(The FASEB Journal. 1999;13:1537-1546.)
© 1999 FASEB
Melatonin inhibits expression of the inducible NO synthase II in liver and lung and prevents endotoxemia in lipopolysaccharide-induced multiple organ dysfunction syndrome in rats
ELENA CRESPO*,
MANUEL MACÍAS*,
DAVID POZO
,
GERMAINE ESCAMES*,
MIGUEL MARTÍN*,
FRANCISCO VIVES*,
JUAN M. GUERRERO and
DARÍO ACUÑA-CASTROVIEJO*1
* Departamento de Fisiología, Instituto de Biotecnología, Universidad de Granada, Spain;
Departamento de Bioquímica Médica y Biología Molecular, Facultad de Medicina, Universidad de Sevilla, Spain
1Correspondence: Departamento de Fisiología, Facultad de Medicina, Avda. de Madrid 11, E-18012 Granada, Spain. E-mail: dacuna{at}goliat.ugr.es
 |
ABSTRACT
|
|---|
We evaluated the role of melatonin in endotoxemia caused by
lipopolysaccharide (LPS) in unanesthetized
rats. The expression of inducible isoform of nitric oxide synthase
(iNOS) and the increase in the oxidative stress seem to be responsible
for the failure of lungs, liver, and kidneys in endotoxemia. Bacterial
LPS (10 mg/kg b.w) was i.v. injected 6 h before rats were killed
and melatonin (10–60 mg/kg b.w.) was i.p. injected before and/or after
LPS. Endotoxemia was associated with a significant rise in the serum
levels of aspartate and alanine aminotransferases,
-glutamyl-transferase, alkaline phosphatase, creatinine, urea, and
uric acid, and hence liver and renal dysfunction. LPS also increased
serum levels of cholesterol and triglycerides and reduced glucose
levels. Melatonin administration counteracted these organ and metabolic
alterations at doses ranging between 20 and 60 mg/kg b.w. Melatonin
significantly decreased lung lipid peroxidation and counteracted the
LPS-induced NO levels in lungs and liver. Our results also show an
inhibition of iNOS activity in rat lungs by melatonin in a
dose-dependent manner. Expression of iNOS mRNA in lungs and liver was
significantly decreased by melatonin (60 mg/kg b.w., 58–65%). We
conclude that melatonin inhibits NO production mainly by inhibition of
iNOS expression. The inhibition of NO levels may account for the
protection of the indoleamine against LPS-induced endotoxemia in
rats.—Crespo, E., Macías, M., Pozo, D., Escames, G.,
Martín, M., Vives, F., Guerrero, J. M.,
Acuña-Castroviejo, D. Melatonin inhibits expression of the
inducible NO synthase II in liver and lung and prevents endotoxemia in
lipopolysaccharide-induced multiple organ dysfunction syndrome in rats.
Key Words: iNOS • endotoxic shock • genomic effects
|
INTRODUCTION
|
|---|
MANY OF THE pathological consequences of gram-negative
shock depend on the bacterial membrane component lipopolysaccharide
(LPS).2
Septic shock is
characterized by hypotension, hyporeactivity to vasoconstrictor agents,
inadequate tissue perfusion, vascular damage, and disseminated
intravascular coagulation leading to multiple organ failure and death
(1)
.
Nitric oxide (NO) is an important messenger regulating nervous, immune,
and cardiovascular homeostasis (2)
. Increases in NO have
been implicated in the pathogenesis of circulatory shock and
inflammation (3
4
5
6)
. LPS-dependent induction of the
inducible isoform of NO synthase (iNOS) is responsible for the
overproduction of NO (3
, 6
, 7)
. NO can also react with
superoxide anion (O2·-), leading to
formation the peroxynitrite anion (ONOO-)
(8)
, which oxidizes sulfhydryl groups and generates
hydroxyl radical (·OH) (9)
. Interaction of
LPS with macrophages results in the generation of free radicals,
including hydrogen peroxide
(H2O2),
O2·-, and ·OH, leading to oxidative
damage in many tissues such as lungs, liver, and kidneys
(10)
. This progression of shock to a multiple organ
dysfunction syndrome is associated with a substantial increase in
mortality (11)
.
Nonselective inhibitors of all NOS isoforms may cause excessive
vasoconstriction by endothelial NOS (eNOS) inhibition, increasing the
incidence of organ ischemia, oxidative stress, and mortality
(12)
. Thus, the beneficial effects of NOS activity
inhibitors may depend on the inhibition of iNOS activity
(4)
. However, the inhibition of NOS activity with
aminoethyl-isothiourea, a relatively selective inhibitor of iNOS
activity, or NG-methyl-L- arginine (L-NMMA), a
nonselective inhibitor of NOS activity, attenuates the liver
dysfunction associated with LPS-induced endotoxemia in the rat without
significant increase in arterial blood pressure, although eNOS activity
was also inhibited (13)
. Thus, the production of NO and
NO-dependent free radicals seems to contribute to the development of
multiple organ failure in endotoxic shock.
Melatonin (N-acetyl-5-methoxytryptamine, aMT) efficiently scavenges
both the hydroxyl and peroxyl radicals (14
15
16
17)
acting at
any subcellular component (18)
, thus decreasing tissue
damage due to free radical generation (19
, 20)
. The
inhibition of the constitutive NOS (cNOS) activity
(21
22
23)
by aMT suggests its interaction with other NOS
isoforms. In fact, both antioxidant (24
, 25)
and
inhibitory iNOS (26)
activities of aMT appear to be
involved in the protective effect of the indoleamine in LPS-induced
endotoxemia.
We used the present experimental paradigm, which mimics the human
endotoxemia (27)
, to study whether aMT inhibits the
expression of iNOS induced by LPS administration to rats in
vivo. We also studied the efficacy of aMT to counteract the
multiple organ failure manifestations.
|
MATERIALS AND METHODS
|
|---|
Chemicals
Lipopolysaccharide (LPS from Escherichia coli,
serotype 0127:B8), melatonin, DL-dithiotreitol (DTT), pepstatin A,
phenylmethylsulfonylfluoride (PMSF), aprotinin, leupeptin, bacitracin,
benzamidine, Na-p-tosyl-L-lysine chloromethyl ketone (TLCK), NADPH,
5,6,7,8- tetrahydro-L-biopterin dihydrochloride (H4-biopterin), FAD,
hypoxanthine-9-ß-D-ribofuranoside (inosine), bovine serum albumin,
L-arginine, N-(2-hydroxyethyl)piperazine-N'-(2- hydroxypropanesulfonic
acid) (HEPES), L-NMMA, ethylene glycol bis-(ß-aminoethyl
ether)-tetraacetic acid (EGTA), chloroform, L-citrulline, Dowex-50W
(50x8–200), N-(1-naphthyl)ethylenediamine dihydrochloride,
sulfanilamide, DTT, guanidine-thiocyanate, diethyl pyrocarbonate
(DEPC), Denhardt's solution, formamide, formaldehyde, herring sperm
DNA, Tween 20, sodium chloride, and sodium nitrite were purchased from
Sigma Química (Spain). UV cross-linker,
L-3H-arginine (58 Ci/mmol),
-32P-dCTP, and
-32P-dATP were obtained from Amersham
(Amersham, Bucks, U.K.). Tris(hydroxymethyl)aminomethane
(Tris-HCl), calcium chloride, and phosphoric acid were obtained from
Merck (Spain). The Bioxytech LPO-586 kit, purchased from Cayman
Chemical (Ann Arbor, Mich.), was used to measure the products of lipid
peroxidation. M-MLV reverse transcriptase, Taq DNA
polymerase, RNase inhibitor, random hexamer primers
[dp(N)6], dATP, dCTP, dGTP, and dTTP were
obtained from Promega (Madison, Wis.). NuSieve agarose was obtained
from FMC BioProducts (Rockland, Maine). Phenol/water saturated solution
was obtained from Eurobio (France). The oligonucleotides and DNase FPLC
pure were obtained from Pharmacia Biotech (Uppsala, Sweden). Zeta-probe
nylon blotting membranes and all electrophoreses reagents were obtained
from Bio-Rad (Hercules, Calif.). All other chemicals were of reagent
grade.
