved by SDS-PAGE, and analyzed by Western blot as described above.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
L929 cells express the high-affinity IL-15R{alpha} chain
To assess the surface expression of IL-15 receptor on L929 cells, a recently generated biotinylated IL-15 fusion protein, coupled to PE-conjugated streptavidin (12) , and FACS analysis were used. This technique provided evidence that the fibroblasts examined express IL-15 binding sites, but do not display the IL-2R{gamma} and only marginally express the IL-2Rß component of the IL-2R complex (Fig. 1A ). This expression profile was supported by the finding that L929 cells showed low binding to a previously generated IL-2-IgG2b chimeric protein (43) . Instead, the IL-15-IgG2b fusion protein strongly bound to these cells, which suggested expression of the high-affinity IL-15R{alpha} chain on the cell surface of L929 fibroblasts (Fig. 1A ). The presence of IL-15R{alpha} and the absence of IL-2R{gamma} expression on L929 cells were confirmed by RT-PCR analysis. In addition, RT-PCR could detect only a faint IL-2Rß transcript band (Fig. 1B ).



View larger version (22K):
[in this window]
[in a new window]
  		Figure 1. The IL-15R{alpha} is expressed on L929 cells. A) L929 cells were stained with biotinylated IL-15-IgG2b fusion protein in combination with streptavidin-PE in order to detect the high-affinity IL-15R, with biotinylated IL-2-IgG2b and IgG2b as controls. Cells were also stained with anti-IL-2R{gamma} chain PE-, anti-IL-2Rß FITC-conjugated antibodies, as indicated. IgM-conjugated antibodies were used as control. Analyses were performed on a FACScan flow cytometer. B) RT-PCR for IL-2R{alpha}, ß, {gamma} and IL-15R{alpha} chain. cDNA from L929 and CTLL-2 cells (as positive control for IL-15 and IL-2 receptor expression) were amplified with primers specific for the IL-2R{alpha}, ß, {gamma} and IL-15R{alpha} receptor chain. A negative control without cDNA was included (-). Amplification of the same cDNAs with ß-actin-specific primers is also shown.

IL-15 rescues L929 cells from TNF-{alpha}-induced apoptosis
To examine the ability of IL-15 to block the proapoptotic signaling induced by human TNF-{alpha}, which binds exclusively to TNFR1 in the murine system (45) , and to define the temporal relationship of any such interaction, L929 cells were treated for 12 h with 10 ng/ml TNF-{alpha}, 10 ng/ml IL-15, TNF-{alpha} plus IL-15, or TNF-{alpha}, followed by 10 ng/ml IL-15 at different time points (30 s, 1, 2, 5, 10, 15 min). Apoptosis was tested by DNA laddering after 12 h and by PI staining after 24 h.

Figure 2 demonstrates that coincubation with IL-15 rendered L929 cells resistant to apoptosis induction by TNF-{alpha}. However, suppression of TNF-{alpha}-induced DNA fragmentation by IL-15 (Fig. 2A ) occurred only when administered simultaneously, 30 s, or 1 min after adding TNF-{alpha} to the culture. This was confirmed by PI staining (FACS), which showed a fluorescence curve in the group treated simultaneously with TNF-{alpha}+IL-15 that virtually corresponded to the negative control; instead, L929 cells-treated with TNF-{alpha} alone or with coadministration of IL-15 showed evidence of massive apoptosis only after 15 min (Fig. 2B ). This suggests that IL-15 blocks TNF-{alpha}-induced apoptosis in L929 cells at a very early stage of the signaling cascade, most likely via the IL-15R{alpha} chain. These data also indicate that isolated IL-15R{alpha} proteins, contrary to conventional wisdom (5) , can indeed serve as functional receptors in the virtual absence of IL-15Rß and -{gamma} chains, at least in this fibroblast cell line. Finally, these data provide the first evidence that IL-15 exerts any functional effects at all on fibroblast apoptosis in vitro.



View larger version (36K):
[in this window]
[in a new window]
  		Figure 2. IL-15 is an inhibitor of TNF-{alpha}-induced apoptosis. A) L929 cells were treated either with medium (lane 2), 10 ng/ml IL-15 (lane 3), TNF-{alpha} 10 ng/ml (lane 4), IL-15 plus TNF-{alpha} (lane 5), or TNF-{alpha}, followed after 30 s, 1 , 2 , 5 , 10 , and 15 min (lanes 6, 7, 8, 9, 10, 11, respectively) by IL-15. DNAs from 1 x 106 cells were prepared after 12 h incubation, analyzed by electrophoresis on a 1.5% agarose gel, and stained with ethidium bromide. Lane 1 shows a 1 kb standard DNA molecular weight marker. B) DNA fluorescence flow cytometric profiles of PI-stained L929 cells treated for 24 h either with medium, 10 ng/ml IL-15, 10 ng/ml TNF-{alpha}, IL-15 plus TNF-{alpha}, or TNF-{alpha}, followed after 15 min by IL-15.

