FASEB J. Pierce now sold as Thermo Scientific
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by GEORGES, D.
Right arrow Articles by SCHWABE, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by GEORGES, D.
Right arrow Articles by SCHWABE, C.
(The FASEB Journal. 1999;13:1269-1275.)
© 1999 FASEB

Porcine relaxin, a 500 million-year-old hormone? The tunicate Ciona intestinalis has porcine relaxin

DANIELLE GEORGES* and CHRISTIAN SCHWABE{dagger}1

* UFR de Biologie, Universite Joseph Fourier-Grenoble 1, France; and
{dagger} Department of Biochemistry and Molecular Biology, Medical University of South Carolina, Charleston, S.C. 29425, USA.

1Correspondence: Department of Biochemistry and Molecular Biology, Medical University of South Carolina, 171 Ashley Ave., Charleston, S.C. 29425, USA.


   ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
REFERENCES
 
The fossil record of tunicates reaches back to the upper Cambrian period. Ascidians have mobile, tadpole-like juvenile forms with a notochord, which inspired the classification of tunicates as Urochordata, i.e., predecessors of vertebrates. The genome of the tunicate Ciona intestinalis contains a relaxin coding region that is organized like a mammalian gene, i.e., signal peptide, B-chain domain, connecting peptide domain, followed by the A-chain domain with a stop codon after cysteine A-22. RNA-derived cDNA encodes a relaxin that is identical to the circulating form of the porcine hormone. In contrast to the porcine gene, the ascidian gene has no intron in the C-peptide domain, and in that respect is similar to the bombyxin gene of the silkworm. During the spawning period, only enough relaxin could be extracted and isolated from gonads of C. intestinalis for a partial sequence analysis. Remarkable as it may be, these findings suggest that relaxin is identical in pigs, whales, and the tunicate C. intestinalis.—Georges, D., Schwabe, C. Porcine relaxin, a 500 million-year-old hormone? The tunicate Ciona intestinalis has porcine relaxin.


Key Words: relaxin coding region • DNA polymerase • genomic potential hypothesis


   INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
REFERENCES
 
RELAXIN, A HORMONE of parturition in placental mammals (1) , has recently been shown to also exist in the ovaries of marsupials (2) and Chondrichthyes (3) . In human males, relaxin appears to be produced in the prostate, where it may function as a sperm motility factor (4) . Serological studies suggest that relaxin may exist in protozoa (5) . Georges et al. (6 , 7) reported the first detection of relaxin-like material in urochordates in 1990. We report the identification of a relaxin sequence in the genomic DNA and mRNA of the tunicate Ciona intestinalis and a partial amino acid sequence of the tunicate relaxin. These results provide compelling evidence for the structural identity of the tunicate relaxin with the porcine hormone. The fact that relaxin is expressed in C. intestinalis only during the spawning period leads to the most interesting notion that relaxin may be associated with, if not functional in, the propagation of Urochordata.


   EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
REFERENCES
 
Ciona intestinalis was collected in the Mediterranean and the English Channel at different times of the year, and the gonads were excised. A portion of the distal part of the intestine of the same animals was removed and used as experimental control. About 450 gonads were collected, ranging in wet weight from 10 mg (immature) to 200 mg for a mature ovary during the spawning period.

Genomic DNA was extracted from one ovary (~200 mg) per experiment with a DNA extraction kit (Stratagene, San Diego, Calif.) and kept in TE (tris or tricine/EDTA) buffer at 4°C. Several extractions were made from gonads harvested during the spawning period from June to July as well as during a quiescent period (March to the end of May).

Total RNA was isolated by a single-step extraction from 8 g of ascidian ovaries (~40 ovaries) according to Chomczynski and Sacchi (8) . The purification of poly(A) + RNA was accomplished by affinity chromatography on oligo(dt) cellulose, as reported by Aviv and Leder (9) . Aliquots of mRNA were kept in 70% ethanol and frozen at -80°C. Total RNA was isolated from 20 mg of control tissue, using the `RNA now' (Stratagene kit) or RNeasy mini kit (Qiagen, Chatsworth, Calif.). Electrophoresis of RNA samples (~5.9 µg) was performed in duplicate on 0.66 M formaldehyde/agarose gel together with 1.9 µg of control RNA (Clontech, Palo Alto, Calif.). One part of the gel was stained to check the purity of the RNA, the other was hybridized.