Animals and treatments
Male Wistar rats (200–250 g) were kept in the university's
animal facilities on a 12 h light/12 h dark cycle at 22°C and on
regular chow and water until the day of the experiment. Three days
before the experiment, the jugular vein was cannulated under
intraperitoneal (i.p.) equithesin anesthesia (1 ml/kg) for the
administration of LPS. Animals were divided into three experimental
groups of 6–8 animals each and two control groups of 10 animals. All
groups except control received an intravenous (i.v.) injection of LPS
(serotype 0127:B8, 10 mg/kg body weight (b.w.) dissolved in 0.3 ml of
saline) between 08:00 and 09:00 AM to minimize diurnal
variations. In trial experiments, several doses of i.v. LPS were tested
to find the optimal dose to induce iNOS and nitrites. A dose-dependent
effect was found, but the endotoxemia caused by 30 mg/kg b.w. produced
the animals death in 4–5 h. Thus, we chose the i.v. dose of 10 mg/kg
b.w. as optimal to perform the experiments.
Melatonin-treated groups were i.p. injected with one to six doses of
aMT (10 to 60 mg/kg body wt dissolved in 0.2 ml of 0.25%
ethanol:saline). The LPS + aMT group was divided into four subgroups
depending on the schedule of aMT administration: LPS + aMTb received a
dose of aMT 30 min before LPS; LPS + aMTa received a dose of aMT 60 min
after LPS; LPS + aMT2 received two aMT doses, one injected 30 min
before LPS and the second injected 60 min after LPS; LPS + aMT6
received six injections of aMT: one injection 30 min before LPS, five
injections beginning 60 min after LPS, and the last dose coinciding
with 1 h before death. A saline-treated and aMT-treated groups
injected with saline and aMT served as controls. There were no
differences between the results obtained with six doses of saline to
simulate the six doses of aMT compared with 1 dose; the data of the
saline control group shown in the results correspond to the group
injected with six saline injections. Similarly, six doses of aMT
produced the same results as one dose, so the data of the aMT control
group correspond to the group injected with six doses of aMT. Six hours
after LPS injection, animals were killed by cervical dislocation and
exsanguination. Lungs and livers were quickly collected, washed in cold
saline, and frozen to -80°C in liquid nitrogen. Blood samples were
also collected for biochemical analysis.
To assess whether the increase in organ nitrite due to LPS treatment
can be blocked by NOS inhibitors, a group of six LPS-treated animals
was i.v. injected with L-NMMA (3 mg/kg b.w. dissolved in 200 µl
saline for each injection; flow rate of 30 µl/min through jugular
vein) as follows: one injection 30 min before LPS and three injections
beginning 60 min after LPS, and the last dose 2 h before death. A
saline-treated and an L-NMMA-treated group were injected with saline;
L-NMMA served as controls.
Quantification of liver, kidney, and metabolic impairment
Blood samples obtained from the animals at the time of death
were centrifuged (2500xg for 10 min) to prepare serum. All
serum samples were analyzed within 24 h by the laboratory of
biopathology of the Granada University's Hospital by routine methods.
We assessed liver dysfunction and failure by measuring the rise in
serum levels of aspartate aminotransferase (GOT, a nonspecific marker
for hepatic parenchymal injury); alanine aminotransferase (GPT, a
specific marker for hepatic parenchymal injury); alkaline
phosphatase (ALP, a marker of the relative degree of hepatocellular
damage and of obstruction, intrahepatic or extrahepatic, tends to
parallel the degree of hyperbilirubinemia); total and direct bilirubin
(specific markers for the development of cholestasis and of liver
failure); and -glutamyltransferase (GT, a marker for
cholestasis). Renal dysfunction and failure were assessed by measuring
the rise in serum levels of creatinine (an indicator of reduced
glomerular filtration rate, hence renal failure), and urea and uric
acid (an indicators of impaired excretory function of the kidney and/or
increased catabolism). Metabolism impairment was assessed by measuring
the changes in serum levels of cholesterol and triglycerides (as
markers for lipid metabolism alteration); glucose (as marker for
carbohydrate metabolism alteration); and total proteins and albumin (as
markers for protein metabolism alteration).
Lipid peroxidation (LPO) assay
Soon after the animals were killed, the rats' abdomens were
opened and the heart was perfused with ice-cold saline (4°C) to
eliminate the excess of iron released from intracellular storage sites.
Lungs and liver were removed and cooled on dry ice. Approximately 100
mg of lung and liver tissues were homogenized with a Stuart Scientific
stirrer in ice-cold 20 mM Tris-HCl buffer, pH 7.4, to produce a 1/10
homogenate. The crude homogenate was centrifuged at 2500 x
g for 30 min at 4°C. Aliquots of the supernatant were
either stored at -20°C for total protein determination
(28)
or used to calculate LPO. Malondialdehyde (MDA) and
4-hydroxyalkenals (4HDA) concentrations provide a convenient index of
lipid peroxidation (29)
. The Bioxytech LPO-568 kit (Cayman
Chemical) was used. The kit takes advantage of a chromogenic reagent
that reacts with MDA and 4HDA at 45°C, yielding a stable chromophore
with maximal absorbance at the 586 nm wavelength. The light wavelength
and the low temperature of incubation used for these measurements
eliminate interference and undesirable artifacts.
Nitrite determination
Tissues were cooled in ice-cold distilled water and homogenized
(0.1 g/ml). The crude homogenate was centrifuged at 21,000 x
g for 20 min at 4°C, and aliquots of the supernatant were
either stored at -20°C for total protein determination
(28)
or used to calculate nitrite levels. The amounts of
nitrite in supernatants or in serum were measured following the Griess
reaction (30)
by incubating a 100 µl of sample with 100
µl of Griess reagent [0.1% N-(1-naphthyl)ethylenediamine
dihydrochloride; 1% sulfanilamide in 5% phosphoric acid; 1:1] at
room temperature for 20 min. The absorbance at 550 nm (OD 550) was
measured with a Molecular Devices microplate reader. Nitrite
concentration was calculated by comparison with the OD 550 of a
standard solution of known sodium nitrite concentrations.