IL-15 stimulation induces the release of adaptor proteins from the TNFR1 complex
Current evidence suggests that TNF-{alpha} induces the trimerization of TNFR1, which is thought to result in the recruitment of TRADD, the adaptor protein that signals for apoptosis, via interactions between homologous regions, the so-called death domains (18 19 20 , 24 , 25) . Subsequently, the TNFR1–TRADD complex recruits at least three additional adaptor proteins: FADD (26 , 27) RIP (28 , 29) , and TRAF2 (30 , 31) . FADD and RIP transmit the key apoptosis signal(s) by interacting with caspases. In addition, together with TRAF2, RIP mediates NF-{kappa}B activation, which may induce the expression of survival genes (18 , 19 , 24 , 46) . Overexpression of FADD and RIP induces apoptosis (26 27 28 29) , while RIP -/- cells fail to activate NF-{kappa}B (46) .

We next addressed how IL-15 might inhibit TNFR1-mediated apoptosis, and first explored whether there is any evidence that IL-15 signaling through the IL-15R{alpha} chain directly interferes with TRADD-, FADD-, RIP-, or TRAF2-TNFR1 interactions. For this purpose, lysates from L929 cells that had been treated with TNF-{alpha}, IL-15, TNF-{alpha} plus IL-15 or were left untreated were immunoprecipitated with a monoclonal antibody directed against the extracellular domain of the TNFR1. Coprecipitation of TRADD, FADD, RIP, or TRAF2 with TNFR1 was investigated by immunoblot analysis, using the corresponding antisera.

TNF-{alpha} stimulation of L929 cells for 15 min induced the coprecipitation of TRADD, FADD, RIP (Fig. 3 , left upper panel), and TRAF2 (Fig. 3 , left lower panel) with the TNFR1. To the best of our knowledge, successful coprecipitation of TNFR1 with its adaptor proteins had never been reported in any cells other than transfectants with experimentally induced adaptor protein overexpression (24 , 25 , 29) ; therefore, these coprecipitation assays were subjected to rigorous validation (different lysis buffer conditions, antibody source, etc.).



View larger version (12K):
[in this window]
[in a new window]
  		Figure 3. IL-15 inhibits association of TRADD, FADD, RIP, and TRAF2 to the TNFR1. L929 cells were stimulated for 15 min with medium, TNF-{alpha}, IL-15, or TNF-{alpha} plus IL-15. Cell lysates were immunoprecipitated with hamster anti-TNFR1 monoclonal antibodies (left panels). Immunoprecipitation with hamster IgG isotype-matched antibodies was included as internal control (right panels). Coprecipitation of TRADD, FADD, RIP, and TRAF2 was detected by immunoblot analysis in 10% PAGE using anti-TRADD, anti-FADD, anti-RIP (upper panels) and in 15% PAGE using anti-TRAF2 (lower panels) -specific polyclonal antisera. Probing of the membrane with anti-TNFR1 antibody was used as control for loading (middle panels).

In contrast, costimulation of L929 cells with TNF-{alpha} plus IL-15 for 15 min blocked the association of the TNFR1 with its adaptor proteins (Fig. 3) . Thus, the simultaneous treatment of L929 cells with IL-15 and TNF-{alpha} appears to inhibit apoptosis by blocking the protein–protein interactions of the TNFR1 with these adaptor proteins by inhibiting the recruitment of cytosolic adaptor proteins to the stimulated TNFR1 and/or by dissociating already bound adaptor proteins from the TNFR1 complex.

The IL-15 receptor coimmunoprecipitates TRAF2
To corroborate this concept, to further dissect the effects of TNF-{alpha} and IL-15 costimulation on IL-15R-mediated signaling, and to identify proteins that might be interacting with the IL-15 receptor, L929 cells were treated with TNF-{alpha}, TNF-{alpha} plus IL-15, or IL-15 (controls: TNF-{alpha}+IL-2, IL-2). Cell extracts were then immunoprecipitated with anti-IL-15 receptor antibody. After SDS-PAGE separation and transfer to nitrocellulose, the blots were probed with a panel of adaptor protein-specific antisera against TRADD, FADD, RIP, and TRAF-2, followed by anti-rabbit and anti-goat Ig conjugated with horseradish peroxidase.

Figure 4 A (upper panel) shows that TRAF2 can associate with the IL-15 receptor on IL-15R{alpha} stimulation with IL-15 alone, and such an association is even stronger after costimulation with TNF-{alpha} and IL-15. No association of TRADD, FADD, or RIP with the IL-15 receptor was detectable (not shown).



View larger version (49K):
[in this window]
[in a new window]
  		Figure 4. IL-15 induces TRAF2 association with the IL-15R{alpha} chain. A) L929 cells were stimulated with TNF-{alpha}, TNF-{alpha} plus IL-2, TNF-{alpha} plus IL-15, IL-2, or IL-15 for 15 min or left untreated (control). Cellular extracts were immunoprecipitated with a goat anti-IL-15R{alpha} monoclonal antibody. After 10% SDS-PAGE separation and transfer to nitrocellulose, the blot was probed with anti-TRAF2 (upper panel), followed by horseradish peroxidase-conjugated antibodies. After stripping, the blot was incubated with anti-IL-15R{alpha} (middle panel) to control for immune complex loading. Immunoprecipitation was controlled by using goat IgG isotype-matched antibodies and probing the membrane with anti-TRAF2 antibodies (lower panel). B) L929 cells were transiently transfected with TRAF2 or IL-15R{alpha} in sense (+) or antisense orientation (-) cDNA or left untransfected but treated with DEAE (control), as indicated. Cell extracts were immunoprecipitated either with goat anti-IL-15R{alpha} antibodies (lanes: 1, 4, and 5) or rabbit anti-TRAF2 antibodies (lanes 2, and 3) and loaded onto a 12% PAGE. Probing of the membrane was performed with anti-TRAF2 (upper panel) and anti-IL-15R{alpha} (middle and lower panels) antiserum. Immunoprecipitation with isotype-matched antibodies was included as internal control: rabbit IgG were used as control for the TRAF2 (lower panel: lanes 2, and 3) and goat IgG antibodies for the IL-15R{alpha} immunoprecipitation (lower panel: lanes 1, 4, and 5). C) L929 cells were transiently transfected withTRAF2 cDNA and subsequently stimulated with TNF-{alpha}, IL-15, IL-2, TNF-{alpha} plus IL-15, or TNF-{alpha} plus IL-2 for 15 min or left untreated (control). Cell extracts were immunoprecipitated with rabbit anti-TRAF2 (upper panel) or rabbit IgG isotype-matched antibodies (lower panel) and 10% PAGE was performed. Membranes were probed with anti-IL-15R{alpha} antibody (upper and lower panel). After stripping, the blot (upper panel) was incubated with anti-TRAF2 antibody (middle panel) to control for immune complex loading.