Amplification procedures and oligonucleotide sequence
Since no sequence was known for the ascidian relaxin, primers were designed as a consensus of degenerate primers based on lower vertebrate insulin and relaxin structures. The primers were then reworked with the PC/gene program according to the sequence of pig relaxin (10) and generated by Genosys or Eurogentec programs.

Taq and TaqStart antibody, vent, Takara, or Pfu DNA polymerase were tested. The cycling parameters used with Pfu DNA polymerase on a minicycler PTC-150 (MJ Research, Watertown, Mass.) were 94°C, 45 s, 35–40 cycles at 94°C for 45 s, 50°C, 55°C, or 60°C for 45 s, 72°C for 2 min, and then 72°C for 10 min. The amplified products were analyzed on low melting gel of 1% to 1.8% LMP agarose (Life Technologies, Inc., Grand Island, N.Y.) in recycled TAE buffer; the gel was stained with ethidium bromide for 15 min, destained for 2 x 10 min each in distilled water, and observed under UV light (312 nm). Bands were excised and eluted with Agarose spin columns (Supelco, Bellefonte, Pa.); the product was reamplified with the same primers and either sequenced directly (Genome Express) or after cloning, using the Clone-amp system (Life Technologies) or PCR-Script Amp SK (+) cloning kit and Screen Test recombinant screening kit (Stratagene). The 5' RACE and 3' RACE experiments were performed according to the technique described by Chenchik et al. (11) with the Marathon cDNA amplification kit from Clontech.

For hybridizations of Northern or Southern blots, Polarplex chemiluminescent blotting kit (Millipore, Bedford, Mass.) was used after overnight transfer in 10x SSC buffer by capillary action onto Immobilon-S membranes. The membrane was then air-dried and fixed for 4 min under UV light at 254 nm. Hybridization with the porcine preprorelaxin probe was performed at 55°C or 60°C. The probe, designed according to porcine preprorelaxin, was a gift from Dr. Kwok (12) .

Radioimmunoassay of tunicate relaxin
Specific anti-relaxin antibodies were prepared in rabbits against a receptor binding site-containing synthetic decapeptide covalently linked to a linear antigen presenting unit (patent pending). The antibodies obtained reacted equally well with porcine and human relaxin but not with the relaxin-like factor, insulin, or bombyxin. Radioiodine-labeled porcine relaxin tracer was used as the competitor when testing tunicate extracts for relaxin.

Isolation and partial sequence analysis
Lyophilized gonadal tissue (~100 mg) was suspended in 0.5 M HCl for 6 h at 4°C. Thereafter, cold acetone was added up to 70% of the total volume. After 12 h, the pellet was collected by centrifugation and discarded, the supernatant adjusted to pH 7.0, and desalted on a 2 x 30 cm G25 column. The first peak, which contained the molecules that reacted with anti-porcine relaxin antibodies, was collected and lyophilized. Separation on a Sephadex G50 SF column caused the relaxin antigenicity to move to the end of the elution curve, indicating that its approximate molecular size was relaxin-like (~6 kDa). Subsequent separation on a quaternary amine column (0.5 x 10 cm, Pharmacia, Piscataway, N.J.), using a Pharmacia FPLC, yielded relaxin-like material in the breakthrough peak whereas separation on a strong cation exchanger moved the ascidian relaxin to the end of the linear gradient, starting with 50 mM sodium acetate (A) to acetate 0.5 M in NaCl (B) at a flow rate of 0.5 ml/min.