To assess whether the nitrite values measured in the tissues collected
from animals were artifactually generated due to accumulated blood,
previous experiments in postmortem perfused animals were undertaken.
Briefly, at the end of the experiment, the rats were anesthetized with
ether and a blood sample was taken from the aorta. Then the aorta was
clamped, the right auricle cut, and 25 ml of cold saline was passed
through the right ventricle to perfuse the organs. At the end of this
procedure, lungs and livers of the animals were quickly removed, placed
in cold nitrogen, and frozen to -80°C. Nitrite concentrations in
perfused tissues were not significantly different from nitrite levels
measured in nonperfused tissues. Thus, nitrites were routinely measured
in nonperfused tissues washed with saline.
Assay of iNOS activity
Lungs were thawed and homogenized (0.1 g/ml) in ice-cold buffer
(25 mM Tris, 0.5 mM DTT, 10 µg/ml pepstatin, 10 µg/ml leupeptin, 10
µg/ml aprotinin, 1 mM PMSF, pH 7.6). Subsequent procedures were
carried out at 0–4°C. The crude homogenate was centrifuged at
2500 x g for 5 min and aliquots of the supernatant
were either stored at -20°C for total protein determination
(28)
or used immediately for NOS activity determination.
NOS activity was measured by monitoring the conversion of
L-3H- arginine to
L-3H-citrulline (31)
. The final
incubation volume was 100 µl and consisted of 10 µl crude
homogenate added to prewarmed (37°C) buffer to give (final
concentration) 25 mM Tris, 1 mM DTT, 30 µM H4-biopterin, 10 µM FAD,
0.5 mM inosine, 0.5 mg/ml bovine serum albumin, 0.1 mM
CaCl2, 10 µM L-arginine, 40 nM
L-3H-arginine, pH 7.6. The reaction was started
by the addition of 10 µl NADPH (0.75 mM final) and continued for 30
min at 37°C. Control incubations were done by NADPH omission. The
reaction was stopped by adding 400 µl of cold 0.1 M HEPES, 10 mM
EGTA, 0.175 mg/ml L-citrulline, pH 5.5. The reaction mixture was
decanted onto a 2 ml column packed with Dowex-50W ion exchange resin
(Na+ form) and eluted with 1.2 ml of water.
L-3H-arginine was quantified by liquid
scintillation spectroscopy. The retention of
L-3H-arginine in this process was greater then
98%. Specific enzymatic activity was determined by subtracting the
control value, usually less than 1% of the added radioactivity. NOS
activity is referred to as picomoles of
L-3H-citrulline produced per mg protein/min.
Analysis of iNOS protein expression
Frozen liver and lung specimens were homogenized with a Polytron
homogenizer (Kinematic, Switzerland) at 4°C in HEPES 20 mM pH 7.4
containing 0.02% (W/V) bacitracin, 0.4 mM PMSF, 1 mM benzamidine, 1.5
µM pepstatin A, 0.1 mM TLCK, and 0.1 mM aprotinin. The homogenates
were then centrifuged at 4000 x g for 10 min at 4°C
and supernatants were collected to assay the protein expression. The
protein content of the supernatant was determined with a protein assay
kit (Bio-Rad) based on the method of Bradford (32)
.
Samples (75 µg) were eluted from the supernatant directly into the
sodium dodecyl sulfate (SDS) sample buffer for 7.5% SDS-polyacrylamide
gel electrophoresis (33)
and then transferred onto
nitrocellulose membranes (Hoeffer, Calif.). Electroblots were blocked
in 25 mM Tris-ClH buffer, pH 7.4, containing 150 mM NaCl, 0.05% (v/v)
Tween 20 (TBST buffer) and 5% (w/v) dry milk. Western analysis was
carried out using a 1:2,500 dilution in TBST buffer of specific
polyclonal antibody against iNOS (Santa Cruz Biotechnology, Santa Cruz,
Calif.) for 2 h at room temperature. After TBST washing procedure,
the blots were incubated with 1:5,000 peroxidase labeled anti-rabbit
antibody (Amersham-Pharmacia Biotech, Uppsala, Sweden) in TBST for 30
min at room temperature. The immunoreaction was detected using the
enhanced chemiluminescence EC system. (Amersham-Pharmacia Biotech).
Analysis of messenger RNA levels for iNOS
Total cellular RNA was purified using guanidinium
thiocyanate-phenol-chloroform extraction (34)
.
Single-stranded cDNA was synthesized from both rat liver and lung
LPS-stimulated total RNA/DNase treated using the following method. Two
microliters of high-quality RNA (5 µg/µl) was preincubated with 0.5
µg of dp(N)6 and 26 µl Rnase-free
H2O at 85°C for 15 min, then rapidly chilled on
ice. To this reaction were added 1 µl RNasin (40 U/µl), 10 µl 5x
reverse transcriptase (RT) buffer, 5 µl dithiothreitol (100 mM), and
2.5 µl deoxyribonucleotide (dNTP; 10 mM each); the mixture was
incubated at 39°C for 3 min. Finally, 1.5 µl Moloney murine
leukemia virus reverse transcriptase (200 U/µl) was added to give a
final volume of 50 µl; the reaction was incubated at 39°C for 60
min and terminated by placing it on ice after deactivation at 95°C
for 5 min. Polymerase chain reaction (PCR) reactions contained 1 µM
specific primers to inducible isoforms amplify a 223-bp portion of NOS
(35
, 36)
. The forward primer was
TGCATGGACCAGTATAAGGCAAGC (5' to 3') and the reverse primer
was CTTCTGGTCGATGTCATGAGCAA. For the PCR reactions (1x PCR reaction
buffer, 1.5 mM MgCl2, 200 µM dNTPs), 2 µl of
RT product was amplified after `hot start' procedure, 30 PCR cycles
(94°C, 1 min; 65°C, 1 min; 72°C, 1 min), followed by a final 10
min extension at 72°C (PTC-150 Minicycler (MJ Research, Watertown,
Mass.). The PCR products were run on a 1.5% agarose gel, excised,
purified, and random primer labeled with
-32P-dCTP and
-32P-dATP. RNA samples (20 µg) were
electrophoresed on 1.2% agarose-formaldehyde gels, washed twice (15
min each) in DEPC-water at 65°C, transferred to zeta-probe membranes,
and fixed using a UV cross-linker (750 µJ/cm2).
The blots were prehybridized (40°C, 3 h) in 5x SSPE, 0.1% SDS,
50% formamide, 2.5x Denhardt's solution, and 100 µg/ml denatured
herring sperm DNA. Hybridization was performed at 42°C for 16 h
with 32P heat-denatured DNA probe in the
prehybridization buffer, followed by washing twice (15 min each, room
temperature) in 1x SSC, 0.1% SDS, and again washed twice (20 min
each) to a final stringency of 0.1x SSC, 0.1% SDS at 55°C. The
membranes were exposed to X-ray film with intensifying screens at
-80°C and developed.