Therefore, when coadministered with TNF-{alpha}, IL-15 may interfere with the protein–protein association of TRAF2 with the TNFR1 complex, and instead up-regulate TRAF2 association with the IL-15R{alpha} chain. Thus, ligand-stimulated TNFR1 complex and IL-15R{alpha} would seem to compete for binding to TRAF2, with IL-15R{alpha} likely showing a higher affinity for TRAF2 than TNFR1.

To further confirm an association of TRAF2 with IL-15R{alpha}, L929 cells were transiently transfected with plasmids that express IL-15R{alpha} or TRAF2 cDNAs in sense or antisense orientation. Transfected and untransfected cells were lysed and then immunoprecipitated either with IL-15R{alpha} antibody or with anti-TRAF2 antiserum. After SDS gel electrophoresis, immunoblotting was performed with anti-TRAF2 (Fig. 4B , upper panel) and anti-IL-15R{alpha} (Fig. 4B , middle panel) antiserum.

As shown in Fig. 4B (upper panel), lane 4, overexpression of IL-15R{alpha} revealed the appearance of a TRAF2 immunoprecipitate, which was not visible in untransfected controls with only constitutive IL-15R{alpha} expression levels (lane 1) or in antisense transfectants (lane 5). This suggests that in the absence of IL-15 stimulation, TRAF2 association with the IL-15R{alpha} chain is present only at a very low level, but becomes visible with an experimentally induced, substantial numeric increase in (low affinity?) TRAF2-IL-15R{alpha} associations. This interpretation was further supported by the reverse experiment, where TRAF2 overexpression in L929 cells also made visible IL-15R{alpha} complexing to TRAF2 (Fig. 4B ; middle panel, lane 2).

To obtain additional evidence that the TNFR1 complex and IL-15R{alpha} really compete for binding to TRAF2 upon activation by their respective ligands, TRAF2-transfected L929 cells were incubated with medium, TNF-{alpha}, IL-15, or TNF-{alpha}+IL-15 (controls: IL-2, TNF-{alpha}+IL-2). Cell extracts were immunoprecipitated with anti-TRAF2 antibodies and immunoblotting was performed with anti-IL-15R{alpha} antibodies. As shown in Fig. 4C (upper panel), stimulation of these TRAF2 overexpressing fibroblasts with TNF-{alpha}, IL-15, IL-2, and TNF-{alpha}+IL-2 showed detectable IL-15R{alpha}-TRAF2 complexes precipitated with anti-IL-15R{alpha} antibody. Stimulation with TNF-{alpha}+IL-15 further up-regulated the complexing of overexpressed TRAF2 with the constitutive level of IL-15R{alpha} (Fig. 4C , upper panel, lane 5).

Together, these data provide evidence for the concept that unstimulated IL-15R{alpha} does not bind TRAF2 (or only with low affinity), just as unstimulated monomeric TNFR1 does not bind TRAF2 (19 , 20) . Furthermore, the above findings suggest that the binding affinity of both receptors for TRAF2 increases substantially after stimulation by their respective ligands. Both receptors may then compete for TRAF2, with ligand-stimulated IL-15R{alpha} showing the highest affinity for TRAF2 binding.

The IL-15R{alpha} intracellular tail contains a conserved amino acid motif for TRAF binding
When the TRAF2 binding motif described for the intracellular tail of CD30 and CD40 (47) was next compared with the IL-15R{alpha} chain intracellular segment, an interesting similarity in the distribution of characteristic amino acid residues surfaced (Fig. 5 ). The high absolute degree of identity of amino acid sequence between the TRAF2 binding motif for IL-15R with the motif described for the CD30 intracellular chain is further complemented by conservative substitutions of amino acids with respect to their properties within the potential binding motif (proline and glutamine for valine): short, uncharged residues tend to alternate with acidic amino acids. The strikingly close relatedness of CD30 and IL-15R{alpha} moieties suggests the existence of a common binding domain for TRAF2. Thus, these amino acid sequence homologies further support the biochemical evidence described above, since they reveal a possible structural correlate for TRAF2 association with the IL-15R{alpha} intracellular chain.