The analytical high-performance liquid chromatography (HPLC)2 (ABI 130) was chosen as the next `miniature preparatory' step. A linear gradient was programmed to run for 50 min at 100 µl/min, beginning with 0.1% TFA in 25% acetonitrile and ending with 0.1% TFA in 80% acetonitrile. Fractions were collected manually in tubes containing 20 µl of 80% acetonitrile in 0.1% TFA to minimize adsorption of relaxin to the tube wall and assayed for relaxin immune activity with anti-porcine relaxin antibodies; the relaxin-containing fractions were lyophilized. The immune-active material was redissolved in a small volume of 10% acetonitrile in 0.1% TFA; 5 µl was injected into an ABI capillary HPLC blotter system-173 and eluted with a 90 min gradient of 15% to 65% acetonitrile in 0.1% TFA. To determine the exact position of the relaxin immune activity, the column effluent was led directly into a series of radioimmunoassay tubes containing assay buffer. The column effluent capillary was moved manually so as to collect the effluent corresponding to exactly 1% of the gradient in each tube. The fractions thus collected could be related precisely to the absorption measured at 210 nm. Subsequently, the relaxin peak was collected from five such runs directly onto a glass membrane and transferred to an ABI Procise sequencer for microsequence analysis. In all, three filters were used as controls to collect the effluent immediately before and after the immune-active fraction.


   RESULTS AND DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
REFERENCES
 
Experiments involving the tunicate intestinal material have never produced a relaxin-like sequence. Reinecke et al. (7) have shown by immunofluorescent techniques that insulin and immunoglobulin F1, but not relaxin, exist in the intestines of C. intestinalis.

Nor have degenerate primers used in earlier experiments ever revealed relaxin-like sequences. In contrast, primers designed according to the porcine relaxin sequence, as shown in Fig. 1 , led to positive results. In general, the same results were obtained with genomic DNA or cDNA after cloning or by direct sequencing of the amplified product. These results were obtained in four or five experiments before they were considered secure.



View larger version (7K):
[in this window]
[in a new window]
 
Figure 1. Schematic representation of the steps of amplification with oligonucleotide primers (numbers 1 to 10) listed below, which correspond to the porcine relaxin sequence. The dashed lines represent the open reading frames. See text for conditions. Sp, signal peptide; B, B-chain; A, A-chain domain; Ur, untranslated region. Primer 1: C55–62 5'GCTACAACAATCTGCATCAAAGG 3'; Primer 2: Ur 5'CTAAACAGTGCTAATAATCAGTGGG 3'; Primer 3: C15–23 5'ACCATGCCATCCTCCATCACCAAAGA 3'; Primer 4: C104-A9 5'GACAACATTTCTCGCTCAGTGTCATACGGA 3'; Primer 5: Sp-8–2 5'CAACTTCCCAGAGAAATCCC 3'; Primer 6: C18–27 5'TGCATCTTTGGTGATGGAGG 3'; Primer 7: Sp-10–2 5'CTGAGCCAACTTCCCAGAGAAATCC 3'; Primer 8: B29-C4 5'CTCTTCCAGGCTGAGAGCAGTTCTT 3'; Primer 9: Ur 5'AAGAGATCAGGTCCAGGATGCCGC 3'; Primer 10: B25–32 5' TTCCCCAGGAGACGGAGCCACAGAT 3'. Universal Primer Gibco: 5'CUACUACUACUAGGCCACGCGTCGACTAGTAC 3'.

A unique 315 base pair (bp) fragment was obtained by cloning an amplified product with a sense primer (Fig. 1) (#1) directed toward the C-peptide region and an antisense primer (#2) located at the 3' end in the untranslated region. Again, the same results were obtained by direct sequence determination of the amplification product.

A 301 bp fragment obtained after amplification of DNA with primers #3 and #4 was subjected to sequence determination. The tunicate sequence was identical to porcine relaxin, except for position 92, which showed serine rather then leucine, as in pig relaxin. Haley et al. (10) reported the occasional exchange of Leu->Ser in position 92 in porcine relaxin.

The amplifications with primers #5 and #6 led regularly to two bands, one of 700 bp and one of 139 bp. The small band gave rise to an open reading frame for porcine relaxin, whereas the larger band did not. Primers #7 and #8 also led to a 700 bp fragment with no relaxin affinity and to the 193 bp fragment, which again coded for relaxin sequences. At this point, we discovered that in one of ten experiments, glutamic acid B13 was replaced by lysine. This observation suggests that C. intestinales may have two relaxin genes, like humans and mice.

The 5' end was more difficult to obtain. The strategy was to use the 5' RACE protocol from Life Technologies, starting with a specific antisense primer #6, followed by a universal primer, and then an internal antisense primer #8. Two bands (260 bp and 180 bp) were obtained and each reamplified with two other internal primers #9 (sense) and #10 (antisense). Only one fragment gave an open reading frame sequence (176 bp) that was related to the porcine relaxin with a difference of one amino acid, Ile-17 instead of Leu, in the signal peptide. Position 3 in the signal peptide showed a Phe->Ile exchange once in ten times. The total sequence of the tunicate relaxin coding region is shown in Fig. 2 .