Statistical analyses
All data in the figures and text are expressed as mean ±
SE of n observations, where n
represents the number of animals or blood samples studied. A two-way
analysis of variance, followed by a Dunnet's post hoc test when
appropriate, was used to compare means between groups. A P
value less than 0.05 was considered to be statistically significant.
|
RESULTS
|
|---|
Effects of aMT on LPS-induced nitrite concentration and lipid
peroxidation in liver and lungs
Baseline levels of nitrite in the lung and liver of
vehicle-treated rats were 1.02 ± 0.03 and 0.68 ± 0.12
nmol/mg protein, respectively (Fig. 1
). Similar values were found in aMT6-treated animals (1.26±0.11 and
0.90±0.01 nmol/mg protein, lung and liver, respectively). Endotoxemia
was associated with a fourfold rise of nitrite levels in lungs and
liver (4.18±0.54 and 2.75±0.35 nmol/mg protein, respectively,
P<0.001). The increase in lung and liver nitrites caused by
endotoxemia was significantly reduced in a dose-dependent manner in
rats treated with aMT. One dose of aMT before or after LPS
administration was enough to significantly reduce nitrite levels in
both lungs and liver (P<0.05). When six doses of aMT
were used, the increase in nitrite levels in both lungs and liver was
abolished (1.12±0.03 and 0.92±0.06 nmol/mg protein, respectively,
P<0.001).
View larger version (38K):
[in this window]
[in a new window]
|
Figure 1. Dose-dependent effect of aMT on nitrite production in lung (top) and
liver (bottom) of LPS-treated rats compared to saline- or aMT-injected
rats. Melatonin (10 mg/kg b.w., each dose) was given in one dose 30 min
before (aMTb); one dose 60 min after (aMTa); two doses, one 30 min
before and another 60 min after (aMT2); or six doses, one 30 min before
plus the others 60, 120, 180, 240, and 300 min after LPS (aMT6).
Control rats injected with aMT alone (without LPS) were treated with
one or six doses of aMT without differences in the nitrite levels; only
the group treated with six doses is depicted (aMT6). Although one dose
of aMT before LPS was enough to significantly inhibit nitrite levels, a
most pronounced inhibition was found after two doses of aMT. Six doses
of aMT reduced nitrite levels to control values. *P
< 0.001 vs. control and aMT6; #P < 0.001 vs.
LPS; +P < 0.001 vs. aMTa, aMTb.
|
|
The LPS-induced organ nitrite depends on the iNOS activation, since
administration of L-NMMA blocked the nitrite production in lung and
liver due to LPS (P<0.001) (Fig. 2
). At the dose used, LPS administration only induces a slight,
insignificant increase in LPO in both the liver and lung. Melatonin
treatment (six doses) was able to significantly decrease the lung LPO
levels found in the control and LPS-treated groups
(P<0.05), showing no effect in liver (Fig. 3
).
View larger version (22K):
[in this window]
[in a new window]
|
Figure 2. Effect of L-NMMA administration on nitrite production in lung and liver
of LPS-treated rats compared to saline-injected animals. L-NMMA (3
mg/kg b.w. each dose, infused through jugular vein at a flow rate of 30
µl/min) was administered in one dose 30 min before LPS and three
injections (beginning 60 min after LPS, the last dose coinciding 2 h before death). Four doses of L-NMMA counteracted the effect of LPS on
nitrite levels. *P < 0.001 vs. saline- and LPS +
L-NMMA-treated rats.
|
|
View larger version (24K):
[in this window]
[in a new window]
|
Figure 3. Effects of aMT on LPO levels in lungs (top) and liver (bottom) of
LPS-treated rats. Legends are the same as in Fig. 1
. Although LPS did
not change LPO levels per se, six doses of melatonin
were able to significantly decrease LPO levels in lungs, but not in
liver.
|
|
|
Effects of aMT on the increase in LPS-induced iNOS activity in the
lung
|
|---|
Studies of the isoform of NOS measured in our experiments show an
increase in calcium-independent iNOS activity after LPS treatment,
whereas no calcium-dependent cNOS was found (Fig. 4
). A small calcium-independent iNOS activity was detectable in lung of
saline-treated animals. The significant increase in LPS-induced iNOS
activity (111.63±7.86 pmol citrulline/mg protein min,
P>0.001) was significantly reduced in a dose-dependent
manner by aMT treatment (Fig. 5
). One dose of aMT 60 min after LPS injection significantly reduced the
iNOS activity in lung (69.12±7.41 pmol citrulline/mg protein min,
P<0.05). Six doses of aMT were associated with a 17-fold
reduction in iNOS activity (6.62±1.54 pmol citrulline/mg protein min,
P<0.001), although a residual activity significantly
different from control iNOS activity remained.
View larger version (33K):
[in this window]
[in a new window]
|
Figure 4. LPS effect on NOS activity in rat lungs. The presence of calcium did
not change the activity of NOS found, suggesting that most of the
activity corresponded to iNOS.
|
|
The technique for iNOS measurement specifically detects iNOS activity.
In fact, addition of L-NMMA (300 µM) to the mixture reaction of
tissues from LPS-treated rats blocked the transformation of L-arginine
to L-citrulline due to iNOS activity inhibition (101.23±6.98 vs.
4.26±1.23 pmol citrulline/mg protein min, LPS, and LPS + L-NMMA,
respectively; P<0.001).
|
Effects of aMT on the LPS-induced expression of iNOS mRNA in lung
and liver
|
|---|
To gain insight into the molecular mechanisms involved in the
inhibitory effect of aMT on iNOS activity, we performed Northern blot
analysis to analyze whether aMT affects the steady-state levels of iNOS
mRNA. No detectable levels of iNOS mRNA were noted from unstimulated
LPS or melatonin alone (data not shown) by RT-PCR. Blots were probed
with a radiolabeled iNOS cDNA generated by RT-PCR (see Materials and
Methods). Northern blot showed a single band in RNA isolated from lungs
and liver treated with LPS. An inhibitory effect of six doses of aMT
could be seen after just 6 h of treatment (65.2% and 58.2%
in lung and liver, respectively) (Fig. 6
), indicating transcriptional or posttranscriptional mechanisms of
modulation by aMT.
View larger version (50K):
[in this window]
[in a new window]
|
Figure 6. In vivo inhibitory effects of aMT on iNOS mRNA
steady-state levels in both lung and liver. LPS-treated rats were i.p.
injected with six doses of aMT (lane 2, lung; lane 4, liver) or vehicle
(lane 1, lung; lane 3, liver). The top panel shows Northern blot
analysis of total RNA (20 µg/lane) probed with a radiolabeled rat
iNOS cDNA. Expression of rat 18S rRNA in the same membrane is shown at
bottom; densitometric analysis of the iNOS Northern blot corrected for
18S rRNA is depicted in the middle panel. Representative data from one
of two independent blots are shown.
|
|
|
Effects of aMT on the LPS-induced iNOS protein expression in lung
and liver
|
|---|
Western blot studies confirmed the presence of iNOS protein and
agreed with measurements of nitric oxide. Immunoblot using an anti-iNOS
antibody revealed a single component corresponding to the 130 kDa
monomer of iNOS (Fig. 7
). The results show that the increase of iNOS activity was accompanied
with a significant increase of iNOS protein expression in rat lung and
liver of LPS-treated animals, with a marked reduction after aMT
administration.