View larger version (14K):
[in this window]
[in a new window]
  		Figure 5. Related TRAF2 binding sequences. Comparison of CD40 and CD30 TRAF2 interacting motifs with the IL-15R{alpha} cytoplasmic domain.

TNF-{alpha} and IL-15 costimulation induces NF-{kappa}B activation
Those TNFR1-mediated effects not directly related to apoptosis (e.g., proliferation, cytokine release, differentiation) are thought to operate chiefly via modulating the activity of the transcription factor NF-{kappa}B (24 , 48) . The most common form of NF-{kappa}B is a heterodimer of a 50 kDa (p50) and a 65 kDa protein (RelA or p65) (49 50 51) . NF-{kappa}B complexes are sequestered in the cytosol bound to one or more inhibitor proteins, whose prototype is I{kappa}B{alpha}. Upon stimulation, I{kappa}B{alpha} dissociates from NF-{kappa}B as a result of phosphorylation and proteolytic degradation, thus permitting NF-{kappa}B to translocate to the nucleus (48) . In addition, NF-{kappa}B activation may confer protection against TNFR1-induced apoptosis by induction of cell death protective genes (25 , 32 , 34 , 35 , 50 , 51) .

Therefore, it was interesting to explore whether the potent antiapoptotic properties of IL-15 in L929 cells (Fig. 2) , which had also been noted in unrelated epithelial and hematopoietic systems (12 , 13 , 52) , might also be obtained (at least in part) through NF-{kappa}B activation. Western blot analysis was performed on L929 cell extracts that had been stimulated for various time periods, using I{kappa}B{alpha}-specific antisera. After TNF-{alpha} stimulation of L929 cells for 5 or 15 min, I{kappa}B{alpha} was found to be present in the unphosphorylated form, which binds NF-{kappa}B and thus keeps the latter in an inactive form (49 , 51) .

As shown in Fig. 6 , stimulation of L929 cells by IL-15 alone neither induced nor inhibited I{kappa}B{alpha} phosphorylation. However, simultaneous stimulation of L929 cells with TNF-{alpha} and IL-15 induced I{kappa}B{alpha} phosphorylation, starting 5 min after stimulation; this was completed within 15 min after stimulation (Fig. 6) . In light of the extremely rapid inhibition of TNF-induced apoptosis by IL-15 costimulation (Fig. 2) , this relatively slow response of I{kappa}B{alpha} (and, implicitly, NF-{kappa}B activity) suggests that TRAF2 recruitment to the IL-15 receptor is the faster, earlier, and likely most critical event in the IL-15-mediated inhibition of TNF-induced L929 apoptosis. However, IL-15 receptor-mediated NF-{kappa}B activation by I{kappa}B{alpha} phosphorylation may at least contribute to rescuing the cells from TNF-induced apoptosis.



View larger version (56K):
[in this window]
[in a new window]
  		Figure 6. IL-15 induces TNF-{alpha}-induced I{kappa}B{alpha} phosphorylation. L929 cells were stimulated for the indicated time periods with TNF-{alpha}, IL-15, or TNF-{alpha} plus IL-15. Cytoplasmic extracts were prepared and analyzed by SDS-PAGE. After transfer to nitrocellulose, the blots were probed with I{kappa}B{alpha}-specific antiserum. Position of I{kappa}B{alpha} and its phosphorylated form (p-I{kappa}B{alpha}) is indicated on the left.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
The experiments described here reveal previously unknown interactions between IL-15R- and TNFR1-mediated signaling, and show that IL-15 and TNF-{alpha} are indeed functional antagonists with respect to the control of apoptosis in a murine fibrosarcoma cell line. Moreover, this study provides the first available evidence that IL-15 can modulate fibroblast apoptosis and demonstrates that the IL-15R{alpha} chain can serve as a fully functional signal-transducing receptor. The latter finding is important, since it is a widely held dogma in IL-15 research that only the complete IL-15 receptor complex ({alpha}, ß, {gamma} chain) has signal-transducing functions (4 , 5) . However, the possibility of a minimal constitutive IL-2Rß chain expression on the cell surface has to be acknowledged. Given that the IL-15R{alpha} chain is the high-affinity receptor for IL-15, any role that the IL-2Rß chain might possibly play in the apoptosis-inhibitory effects of IL-15 reported here would, in all likelihood, be of minor importance.

Most important, the current study suggests a plausible molecular scenario by which IL-15 can very rapidly and highly efficiently protect cells from apoptosis. Though it remains to be investigated whether this model is also valid for other cell types, at least in L929 fibroblasts IL-15 appears to deflect TNF-{alpha} -induced apoptosis by blocking adaptor protein recruitment to the TNFR1 (Fig. 7 ). Ligand-stimulated TNFR1 complex and IL-15R{alpha} seem to compete for binding to TRAF2, with IL-15R{alpha} probably showing a higher affinity for TRAF2 than TNFR1. It is tempting to speculate that in analogy to what has already been described for CD30-TRAF2 interactions (53) , the ligand-activated intracellular IL-15R{alpha} chain rapidly `depletes' TRAF2 so that it becomes unavailable for assembly of the apoptosis-signaling TNFR1 complex. However, once all three protein interaction partners become available for study as purified soluble proteins, systematic kinetic and comparative affinity analyses of TNFR1 vs. the IL-15R{alpha} for binding to TRAF2 will be required before this concept can be fully accepted.



View larger version (15K):
[in this window]
[in a new window]
  		Figure 7. Working model. IL-15 inhibits TNF-induced apoptosis by blocking adaptor protein recruitment to TNFR1. A) Ligand binding to the TNFR1 induces recruitment of the adaptor proteins TRADD, FADD, and RIP to the cytoplasmic domain of the receptor via homotypic death domain interactions. In addition, TRAF2 association with TRADD and RIP mediates NF-{kappa}B activation, which may inhibit apoptosis. Instead, FADD association with TRADD is a key positive signal for undergoing apoptosis (18 , 19) . B) TNF-{alpha} and IL-15 costimulation of the respective receptors is postulated to inhibit the association of TRADD, FADD, RIP, and TRAF2 with the TNFR1 cytoplasmic region, whereas the IL-15R{alpha} chain, which displays a TRAF2 binding motif, directly interacts with TRAF2. This `depletes' TRAF2 from the ligand-stimulated TNFR1 complex, thus preventing assembly of the adaptor protein complex that normally signals for induction of apoptosis. In addition, the NF-{kappa}B antagonist I{kappa}B is phosphorylated upon IL-15R{alpha} stimulation, possibly under participation of TRAF2, thus activating NF-{kappa}B. This rescues cells from TNFR1-mediated apoptosis.

Our data also implicate NF-{kappa}B in the actual apoptosis inhibition by costimulation of L929 cells with TNF and IL-15. The time course of TNF/IL-15 costimulation and apoptosis inhibition (Fig. 2) suggests that TRAF2 recruitment to the IL-15 receptor is the fastest, earliest, and likely most critical event in the IL-15-mediated inhibition of TNF-induced L929 cell apoptosis. However, later NF-{kappa}B activation by IL-15R{alpha}-dependent I{kappa}B{alpha} phosphorylation may at least contribute to rescuing the cells from apoptosis. In view of recent evidence that TRAF2 may mediate TNF-induced NF-{kappa}B activation (25 , 46) , it is conceivable that the strong association of TRAF2 with the ligand-activated IL-15R{alpha} chain is critically involved in the I{kappa}B{alpha} phosphorylation that can be observed here only upon costimulation with IL-15 and TNF.

The present experiments do not clarify whether IL-15R stimulation by its ligand blocks the association of cytosolic adaptor proteins with TNFR1 or whether IL-15R stimulation dissociates already bound adaptors proteins from the TNFR1. However, the extraordinarily fast apoptosis inhibition by costimulation with TNF-{alpha} and IL-15 (Fig. 2) suggests an effect very early in the signaling cascade: that adaptor protein recruitment to the TNFR1 was blocked. The observation that TNFR1-mediated apoptosis was inhibited only if IL-15 was administered at the latest 1 min after TNF stimulation (Fig. 2A ) makes it fairly unlikely that such a short time span could have sufficed for both adaptor protein recruitment to and subsequent dissociation from the TNFR1. Instead, ligand binding-induced conformational changes in protein affinity for TRAF2 might well occur that fast. Preliminary results from our laboratory indicate that the assembly of adaptor proteins (TRADD and FADD were tested) to the TNFR1 has already occurred by 1 min after TNF-{alpha} administration and is stable for at least 15 min (S. Bulfone-Paus et al., unpublished data).

Taken together, our data provide evidence for the following scenario of TNF/IL-15 interactions in the control of TNFR1-mediated fibroblast apoptosis (Fig. 7) . In the absence of TNF-{alpha} or IL-15, TRAF2 does not bind to TNFR1 and does not or only minimally binds to IL-15R{alpha}, due to a very low affinity of the unstimulated receptor protein for TRAF2. After stimulation by the respective ligands, which causes a change in receptor conformation, the TRAF2 affinity of IL-15R{alpha} and of the trimerized TNR1 complex increases substantially. The efficiency and time course of IL-15-mediated blocking of TNF-induced apoptosis in L929 cells (Fig. 2) suggest that in this putative, high-affinity competition of ligand-stimulated TNFR1 and IL-15R{alpha} for TRAF2 binding, IL-15R{alpha} subsequently wins if IL-15R{alpha} is stimulated by IL-15 in time to increase its normally low affinity for TRAF2 before most TRAF2 is bound to the TNFR1 complex. Thus, the stimulated IL-15R{alpha} attracts most TRAF2 so that it is no longer available for initiating the proapoptotic cascade mediated by proper adaptor protein assembly to the TNFR1. I{kappa}B{alpha} phosphorylation upon costimulation with TNF-{alpha} and IL-15 (Fig. 6) , which should result in NF-{kappa}B activation (25 , 32 , 34 , 35 , 50 , 51) , may be exploited by IL-15-stimulated IL-15R{alpha} as a second pathway for inhibiting TNFR1-mediated apoptosis in this fibroblast line. TRAF2 may be an important regulatory element of this pathway as well.

This scenario does not yet explain why the association of TRAF2 to the IL-15R{alpha} chain is made stronger by costimulation with TNF-{alpha} and IL-15. By coimmunoprecipitation experiments, we are currently testing the hypothesis that both cognate receptors need to be physically associated to compete for TRAF2 binding and that only ligand binding to both receptors brings TNFR1 and IL-15R{alpha} into sufficiently close proximity for the proposed competition for TRAF2 binding to be able to unfold. First, as yet preliminary data from our laboratory indicate that extracts from IL-15R{alpha} overexpressing L929 cells immunoprecipitated with anti-TNFR1 can indeed coprecipitate the IL-15R{alpha} (S. Bulfone-Paus and E. Bulanova, unpublished data).