View larger version (61K):
[in this window]
[in a new window]
 
Figure 2. Primary structure of tunicate preprorelaxin cDNA. The B-chain and A-chain are underlined. The boldfaced residues correspond to the exchange compared with porcine relaxin. The change of the first or second codon explains the exchange of residue: ATC = Ile (CTC = Leu), TTC = Phe (ATC = Ile), AAA = Lys (GAA = Glu), GTC = Val (CTC = Leu), TTA = Leu (TCA = Ser).

The mRNA extracted from ovaries of ascidians collected from March to June in the English Channel did not contain any sequences related to relaxin, which correlates well with the absence of mature oocytes at that time of the year. The positive results (at the 5' end) were obtained only with animals collected in July, when the ovaries had matured and the animals were ready to spawn. Immunofluorescence studies have shown that only mature oocytes with well-developed follicle cells reacted with the porcine anti-relaxin antibody (6 , 7) .

The sequences of tunicate relaxin coding regions show clearly that there is no intron. This is different from the porcine gene, but identical to the bombyxin gene, which codes for a relaxin-like molecule in the silk moth, Bombyx mori.

Northern analysis with the preprorelaxin probe (not shown) revealed several bands larger than 1 kb. This had already been observed by one of us (D.G.) during a set of experiments with a different species from Hawaii (Herdmania momus). In that case, poly(A) + RNA failed to hybridize with the porcine C-peptide probes, suggesting that H. momus relaxin is different.

Relaxin shows high variability even among closely related mammals. The startling exceptions have been the relaxins of the whales, Balaenopterae acutorostrata and Balaenopterae edeni, which differ from each other by three residues, whereas B. edeni relaxin differed at only one position from that of pigs (14) . Although this observation has been acknowledged as one of nature's quirks, the ascidian relaxin indicates that there may be a serious problem with the concept of molecular genealogy.

The high homology of sequences of pig and ascidian relaxins alerted us to the dangers of contamination. Extreme precautions were therefore taken during experiments. Parallel experiments with intestinal tissues were consistently negative. Moreover, every time two bands were obtained by amplifying cDNA, only one gave a sequence related to relaxin.

The danger of contamination is moderate in DNA work, but it is a serious problem during small-scale protein purification. Consequently, only new column material and glassware were used for the isolation and purification procedures.

The acid-acetone extract of tunicate gonads reacted with anti-porcine relaxin antibodies, and a dilution curve showed identical slopes (Fig. 3 ), suggesting similarity with porcine relaxin. In fact, throughout all of the subsequent purification procedures by ion-exchange chromatography (not shown), the similarity to porcine relaxin became more obvious. Finally, separation on a capillary HPLC system gave rise to the data in Fig. 4 , which shows that the immune activity from C. intestinalis coincides with the elution of a porcine relaxin standard.



View larger version (17K):
[in this window]
[in a new window]
 
Figure 3. Radioimmunoassay of tunicate relaxin-like material with an anti-porcine relaxin antibody. Serial dilution of 10 µl of a 1 mg/ml solution of tunicate acetone extract. The midpoint corresponds to ~1 ng equivalent of porcine relaxin.



View larger version (18K):
[in this window]
[in a new window]
 
Figure 4. Capillary HPLC separation of a prepurified tunicate extract showing tunicate protein and radioimmunoassay (RIA) activity against anti-porcine relaxin antibody and a control (pure porcine relaxin). RIA activity and porcine relaxin elute at the same point. See text for conditions.

Separation by capillary HPLC yielded a compound peak, which could be collected in three separate fractions directly onto a glass filter for sequencing. All three fractions were analyzed, but only the one that had previously been shown to contain the immune-active component revealed the sequence of the ascidian relaxin A-chain, which was identical to the corresponding chain in porcine or whale relaxin (Table 1 ). The B-chain has a glutamine residue at the NH2 terminus, which converts quantitatively to pyrrolidonecarboxylic acid and is therefore silent during sequencing. Together with the data obtained by gene analysis and cDNA sequence determination, these results leave no doubt that the relaxin of the tunicate C. intestinalis is identical to the circulating form (B29) of porcine relaxin (Fig. 5 ).