View larger version (63K):
[in this window]
[in a new window]
|
Figure 7. Effect of melatonin on iNOS protein expression in the rat liver (upper
gel) and lung (bottom gel) treated with LPS. Lane 1: melatonin; lane 2:
LPS; lane 3: LPS + melatonin; lane 4: vehicle.
|
|
|
Effect of aMT on LPS-induced liver dysfunction
|
|---|
As expected from the LPS dose used, levels of GOT
(P<0.005), GPT (P<0.05), GT
(P<0.005), ALP (P<0.005), and total
(P<0.05) and direct (P<0.005) bilirubin
increase with LPS treatment. Table 1
shows that a unique dose of aMT before or after LPS was enough to
significantly decrease the serum levels of GOT and GPT, respectively
(P<0.05). Normal serum values of these hepatic enzymes were
reached with two aMT doses (P<0.005). GT and ALP were
more resistant to aMT treatment, and two doses of the indoleamine were
necessary to significantly counteract the effect of LPS
(P<0.005). Regarding total and direct bilirubin one dose of
aMT after or before, respectively, counteracts the LPS effect
(P<0.05). In all cases except GT, the rise in serum
levels of the hepatic markers caused by LPS was abolished by treatment
with two doses of aMT. Additional aMT doses do not further decrease the
levels of these enzymes.
View this table:
[in this window]
[in a new window]
|
Table 1. Effects of melatonin on LPS-induced increases in the serum activities
of aspartate aminotransferase (GOT), alanine aminotransferase (CGT),
-glutamyl-transferase (GT), alkaline phosphatase (ALP), and both
total (Tbil) and direct (Dbil) bilirubina
|
|
|
Effect of aMT on LPS-induced renal dysfunction
|
|---|
The dose of LPS used here also impaired renal function.
Table 2
shows the significant increase in serum levels of creatinine
(P<0.05), urea (P<0.005), and uric acid
(P<0.05) after i.v. injection of 10 mg/kg body wt of LPS.
Although two doses of aMT significantly counteract the effect of LPS on
urea levels (P<0.005), six doses of the indoleamine were
necessary to normalize serum levels of both creatinine and urea. One
dose of aMT before LPS was enough to counteract LPS-dependent increases
of uric acid levels (P<0.05), the effect being more
valuable with two doses of aMT.
|
Effect of melatonin on LPS-induced metabolism impairment
|
|---|
Because of the organ dysfunction caused by endotoxemia, an
alteration in metabolic routes is expected. Table 3
shows the changes in some parameters measured as index of lipid
(cholesterol and triglycerides), carbohydrate (glucose), and protein
(total protein and albumin) metabolism. Uric acid, which may be used as
an index of nucleic acid metabolism, was included with markers of renal
dysfunction. Cholesterol (P<0.05) and triglycerides
(P<0.005) significantly increase after LPS treatment. One
dose of aMT significantly normalizes cholesterol levels
(P<0.05), whereas two doses of the indoleamine were
necessary to normalize triglyceride values. LPS also induced changes in
carbohydrate metabolism, decreasing the glucose levels
(P<0.005). In this case, six doses of aMT were able to
abolish the LPS effect (P<0.05). Regarding protein
metabolism, no significant changes were found in total protein after
LPS treatment. Only a slight decrease in albumin was found after LPS,
an effect counteracted by six doses of aMT (P<0.05).
View this table:
[in this window]
[in a new window]
|
Table 3. Effects of melatonin on LPS-induced changes in the serum levels of
cholesterol, triglycerides, glucose, total protein, and
albumina
|
|
|
DISCUSSION
|
|---|
This study clearly demonstrates for the first time that aMT is
able to inhibit the expression of the iNOS mRNA levels induced by LPS
in lungs and liver of rats in vivo in a dose-related manner.
As expected, we also observed a dose-dependent inhibition of iNOS
activity and nitrite production by aMT in the same experimental
paradigm. These data further support and extend to in vivo
conditions the recently reported inhibition of the LPS-induced iNOS
expression in murine macrophages in culture by aMT (37)
.
Gram-negative bacterial endotoxin (LPS) induces a variety of biological
responses and diseases. It is believed that at least two mechanisms are
involved in these responses: the production of anaphylatoxin and the
release of biochemical mediators such as histamine, serotonin, kinins,
platelet-activating factors by the reticuloendothelial system, and
cytokines such as tumor necrosis factor-, interleukin 1ß, and
interferon- (1
, 26
, 38)
. In addition, LPS directly
inhibits both glucose (39)
and lipid metabolism
(40)
and causes hepatotoxicity, renal failure, and lipid
peroxidation via the induction of free radicals (10
, 24
, 25
, 41
, 42)
. Our data agree with these organ failure and metabolic
alterations caused by LPS. Our results also demonstrated that aMT
administration counteracted the LPS-induced multiple organ dysfunction
syndrome in rats, protecting the animals against endotoxemia and death.
Is the inhibitory effect of aMT on the expression of iNOS mRNA levels
the same mechanism by which the indoleamine counteracted multiple organ
dysfunction caused by LPS? Previous reports showed that aMT inhibits
the activity of cNOS (21
22
23)
. It was suggested that with
nonselective inhibitors of all isoforms of NOS such as L-NMMA, the
concomitant inhibition of eNOS activity causes excessive
vasoconstriction and thus increases the incidence of organ ischemia and
mortality (43)
. Consequently, the beneficial effects of
NOS inhibitors may be due to inhibition of iNOS activity, whereas the
adverse effects reported may be due to the inhibition of eNOS and/or
neuronal NOS activities (4
, 44)
. However, in a recent
report, the use of a iNOS-selective inhibitor (aminoethyl-isothiourea)
and a nonselective NOS inhibitor (L-NMMA) yielded similar beneficial
results in LPS-induced endotoxemia in rats (13)
, without
adverse effects. In our experiments, we cannot know the degree (if any)
of inhibition of constitutive eNOS isoform by aMT. Nevertheless, our
results demonstrate that melatonin not only prevents LPS toxicity in
terms of iNOS activity and iNOS mRNA levels, but also promotes
recovery from LPS effects in rats.
Expression of iNOS activity impairs hepatocyte cell function, leading
to a reduction in protein, prostaglandins, and interleukin 6 synthesis
(45
, 46)
, glycogen and lipid metabolism alterations
(39
, 40)
, and inhibition of mitochondrial respiratory
chain complex I and II (47)
. These metabolic alterations
may contribute to the injury caused by NO after the induction of iNOS.
NO may combine with O2·- to form the more potent,
reactive oxygen metabolite peroxynitrite, which decomposes to form the
·OH. Both peroxynitrites and ·OH are responsible for cellular lipid
peroxidation, protein oxidation, and mitochondrial impairment function.
Melatonin is a very efficient scavenger of peroxynitrites
(48)
and hydroxyl radicals (15
16
17
, 49)
,
counteracting lipid peroxidation produced by toxins, including LPS
(24
, 25)
. Although at the dose used here LPS produced a
significant increase in lipid peroxidation in lungs, aMT significantly
decreased it, suggesting that some of the beneficial effects of
melatonin depend on its antioxidant properties. aMT significantly
increased the activity of the mitochondrial respiratory chain complex I
and IV in liver of normal rats (50)
.
Thus, the ability of aMT to inhibit the expression of iNOS mRNA
levels, and thus iNOS activity and NO production, may be the main
effect of the indoleamine to protect rats against endotoxemia. However,
both the antioxidant and stimulatory mitochondrial respiratory chain
roles of aMT seems to participate in the recovery of multiple organ
failure in LPS-treated animals. How aMT inhibits the expression of iNOS
mRNA? Melatonin exhibits remarkable functional versatility. Besides the
antioxidant, nonmediated receptor effects of the indoleamine, some it
effects are related to the cell nucleus. A nuclear receptor for
melatonin has been characterized, and it was shown that nuclear binding
sites may be a family of orphan receptors (51
, 52)
.
Several genomic actions of melatonin have been reported (53
, 54)
. Thus, melatonin may inhibit iNOS mRNA expression acting at
nuclear level. Our results show that the changes in iNOS mRNA
steady-state levels measured by Northern blot were lower than enzymatic
activity, suggesting a regulatory role of aMT in the transcriptional
rate. However, from our results, a role of aMT in the stability and/or
translation efficiency cannot be discarded. A recent study showed that
aMT inhibits NO production mainly by inhibiting the expression of iNOS
(37)
. The authors show that aMT inhibits iNOS promoter
activation and that the inhibition of iNOS expression was associated
with inhibition of activation of the transcription factor nuclear
factor kappa B (NF-
B) (37)
. NF-B has been found to
be regulated by the intracellular redox state (55)
.
Critical steps in the signal transduction cascade are sensitive to
oxidants and antioxidants (56)
, and the endogenous
glutathione system may therefore be considered to effectively regulate
redox-sensitive gene expression. Since both glutathione and glutathione
peroxidase are influenced by aMT (53
, 57)
, the changes in
cellular redox status by aMT may underlie the inhibition of iNOS mRNA
expression due to the pineal hormone. The possibility that aMT acts as
a regulator of redox-sensitive gene expression opens new perspectives
in the study of its mechanism of action.
A last consideration is the dose of aMT used to counteract LPS damage
in our study. Endogenous aMT levels reach 1 nM during nocturnal peak,
and this concentration is enough to reduce cNOS activity in a 20%
(21
22
23)
. In rats, a dose of 200 µg/kg of aMT may be
regarded as within the physiological range (58)
. Thus, the
doses of aMT used here (from 10 to 60 mg/kg) will increase plasma
melatonin levels up to 50–300 nM. These values are significantly lower
than those reported elsewhere (1 µM–1 mM) showing aMT inhibition of
iNOS expression in murine macrophages in culture (35)
.
These results suggest that aMT is more efficient in counteracting
LPS-induced iNOS expression in in vivo than in in
vitro conditions. Melatonin plasma half-life is approximately
40 min, and this value is significantly reduced in the presence of free
radicals that quickly oxidize the indoleamine. Because including high
doses of aMT seems to lack negative side effects (59)
, the
results of this study may support the clinical use of melatonin in
endotoxemia.
|
ACKNOWLEDGMENTS
|
|---|
This study was supported by research grants from the Spanish
Government Agencies (CICYT, PB94–0817 to D.A-C.; FIS, 98/0335 to
J.M.G.) and by the Consejería de Educación (CTS-0101 to
D.A.C; CTS-0160 to J.M.G) from the Andalusian Government. G.E. and D.P.
are recipients of postdoctoral fellowships from the FIS (Spanish
Ministry of Health).
|
FOOTNOTES
|
|---|
2 Abbreviations: ALP, alkaline phosphatase; aMT,
melatonin (N-acetyl-5-methoxytryptamine); b.w., body weight; cNOS,
constitutive nitric oxide synthase; DEPC, diethyl pyrocarbonate; dNTP,
deoxyribonucleotide; DTT, DL-dithiotreitol; EGTA, ethylene glycol
bis-(ß-aminoethyl ether)-tetraacetic acid; eNOS, endothelial NOS;
GOT, aspartate aminotransferase; GPT, alanine aminotransferase; GT,
-glutamyltransferase; H2O2, hydrogen
peroxide; 4HAD, 4-hydroxyalkenals; iNOS, inducible isoform of NOS;
H4-biopterin, 5,6,7,8- tetrahydro-L-biopterin dihydrochloride; HEPES,
N-(2-hydroxyethyl)piperazine-N'-(2- hydroxypropanesulfonic acid); i.p.,
intraperitoneal; i.v., intravenous; L-NMMA, NG-methyl-L-
arginine; LPS, lipopolysaccharide(s); MDA, malondialdehyde; NF-B,
nuclear factor kappa B; NO, nitric oxide; O2·-
superoxide anion; ·OH, hydroxyl radical; ONOO-,
peroxynitrite anion; PMSF, phenylmethylsulfonylfluoride; RT-PCR,
reverse transcriptase-polymerase chain reaction; SDS, sodium dodecyl
sulfate; TLCK, Na-p-tosyl-L-lysine chloromethyl ketone; tris-HCl,
tris(hydroxymethyl)aminomethane. 
Received for publication August 31, 1998.
Revision received March 19, 1999.
|
REFERENCES
|
|---|
-
Barron, R. L. (1993) Pathophysiology of septic shock and implications for therapy. Clin. Pharm. 12,829-845[Medline]
-
Moncada, S., Palmer, R. M. J., Higgs, E. A. (1991) Nitric oxide: physiology, pathophysiology, and pharmacology. Pharmacol. Rev. 43,109-142[Medline]
-
Moncada, S., Higgs, A. (1993) The L-arginine-nitric oxide pathway. N. Engl. J. Med. 329,2002-2012[Free Full Text]
-
Thiemermann, C. (1994) The role of the L-arginine: nitric oxide pathway in circulatory shock. Adv. Pharmacol. 28,45-79
-
Nathan, C., Xie, Q. W. (1994) Nitric oxide synthases: roles, trolls and controls. Cell 78,915-918[Medline]
-
Szabó, C. (1995) Alterations in nitric oxide production in various forms of circulatory shock. New Horiz 3,2-32[Medline]
-
Iuvone, T., D'Acquisto, F., Carnuccio, R., Di Rosa, M. (1997) Nitric oxide inhibits LPS-induced tumor necrosis factor synthesis in vitro and in vivo. Life Sci 59,L207-PL211
-
Lipton, S. A., Choi, Y. B., Pan, Z. H., Lei, S. Z., Chen, H. S., Sucher, N. J., Loscalzo, J., Singel, D. J., Stamler, J. S. (1993) A redox-based mechanism for the neuroprotective and neurodestructive effects of nitric oxide and related nitroso-compounds. Nature (London) 364,626-632[Medline]
-
Beckman, J. S., Beckman, T. W., Chen, J., Marshall, P. A., Freeman, B. A. (1990) Apparent hydroxyl radical production by peroxynitrite: implications for endothelial injury from nitric oxide and superoxide. Proc. Natl. Acad. Sci. USA 87,1620-1624[Abstract/Free Full Text]
-
Sugino, K., Dohi, K., Yamada, K., Kawasaki, T. (1989) Changes in the levels of endogenous antioxidants in the liver of mice with experimental endotoxemia and the protective effects of the antioxidants. Surgery 105,200-206[Medline]
-
Deitsch, E. A. (1992) Multiple organ failure: pathophysiology and potential future therapy. Ann. Surg. 216,117-134[Medline]
-
Wright, C. E., Rees, D. D., Moncada, S. (1992) Protective and pathological roles of nitric oxide in endotoxic shock. Cardiovasc. Res. 26,48-57[Abstract/Free Full Text]
-
Thiemermann, C., Ruetten, H., Wu, C. C., Vane, J. R. (1995) The multiple organ dysfunction syndrome caused by endotoxin in the rat: attenuation of liver dysfunction by inhibitors of nitric oxide synthase. Br. J. Pharmacol. 116,2845-2851[Medline]
-
Pieri, C., Marra, M., Moroni, F., Recchioni, R., Marcheselli, F. (1994) Melatonin: a peroxyl radical scavenger more effective than vitamin E. Life Sci 55,271-276
-
Reiter, R. J., Melchiorri, D., Sewerynek, E., Poeggeler, B., Barlow-Walden, L., Chuang, G. G., Ortiz, G., Acuña-Castroviejo, D. (1995) A review of the evidence supporting melatonin as antioxidant. J. Pineal Res. 185,1-11
-
Acuña-Castroviejo, D., Escames, G., Macías, M., Muñóz Hoyos, A., Molina Carballo, A., Arauzo, M., Montes, R., Vives, F. (1995) Cell protective role of melatonin in the brain. J. Pineal Res. 19,57-63[Medline]
-
Reiter, R. J., Guerrero, J. M., Escames, G., Pappolla, M. A., Acuña-Castroviejo, D. (1997) Prophylactic actions of melatonin in oxidative neurotoxicity. Ann. N.Y. Acad. Sci. 825,70-78[Medline]
-
Menendez-Pelaez, A., Reiter, R. J. (1993) Distribution of melatonin in mammalian tissues: The relative importance of cytosolic versus nuclear localization. J. Pineal Res. 15,9-165
-
Melchiorri, D., Reiter, R. J., Attia, A., Hara, M., Burgos, A., Nístico, G. (1995) Potent protective effect of melatonin on in vivo paraquat-induced oxidative damage in rats. Life Sci 56,83-89[Medline]
-
Vijayalaxmi,, Reiter, R. J., Meltz, M. L. (1995) Melatonin protects human blood lymphocytes from radiation-induced chromosome damage. Mutat. Res. 346,23-31[Medline]
-
Bettahi, I., Pozo, D., Osuna, C., Reiter, R. J., Acuña-Castroviejo, D., Guerrero, J. M. (1996) Melatonin reduces nitric oxide synthase activity in rat hypothalamus. J. Pineal Res. 20,205-210[Medline]
-
Pozo, D., Reiter, R. J., Calvo, J. R., Guerrero, J. M. (1997) Inhibition of cerebellar nitric oxide synthase and cyclic GMP production by melatonin via complex formation with calmodulin. J. Cell. Biochem. 65,430-442[Medline]
-
León, J., Vives, F., Crespo, E., Camacho, E., Espinosa, A., Gallo, M. A., Escames, G., Acuña-Castroviejo, D. (1998) Modification of nitric oxide synthase activity and neuronal response in rat striatum by melatonin and kynurenine derivatives. J. Neuroendocrinol. 10,297-302[Medline]
-
Sewerynek, E., Melchiorri, D., Chen, L., Reiter, R. J. (1995) Melatonin reduces both basal and bacterial lipid peroxidation in vitro. Free Rad. Biol. Med. 19,903-909[Medline]
-
Sewerynek, E., Melchiorri, D., Reiter, R. J., Ortiz, G., Lewinski, A. (1995) Lipopolysaccharide-induced hepatotoxicity is inhibited by the antioxidant melatonin. Eur. J. Pharmacol. 293,327-334[Medline]
-
Maestroni, G. J. M. (1996) Melatonin as a therapeutic agent in experimental endotoxic shock. J. Pineal Res. 20,84-89[Medline]
-
Danner, R. L., Elin, R. J., Hossein, J. M., Wesley, R. A., Reilly, J. M., Parillo, J. E. (1991) Endotoxemia in human septic shock. Chest 99,169[Abstract/Free Full Text]
-
Lowry, O. H., Rosenbrough, N. J., Farr, A. L., Randall, R. J. (1951) Protein measurement with the Folin phenol reagent. J. Biol. Chem. 193,265-275[Free Full Text]
-
Esterbauer, H., Cheeseman, K. H. (1990) Determination of aldehydic lipid peroxidation products: maionaldehyde and 4-hydroxynonenal. Methods Enzymol 186,407-42l[Medline]
-
Green, L. C., Ruiz de Luzuriaga, K., Wagner, D. A. (1981) Nitrate biosynthesis in man. Proc. Natl. Acad. Sci. USA 78,7764-7768[Abstract/Free Full Text]
-
Bredt, D. S., Snyder, S. H. (1989) Nitric oxide mediates glutamate-linked enhancement of cGMP levels in the cerebellum. Proc. Natl. Acad. Sci. USA 86,9030-9033[Abstract/Free Full Text]
-
Bradford, M. (1976) A rapid and sensitive method for quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72,248-252[Medline]
-
Laemmli, U. K. (1970) Cleavage of structural proteins during the assembly of bacteriophage T4. Nature (London) 263,789-798
-
Chomczynski, P., Sacchi, N (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162,156-159[Medline]
-
Nunokawa, Y., Ishida, N., Tanaka, S. (1993) Cloning of inducible nitric oxide synthase in rat vascular smooth muscle cells. Biochem. Biophys. Res. Commun. 191,89-94[Medline]
-
Mohaupt, M. G., Elzie, J. L., Ahn, K. Y., Clapp, W. L., Wilcox, C. S., Kone, B. C. (1994) Differential expression and induction of mRNAs encoding two inducible nitric oxide synthases in rat kidney. Kidney Int 46,653-655[Medline]
-
Gilad, E., Wong, H. R., Zingarelli, B., Virag, L., O'Connor, M., Salzman, A. L., Csabó, C. (1998) Melatonin inhibits expression of the inducible isoform of nitric oxide synthase in murine macrophages: role of inhibition of NF 54 6B activation. FASEB J 12,685-693[Abstract/Free Full Text]
-
Tracey, K. J. (1992) The acute and chronic pathophysiologic effects of TNF: mediation of septic shock and wasting (cachexia). Beutler, B. eds. Tumor Necrosis Factors: The Molecules and their Emerging Role in Medicine ,255-273 Raven New York.
-
McCallum, R. E., Berry, L. J. (1973) Effects of endotoxin on gluconeogenesis, glycogen synthesis and liver glycogen synthase in mice. Infect. Immunol. 7,642-654[Abstract/Free Full Text]
-
Sakaguchi, O., Sakaguchi, S. (1979) Alterations of lipid metabolism in mice injected with endotoxin. Microbiol. Immunol. 23,71-85[Medline]
-
Sakaguchi, S., Kanda, N., Hsu, C. C., Sakaguchi, O. (1981) Lipid peroxide formation and membrane damage in endotoxin poisoned mice. Microbiol. Immunol. 25,229-244[Medline]
-
Parks, D. A., Bulkey, G. B., Granger, D. N. (1983) Role of oxygen free radicals in shock, ischemia, and organ preservation. Surgery 94,428-432[Medline]
-
Harbrecht, R. G., Stadler, J., Demetris, A. J., Simmons, R. L., Billiar, T. R. (1994) Nitric oxide and prostaglandins interact to prevent hepatic damage during murine endotoxemia. Am. J. Physiol. 266,G1004-G1010[Abstract/Free Full Text]
-
Tracey, W. R., Tse, J., Carter, G. (1995) Lipopolysaccharide-induced changes in plasma nitrite and nitrate concentrations in rats and mice: pharmacological evaluation of nitric oxide synthase inhibitors. J. Pharmacol. Exp. Ther. 272,1011-1015[Abstract/Free Full Text]
-
Billiard, T. R., Curran, R. D., Stuehr, D. J., West, M. A., Bentz, B. G., Simmons, R. L. (1989) An L-arginine-dependent mechanism mediated Kupffer cell inhibition of hepatocyte protein synthesis in vitro. J. Exp. Med. 169,1467-1472[Abstract/Free Full Text]
-
Stadler, J., Harbrecht, B. G., Di Silvo, M., Curran, R. D., Jordan, M. L., Simons, R. L., Billiar, T. R. (1993) Endogenous nitric oxide inhibits the synthesis of cyclooxygenase products and interleukin 6 by rat Kupffer cells. J. Leukoc. Biol. 53,165-172[Abstract]
-
Morris, S. M., Jr, Billiard, T. R. (1993) New insights into the regulation of inducible nitric oxide synthesis. Am. J. Physiol. 266,E829-E839
-
Gilad, E., Cuzzocrea, S., Zingarelli, B., Salzman, A. L., Csabó, C. (1997) Melatonin is a scavenger of peroxynitrite. Life Sci 60,169-174
-
Reiter, R. J. (1995) Oxidative processes and antioxidative defense mechanisms in the aging brain. FASEB J 9,526-533[Abstract]
-
Martín, M., Crespo, E., Macías, M., Aguilera, P., Arauzo, M., León, J., Escames, G., Acuña-Castroviejo, D. (1997) Melatonin counteracts the ruthenium red cytotoxicity. J. Physiol. Biochem. 53,179
-
Acuña-Castroviejo, D., Reiter, R. J., Menendez-Pelaez, A., Pablos, M. I., Burgos, A. (1994) Characterization of high-affinity melatonin binding sites in purified cell nuclei of rat liver. J. Pineal Res. 16,100-112[Medline]
-
Becker-Andre, M., Wiesenberg, I., Scaeren-Wiemer, N., Andre, E., Missbach, M., Saurat, J. H., Carlberg, C. (1994) Pineal hormone melatonin binds and activates an orphan of the nuclear receptor superfamily. J. Biol. Chem. 269,28531-28534[Abstract/Free Full Text]
-
Steinhilber, D., Brungs, M., Werz, O., Wiesenberg, I., Danielsson, C., Kalen, J. P., Nayeri, S., Schader, M., Carlberg, C. (1995) The nuclear receptor for melatonin repress 5-lipoxygenase gene expression in human B lymphocytes. J. Biol. Chem. 270,7037-7040[Abstract/Free Full Text]
-
Antolin, I., Rodriguez, C., Sainz, R. M., Mayo, J. C., Uria, H., Kotler, M. N., Rodriguez-Colunga, M. J., Tolivia, D., Menendez-Pelaez, A. (1996) Neurohormone melatonin prevents cell damage: Effect on gene expression for antioxidant enzymes. FASEB J 10,882-890[Abstract]
-
Sen, C. K., Packer, L. (1996) Antioxidant and redox regulation of gene transcription. FASEB J 10,709-720[Abstract]
-
Vesley, D. L. (1997) Signal transduction: activation of the guanylate cyclase-cyclic guanosine-3'-5' monophosphate system by hormones and free radicals. Am. J. Physiol. 314,311-323
-
Pablos, M. I., Agapito, M. T., Gutierrez, R., Recio, J. M., Reiter, R. J., Barlow-Walden, L., Acuña-Castroviejo, D., Menendez-Pelaez, A. (1995) Melatonin stimulates the activity of the detoxifying enzyme glutathione peroxidase in several tissues of chicks. J. Pineal Res. 19,111-115[Medline]
-
Lesions in suprachiasmatic nuclei simulate effects of
pinealectomy on prolactin release in ovariectomized, and
sulpiride-treated female rats. Experientia 45,
739–742
-
Molina-Carballo, A., Muñoz-Hoyos, A., Reiter, R. J., Sanchez-Forte, M., Moreno-Madrid, F., Rufo-Campos, M., Molina-Font, J. A., Acuña-Castroviejo, D. (1997) Utility of high doses of melatonin as adjunctive anticonvulsant therapy in a child with severe myoclonic epilepsy: two years' experience. J. Pineal Res. 23,97-105[Medline]
This article has been cited by other articles:
|
|
|
|
 
W.-G. Deng, S.-T. Tang, H.-P. Tseng, and K. K. Wu
Melatonin suppresses macrophage cyclooxygenase-2 and inducible nitric oxide synthase expression by inhibiting p52 acetylation and binding
Blood,
July 15, 2006;
108(2):
518 - 524.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Z. Pei, S. F. Pang, and R. T. F. Cheung
Administration of Melatonin After Onset of Ischemia Reduces the Volume of Cerebral Infarction in a Rat Middle Cerebral Artery Occlusion Stroke Model
Stroke,
March 1, 2003;
34(3):
770 - 775.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. Matsuzaki, M. Kuwamura, R. Yamaji, H. Inui, and Y. Nakano
Inflammatory Responses to Lipopolysaccharide Are Suppressed in 40% Energy-Restricted Mice
J. Nutr.,
August 1, 2001;
131(8):
2139 - 2144.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
B. van der Loo, R. Labugger, J. N. Skepper, M. Bachschmid, J. Kilo, J. M. Powell, M. Palacios-Callender, J. D. Erusalimsky, T. Quaschning, T. Malinski, et al.
Enhanced Peroxynitrite Formation Is Associated with Vascular Aging
J. Exp. Med.,
December 11, 2000;
192(12):
1731 - 1744.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. León, M. Macías, G. Escames, E. Camacho, H. Khaldy, M. Martín, A. Espinosa, M. A. Gallo, and D. Acuña-Castroviejo
Structure-Related Inhibition of Calmodulin-Dependent Neuronal Nitric-Oxide Synthase Activity by Melatonin and Synthetic Kynurenines
Mol. Pharmacol.,
November 1, 2000;
58(5):
967 - 975.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
C. Zhang, L. M. Walker, J. A. Hinson, and P. R. Mayeux
Oxidant Stress in Rat Liver after Lipopolysaccharide Administration: Effect of Inducible Nitric-Oxide Synthase Inhibition
J. Pharmacol. Exp. Ther.,
June 1, 2000;
293(3):
968 - 972.
[Abstract]
[Full Text]
|
|
|
TOP
ABSTRACT
INTRODUCTION
P < 0.001 vs. aMT aMTa, aMTb, and aMT2.