The observation that IL-15 blocks TNFR1-mediated cell death very early in, and at a critical crossroads of, the apoptosis signaling cascade designates IL-15 as an unusually powerful apoptosis antagonist with intriguing therapeutic potential in a large number of clinical situations where apoptosis inhibition appears desirable (54 , 55) . Our finding that TRAF2 recruitment to the ligand-stimulated IL-15R{alpha} chain is crucial in this respect should also facilitate the development of novel antiapoptotic drugs unrelated to IL-15 signaling that directly target TRAF2 and its effects on NF-{kappa}B activation.


   ACKNOWLEDGMENTS
 
We are grateful to Maria-Virgilia Odenwald and Gabriela Hein for their excellent technical assistance. This study was supported in part by grants from the Deutsche Forschungsgemeinschaft to S.B.P. and T.P. (SFB 506/C5), and from Deutsche Krebshilfe to R.P.


   FOOTNOTES
 
2 Abbreviations: DD, death domain; ECL, enhanced chemiluminescence; FACS, fluorescein-activated cell sorter; FADD, Fas-associated protein with death domain; FCS, fetal calf serum; IFN, interferon; IL, interleukin; IL-15R, interleukin 15 receptor; NK, natural killer; PBS, phosphate-buffered saline; PI, propidium iodide; RIP, receptor interacting protein; RT-PCR, reverse transcriptase-polymerase chain reaction; SDS-PAGE, sodium dodecyl sulfate-polyacrylamide gel electrophoresis; TNF, tumor necrosis factor; TRADD, TNFR1-associated death domain protein; TRAF2, TNFR-associated factor.

Received for publication August 11, 1998. Revised for publication March 15, 1999.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Grabstein, K. H., Eisenman, J., Shanebeck, K., Rauch, C., Srinivasan, S., Fung, V., Beers, C., Richardson, J., Schoenborn, M. A., Ahdieh, M., et al (1994) Cloning of a T cell growth factor that interacts with the beta chain of the interleukin-2 receptor. Science 264,965-968[Abstract/Free Full Text]
  2. Bamford, R. N., Grant, A. J., Burton, J. D., Peters, C., Kurys, G., Goldman, C. K., Brennan, J., Roessler, E., Waldmann, T. A. (1994) The interleukin (IL) 2 receptor beta chain is shared by IL-2 and a cytokine, provisionally designated IL-T, that stimulates T-cell proliferation and the induction of lymphokine-activated killer cells. Proc. Natl. Acad. Sci. USA 91,4940-4944[Abstract/Free Full Text]
  3. Giri, J. G., Ahdieh, M., Eisenman, J., Shanebeck, K., Grabstein, K., Kumaki, S., Namen, A., Park, L. S., Cosman, D., Anderson, D. (1994) Utilization of the beta and gamma chains of the IL-2 receptor by the novel cytokine IL-15. EMBO J 13,2822-2830[Medline]
  4. Tagaya, Y., Bamford, R. N., DeFilippis, A. P., Waldmann, T. A. (1996) IL-15: a pleiotropic cytokine with diverse receptor/signaling pathways whose expression is controlled at multiple levels. Immunity 4,329-336[Medline]
  5. Anderson, D. M., Kumaki, S., Ahdieh, M., Bertles, J., Tometsko, M., Loomis, A., Giri, J., Copeland, N. G., Gilbert, D. J., Jenkins, N. A., Valentine, V., Shapiro, D. N., Morris, S. W., Park, L. S., Cosman, D. (1995) Functional characterization of the human interleukin-15 receptor {alpha} chain and close linkage of IL15RA and IL2RA genes. J. Biol. Chem. 270,29862-29869[Abstract/Free Full Text]
  6. Carson, W. E., Giri, J. G., Lindemann, M. J., Linett, M. L., Ahdieh, M., Paxton, R., Anderson, D., Eisenmann, J., Grabstein, K., Caligiuri, M. A. (1994) Interleukin (IL) 15 is a novel cytokine that activates human natural killer cells via components of the IL-2 receptor. J. Exp. Med. 180,1395-1403[Abstract/Free Full Text]
  7. Giri, J. G., Kumaki, S., Ahdieh, M., Friend, D. J., Loomis, A., Shanebeck, K., DuBose, R., Cosman, D., Park, L. S., Anderson, D. M. (1995) Identification and cloning of a novel IL-15 binding protein that is structurally related to the alpha chain of the IL-2 receptor. EMBO J 14,3654-3663[Medline]
  8. Armitage, R. J., Macduff, B. M., Eisenman, J., Paxton, R., Grabstein, K. H. (1995) IL-15 has stimulatory activity for the induction of B cell proliferation and differentiation. J. Immunol. 154,483-490[Abstract]
  9. Bulfone-Paus, S., Dürkop, H., Paus, R., Krause, H., Pohl, T., Onu, A. (1997) Differential regulation of human T lymphoblast functions by IL-2 and IL-15. Cytokine 9,507-513[Medline]
  10. Di Santo, J. (1997) Shared receptors, distinct functions. Curr. Biol. 7,R424-R426[Medline]
  11. Onu, A., Pohl, T., Krause, H., Bulfone-Paus, S. (1997) Regulation of IL-15 secretion via the leader peptide of two IL-15 isoforms. J. Immunol. 158,255-262[Abstract]
  12. Bulfone-Paus, S., Ungureanu, D., Pohl, T., Lindner, G., Paus, R., Rückert, R., Krause, H., Kunzendorf, U. (1997) Interleukin-15 protects from lethal apoptosis in vivo. Nature Med 3,1124-1128[Medline]
  13. Lindner, G., Rückert, R., Bulfone-Paus, S., Paus, R. (1998) Inhibition of chemotherapy-induced keratinocyte apoptosis in vivo by an interleukin-15-IgG fusion protein (letter) J. Invest. Dermatol. 141,101-102
  14. Itoh, N, Nagata, S. (1993) A novel protein domain required for apoptosis: mutational analysis of human Fas antigen. J. Biol. Chem. 268,10932-10937[Abstract/Free Full Text]
  15. Tartaglia, L. A., Ayres, T. M., Wong, G. H., Goeddel, D. V. (1993) A novel domain within the 55 kD TNF receptor signals cell death. Cell 74,845-853[Medline]
  16. Tartaglia, L. A., Rothe, M., Hu, Y. F., Goeddel, D. V. (1993) Tumor necrosis factor's cytotoxic activity is signaled by the p55 TNF receptor. Cell 73,213-216[Medline]
  17. Nagata, S., Suda, T. (1995) Fas and Fas ligand: lpr and gld mutations. Immunol. Today 16,39-43[Medline]
  18. Wallach, D. (1997) Cell death induction by TNF: a matter of self control. Trends. Biochem. Sci. 22,107-109[Medline]
  19. Wallach, D. (1997) Placing death under control. Nature (London) 388,123-126[Medline]
  20. Nagata, S. (1997) Apoptosis by death factor. Cell 88,355-365[Medline]
  21. Chinnaiyan, A. M., O'Rourke, K., Yu, G. L., Lyons, R. H., Garg, M., Duan, D. R., Xing, L., Gentz, R., Ni, J., Dxit, V. M. (1996) Signal transduction by DR3, a death domain-containing receptor related to TNFR-1 and CD95. Science 264,707-710
  22. Kitson, , . j.,Raven, T., Jiang, Y. P., Goeddel, D., Giles, K. M., Pun, K. T., Grinham, C. J., Brown, R., Farrow, S. N. (1996) A death domain-containing receptor that mediates apoptosis. Nature (London) 384,372-375[Medline]
  23. Marsters, S. A., Sheridan, J. P., Donahue, C. J., Pitti, R. M., Gray, C. L., Goddard, A. D., Bauer, K. D., Ashkenazi, A. (1996) Apo-3, a new member of the tumor necrosis factor receptor family, contains a death domain and activates apoptosis and NF-{kappa}B. Curr. Biol. 6,1669-1676[Medline]
  24. Hsu, H., Xiong, J., Goeddel, D. V. (1995) The TNF receptor 1-associated protein TRADD signals cell death and NF-{kappa}B activation. Cell 81,495-504[Medline]
  25. Hsu, H., Shu, H. B., Pan, M. G., Goeddel, D. V. (1996b) TRADD-TRAF2 and TRADD-FADD interactions define two distinct TNF receptor 1 signal transduction pathways. Cell 84,299-308[Medline]
  26. Boldin, M. P., Varfolomeev, E. E., Pancer, Z., Mett, I. L., Camonis, J. H., Wallach, D. (1995) A novel protein that interacts with the death domain of Fas/APO1 contains a sequence motif related to the death domain. J. Biol. Chem. 270,7795-7798[Abstract/Free Full Text]
  27. Chinnaiyan, A. M., O'Rourke, K., Tewari, M., Dixit, V. M. (1995) FADD, a novel death domain-containing protein, interacts with the death domain of Fas and initiates apoptosis. Cell 81,505-512[Medline]
  28. Stanger, B. Z., Leder, P., Lee, T. H., Kim, E., Seed, B. (1995) RIP: a novel protein containing a death domain that interacts with Fas/APO-1 (CD95) in yeast and causes cell death. Cell 81,513-523[Medline]
  29. Hsu, H., Huang, J., Shu, H. B., Baichwal, V., Goeddel, D. V. (1996) TNF-dependent recruitment of the protein kinase RIP to the TNF receptor-1 signaling complex. Immunity 4,387-396[Medline]
  30. Baker, S. J., Reddy, E. P. (1996) Transducers of life and death: TNF receptor superfamily and associated proteins. Oncogene 12,1-9[Medline]
  31. Rothe, M., Wong, S. C., Henzel, W. J., Goeddel, D. V. (1994) A novel family of putative signal transducers associated with the cytoplasmic domain of the 75 kDa tumor necrosis factor receptor. Cell 78,681-692[Medline]
  32. Beg, A. A., Baltimore, D. (1996) An essential role for NF-{kappa}B in preventing TNF-{alpha}-induced cell death. Science 274,782-784[Abstract/Free Full Text]
  33. Wang, C-Y., Mayo, M. W., Baldwin, A. S., Jr (1996) TNF-and cancer therapy-induced apoptosis: potentiation by inhibition of NF-{kappa}B. Science 274,784-787[Abstract/Free Full Text]
  34. Van Antwerp, D. J., Martin, S. J., Kafri, T., Green, D. R., Verma, I. M. (1996) Suppression of TNF-{alpha}-induced apoptosis by NF-{kappa}B. Science 274,787-789[Abstract/Free Full Text]
  35. Liu, Z., Hsu, H., Goeddel, D. V., Karin, M. (1996) Dissection of TNF receptor 1 effector functions: JNK activation is not linked to apoptosis while NF-{kappa}B activation prevents cell death. Cell 87,565-576[Medline]
  36. Cleveland, J. L., Ihle, J. N. (1995) Contenders in FasL/TNF death signaling. Cell 81,479-482[Medline]
  37. Fraser, A., Evan, G. (1996) A license to kill. Cell 85,781-784[Medline]
  38. Jacobson, M. D., Weil, M., Raff, M. C. (1997) Programmed cell death in animal development. Cell 88,347-354[Medline]
  39. White, E. (1996) Life, death, and the pursuit of apoptosis. Genes Dev 10,1-15[Free Full Text]
  40. Tartaglia, L. A., Goeddel, D. V. (1992) Two TNF receptors. Immunol. Today 13,151-153[Medline]
  41. Xie, K., Huang, S., Dong, Z., Fidler, I. J. (1993) Cytokine-induced apoptosis in transformed murine fibroblasts involves synthesis of endogenous nitric oxide. Int. J. Oncol. 3,1043-1048
  42. Coligan, J. E., Kruisbeek, A. M., Margulies, D. H., Shevach, E. M., Strober, W. (1994) Current Protocols in Immunology Wiley & Sons, Inc. New York.
  43. Kunzendorf, U., Pohl, T., Bulfone-Paus, S., Krause, H., Notter, M., Onu, A., Walz, G., Diamantstein, T. (1996) Suppression of cell-mediated and humoral immune responses by an interleukin-2-immunoglobulin fusion protein in mice. J. Clin. Invest. 97,1204-1210[Medline]
  44. Nicoletti, I., Migliorati, G., Pagliacci, M. C., Grignani, F., Riccardi, C. (1991) A rapid and simple method for measuring thymocyte apoptosis by propidium iodide staining and flow cytometry. J. Immunol. Methods 139,271-279[Medline]
  45. Lewis, M., Tartaglia, L. A., Lee, A., Bennet, G. L., Rice, G. C., Wong, G. H. W., Chen, E. Y., Goeddel, D. V. (1991) Cloning and expression of cDNAs for two distinct murine tumor necrosis factor receptors demonstrate one receptor is species specific. Proc. Natl. Acad. Sci. USA 88,2830-2834[Abstract/Free Full Text]
  46. Kelliher, M. A., Grimm, S., Ishida, Y, Kuo, F., Stanger, B. Z., Leder, P. (1998) The death domain kinase RIP mediates the TNF-induced NF-{kappa}B signal. Immunity 8,297-303[Medline]
  47. Boucher, L. M., Marengere, L. E. M., Lu, Y., Thukral, S., Mak, T. W. (1997) Binding sites of cytoplasmic effectors TRAF1, 2, and 3 on CD30 and other members of the TNF receptor superfamily. Biochem. Biophy. Res. Commun. 233,592-600[Medline]
  48. Baldwin, A. S. (1996) The NF-{kappa}B and I{kappa}B proteins: new discoveries and insights. Annu. Rev. Immunol. 14,649-681[Medline]
  49. Baeuerle, P. A., Baltimore, D. (1989) A 65-kD subunit of active NF-{kappa}B is required for inhibition of NF-{kappa}B by I{kappa}B. Genes Dev 3,1689-1698[Abstract/Free Full Text]
  50. Baichwal, V. R., Baeuerle, P. A. (1997) Activate NF-{kappa}B or die?. Curr. Biol. 7,R94-R96[Medline]
  51. Ghosh, S., May, M. J., Kopp, E. B. (1998) NF-{kappa}B and REL proteins: evolutionary conserved mediators of immune responses. Annu. Rev. Immunol. 16,225-260[Medline]
  52. Girard, D., Paquet, M. E., Paquin, R., Beaulieu, D. (1996) Differential effects of interleukin-15 (IL-15) and IL-2 on human neutrophils: modulation of phagocytosis, cytoskeleton rearrangement, gene expression and apoptosis by IL-15. Blood 88,3176-3184[Abstract/Free Full Text]
  53. Duckett, C. S., Thompson, C. B. (1997) CD30-dependent degradation of TRAF2: implications for negative regulation of TRAF signaling and the control of cell survival. Genes Dev. 11,2810-2821[Abstract/Free Full Text]
  54. Jacobson, M. D. (1998) Anti-apoptosis therapy: a way of treating neural degeneration?. Curr. Biol. 8,R418-R422[Medline]
  55. Thompson, C. B. (1995) Apoptosis in the pathogenesis and treatment of disease. Science 267,1456-1462[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 Mol. Cell. Biol.Home page
E. H. Duitman, Z. Orinska, E. Bulanova, R. Paus, and S. Bulfone-Paus
How a Cytokine Is Chaperoned through the Secretory Pathway by Complexing with Its Own Receptor: Lessons from Interleukin-15 (IL-15)/IL-15 Receptor {alpha}
Mol. Cell. Biol., August 1, 2008; 28(15): 4851 - 4861.
[Abstract] [Full Text] [PDF]

Home page