View this table:
[in this window]
[in a new window]
 
Table 1. Tunicate relaxin A-chain partial sequencea



View larger version (12K):
[in this window]
[in a new window]
 
Figure 5. Primary structure of tunicate/porcine relaxin A and B chains and a tunicate B chain observed in 10% of our experiments. The circulating form of porcine relaxin ends at B29(R) as indicated by the arrow. The structure of tunicate relaxin was determined by sequencing cDNA and genomic DNA; the first 15 residues of the A chain were determined by protein microsequencing of material extracted from tunicate ovaries. The box highlights the receptor binding site of relaxin. The arginines in position B12 and 16 are essential; residues B13, 14, and 15 can vary between species.

It should be noted that our ability to extract relaxin, however little, and obtain a partial sequence analysis means that the molecule is expressed in tunicates during the reproductive cycle. In the unlikely event that artifacts always made their appearance in the spawning season during several years of cloning and isolation in the laboratory in France, it would be taking caution too far to assume that such a contaminant could also show up in the laboratory in the U.S., this time in its translated form as a protein. Our finding is taking a big bite out of an endearing dogma, and it would have been good to see the whole sequence of the tunicate relaxin; but even with these investigators' considerable experience, it would take a great many animals to improve our data beyond this point.

The phylogenetic distance between tunicates and pigs is simply the whole evolutionary time allotted by the Darwinian model for the evolution of all of the diversity observed today. In contrast, this report not only suggests that the pig and tunicate molecule are the same, but invites speculation that the same hormone might be involved in the reproductive process in two phyla that have been separate for 500 million years. The fact that the tunicate molecule is identical to the most potent of relaxins (in the mouse bioassay) should give pause for rethinking the concept of functional adaptation. It is even more amazing that among land mammals, relaxins vary by ~55% even though their insulin and cytochromes show far less structural diversity.

One must conclude that there are identical relaxins in members of two different phyla: Vertebrata and Urochordata. Molecular genealogy based on relaxins would place pigs much closer to the tunicate and whale than to their fellow land vertebrates. Such a distribution of homologous proteins does not support a linear succession model (neo-Darwinian), but favors a clonal model of evolution such as the genomic potential hypothesis (15) , which separates to a significant extent the development of species from that of protein structures.

The genomic potential hypothesis is a polyphyletic clonal model that presumes proteins are derived from normal distributions of abiotically polymerized nucleic acids, and that during the process of cell formation, messages for proteins are incorporated into nascent cells according to proximity to the large pools of abiotically produced redundant nucleic acids. Neighboring cells can end up with a relaxin from the same distribution of sequences, whereas insulin genes may be from different regions. Species, of course, will have the same proteins; beyond that, similarity has no meaning as regards phylogeny.

The absence of an intron has been considered a strong indicator of polymerase chain reaction artifacts. One must consider that the absence of an intron in the cDNA may also mean that there is no intron in the gene, as in the case of the relaxin-like insect hormone, bombyxin II (16) .

The identity of whale relaxin with porcine relaxin (14) has been regarded as a quirk of nature (17) and an isolated case, but now C. intestinalis reopens the problem with even greater urgency. The implications of our findings have caused us to proceed with extraordinary care: to the best of our knowledge, porcine relaxin is indeed tunicate relaxin.


   ACKNOWLEDGMENTS
 
We are grateful to the staff of the Roscoff Marine Station (France) for collecting animals and to Barbara Rembiesa for radioimmunoassays. D.G. acknowledges Drs. M. Villaz and I. Marty (CENG) for help with the PC gene program and database search.


   FOOTNOTES
 
2 Abbreviations: bp, base pair; HPLC, high-performance liquid chromatography.

Received for publication November 3, 1998. Revision received December 12, 1998.
   REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
REFERENCES
 

  1. Hisaw, F. L. (1926) Experimental relaxation of the pubic ligament of the guinea pig. Proc. Soc. Exp. Biol. Med. 23,661-663
  2. Parry, L. J., Rust, W., Ivell, R. (1997) Marsupial relaxin—complementary deoxyribonucleic acid sequence and gene expression in the female and male tammar wallaby, Macropus eugenii. Biol. Reprod. 57,119-127[Abstract]
  3. Gowan, L. K., Reinig, J. W., Schwabe, C., Bedarkar, S., Blundell, T. L. (1981) On the primary and tertiary structure of relaxin from the sand tiger shark (Odontaspis taurus). FEBS Lett 129,80-82[Medline]
  4. Neuwinger, J., Jockenhovel, F., Nieschlay, E. (1990) The influence of relaxin on motility of human sperm in vitro. Andrologia 22,335-339[Medline]
  5. Schwabe, C., LeRoith, D., Thompson, R. P., Shiloach, J., Roth, J. (1983) Relaxin extracted from protozoa (Tetrahymena pyriformis). J. Biol. Chem. 258,2778-2781[Free Full Text]
  6. Georges, D., Viguier-Martinez, M. C., Poirier, J. C. (1990) Relaxin-like peptide in ascidians II. Gen. Comp. Endocrinol. 79,429-438[Medline]
  7. Reinecke, M., Eppler, E., David, I., Georges, D. (1999) Immunohistochemical evidence for the presence, distinct localization and partial coexistence of insulin, insulin-like growth factor I and relaxin in the protochordate Ciona intestinalis. Cell Tissue Res 295,331-338[Medline]
  8. Chomczynski, P., Sacchi, N. (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162,156-162[Medline]
  9. Aviv, H., Leder, P. (1972) Purification of biologically active globin messenger RNA by chromatography on oligothymidylic acid-cellulose. Proc. Natl. Acad. Sci. USA 69,1408-1412[Abstract/Free Full Text]
  10. Haley, J., Crawford, R., Hudson, P., Scanlon, D., Tregear, G., Shine, J., Niall, H. (1987) Porcine relaxin: gene structure and expression. J. Biol. Chem. 262,11940-11946[Abstract/Free Full Text]
  11. Chenchik, A., Moqadam, F., Sieber, P. (1995) Marathon cDNA amplification: a new method for cloning full-length cDNAs. CLONTECHniques IX,9-12
  12. Reddy, G. K., Gunwar, S., Green, C. B., Fei, D. T., Chen, A. B., Kwok, S. C. (1992) Purification and characterization of recombinant porcine prorelaxin expressed in Escherichia coli. Arch. Biochem. Biophys. 294,579-585[Medline]
  13. Georges, D., Tashima, L., Yamamoto, S., Bryant-Greenwood, G. B. (1990) Relaxin-like peptide in ascidians I. Gen. Comp. Endocrinol. 79,423-428[Medline]
  14. Schwabe, C., Büllesbach, E. E., Heyn, H., Yoshioka, M. (1989) Cetacean relaxin: isolation and sequence of relaxins from Balaenoptera acutorostrata and Balaenoptera edeni. J. Biol. Chem. 264,940-943[Abstract/Free Full Text]
  15. Schwabe, C. (1990) Evolution and chaos: the genomic potential hypothesis and phase-state mathematics. Comp. Math. Appl. 20,287-301
  16. Kimura-Kawakami, M., Iwami, M., Kawakami, A., Nagasawa, H., Suzuki, A., Ishizaki, H. (1992) Structure and expression of bombyxin related peptide genes of the moth Samia cynthia ricini. Gen. Comp. Endocrinol. 86,257-268[Medline]
  17. Schwabe, C. (1986) On the validity of molecular evolution. Trends Biochem. Sci. 11,280-283



This article has been cited by other articles:


Home page
FASEB J.Home page
M. Hafner and G. Korthof
Does a "500 million-year-old hormone" disprove Darwin?
FASEB J, July 1, 2006; 20(9): 1290 - 1292.
[Full Text] [PDF]


Home page
Mol Biol EvolHome page
T. Klonisch, C. Froehlich, F. Tetens, B. Fischer, and S. Hombach-Klonisch
Molecular Remodeling of Members of the Relaxin Family During Primate Evolution
Mol. Biol. Evol., March 1, 2001; 18(3): 393 - 403.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by GEORGES, D.
Right arrow Articles by SCHWABE, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by GEORGES, D.
Right arrow Articles by SCHWABE, C.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS