FASEB J. Avanti Polar Lipids
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by SONG, D.-K.
Right arrow Articles by KIM, Y.-H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by SONG, D.-K.
Right arrow Articles by KIM, Y.-H.
(The FASEB Journal. 1999;13:1259-1267.)
© 1999 FASEB

Central injection of nicotine increases hepatic and splenic interleukin 6 (IL-6) mRNA expression and plasma IL-6 levels in mice: involvement of the peripheral sympathetic nervous system

DONG-KEUN SONG1, YEONG-BIN IM, JUN-SUB JUNG, HONG-WON SUH, SUNG-OH HUH, JOON-HO SONG and YUNG-HI KIM

Department of Pharmacology, College of Medicine, Institute of Natural Medicine, Hallym University, Chunchon, 200–702, South Korea

1Correspondence: Department of Pharmacology, College of Medicine, Institute of Natural Medicine, Hallym University, Chunchon, Kangwon-Do, 200–702, South Korea. E-mail: dksong{at}sun.hallym.ac.kr


   ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Accumulating evidence suggests that plasma levels of interleukin 6 (IL-6), a major cytokine stimulating the synthesis of acute-phase proteins, are intimately regulated by the central nervous system. Nicotine, one of the major drugs abused by humans, has been shown to affect immunological functions. In the present study, effects of intracerebroventricular (i.c.v.) injection of nicotine on plasma IL-6 levels were investigated in mice. Nicotine administered i.c.v. dose-dependently increased plasma IL-6 levels; the lowest effective dose was 0.3 ng/mouse and the maximal effect was attained with the dose of 105 ng/mouse. The nicotine (105 ng/mouse, i.c.v.)-induced plasma IL-6 levels peaked at 3 h and approached basal levels 6 h after injection. Mecamylamine, a nicotinic receptor antagonist, blocked nicotine-induced plasma IL-6 levels. Depletion of peripheral norepinephrine with 6-hydroxydopamine [100 mg/kg, intraperitoneal (i.p.)] inhibited the nicotine-induced plasma IL-6 levels by 57%, whereas central norepinephrine depletion with 6-hydroxydopamine (50 µg/mouse, i.c.v.) had no effect. Pretreatment with prazosin ({alpha}1-adrenergic antagonist; 1 mg/kg, i.p.), yohimbine ({alpha}2-adrenergic antagonist; 1 mg/kg, i.p.), and ICI-118,551 (ß2-adrenergic antagonist; 2 mg/kg, i.p.), but not with betaxolol (ß1-adrenergic antagonist; 2 mg/kg, i.p.), inhibited nicotine-induced plasma IL-6 levels. Among the peripheral organs, including the pituitary, adrenals, heart, lung, liver, spleen, and lymph nodes, nicotine (105 ng/mouse, i.c.v.) increased IL-6 mRNA expression only in the liver and spleen, which was inhibited by peripheral norepinephrine depletion. These results suggest that stimulation of central nicotinic receptors induces plasma IL-6 levels and IL-6 mRNA expression in the liver and spleen via the peripheral sympathetic nervous system, {alpha}1-, {alpha}2-, and ß2-adrenoreceptors being involved.—Song, D.-K., Im, Y.-B., Jung, J.-S., Suh, H.-W., Huh, S.-O., Song, J.-H., Kim, Y.-H. Central injection of nicotine increases hepatic and splenic interleukin 6 (IL-6) mRNA expression and plasma IL-6 levels in mice: involvement of the peripheral sympathetic nervous system.


Key Words: norepinephrine • sympathetic nervous system • liver • spleen


   INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
ACCUMULATING EVIDENCE SUGGESTS that inflammation has a role in the pathogenesis of atherosclerosis: increased plasma levels of C-reactive protein, one of the acute-phase proteins that are indicators of systemic inflammation, were associated with the increased risk of future myocardial infarction in patients with angina pectoris (1 , 2) . Furthermore, baseline levels of C-reactive protein were reported to predict the risk of future myocardial infarction and stroke as well as peripheral vascular disease in apparently healthy men (3 , 4) . Thus, it is important to characterize precisely the factors that increase synthesis of acute-phase proteins in vivo.

Production of acute-phase proteins in the liver is stimulated chiefly by several proinflammatory cytokines, including interleukin 1 (IL-1)2 , IL-6, and tumor necrosis factor {alpha} (TNF-{alpha}), of which IL-6 is the most important (5 , 6) . Accumulating evidence demonstrates that plasma concentration of IL-6 is intimately regulated by the central nervous system (CNS): diverse models of stress induce an increase in plasma IL-6 levels (7 8 9 10 11) , and central administration of various agents including IL-1ß (12 , 13) , lipopolysaccharide (14) , MK-801, a noncompetitive N-methyl-D-aspartate receptor antagonist (15) , and {gamma}–aminobutyric acid receptor antagonists (16) increases plasma levels of IL-6.

Nicotine is one of the major drugs abused by humans (17) . In addition to the reinforcing effect, stimulation of central nicotinic receptors induces alteration of plasma levels of various neuroendocrinological parameters, such as adrenocorticotropic hormone (ACTH), prolactin, norepinephrine, and epinephrine (18 19 20 21 22) . However, the potential modulatory effect of central nicotinic receptor stimulation on plasma cytokine levels has not been investigated. In addition, nicotine has recently been shown to induce alterations in immunological parameters by a central mechanism (23) . In the present study, we hypothesized that stimulation of central nicotinic receptors may modulate plasma levels of cytokines. We focused on IL-6 and examined the effects of intracerebroventricular injection of nicotine on plasma IL-6 levels in mice.


   MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Animals and drugs
Male ICR mice weighing 25–30 g, supplied from Myung-Jin, Inc. (Seoul, Korea), were used in all the experiments. The animals were housed five per cage in a room maintained at 22 ± 1°C with an alternating 12 h light-dark cycle. Food and water were available ad libitum. All animal procedures were carried out as approved by the Animal Care and Use Committee at Hallym University College of Medicine. Mecamylamine HCl, phentolamine mesylate, propranolol HCl, prazosin HCl, and ICI-118,551 HCl were purchased from Research Biomedicals International (Natick, Mass.), nicotine hydrogen tartrate and yohimbine HCl were from Sigma Chemical Co. (St. Louis, Mo.), and betaxolol HCl was from Tocris Cookson Ltd. (Bristol, U.K.). Prazosin HCl and yohimbine HCl were dissolved in saline containing 10% and 20% dimethyl sulfoxide, respectively. Other drugs were dissolved in sterile saline.

Intracerebroventricular (i.c.v.) injection
The i.c.v. administration was performed following the procedure established by Laursen and Belknap (24) , which was modified from the method of Haley and McCormick (25) . Briefly, the animal was injected at 2 mm lateral to the bregma with a 50 µl Hamilton syringe fitted with a 26-gauge needle, which was adjusted to be inserted 2.4 mm deep. The i.c.v. injection volume was 5 µl and injection sites were verified by injecting the same volume of 1% methylene blue into the site and then observing the distribution of the injected dye in the ventricular space. The dye injected i.c.v. was found to be distributed in the ventricular spaces and ventral surface of the brain and in the upper cervical portion of the spinal cord.

Experimental protocol
Nicotine hydrogen tartrate or mecamylamine HCl was injected i.c.v. Doses of nicotine and mecamylamine represent the free base. Blood for the plasma IL-6 assay was collected from the retro-orbital venous plexus at various times after the administration of nicotine. For reverse-transcription-polymerase chain reaction (RT-PCR) of IL-6 mRNA, various peripheral organs (pituitary, adrenals, heart, lung, liver, spleen, and iliac lymph nodes) were collected 45 min after nicotine administration. To deplete central and peripheral norepinephrine, respectively, 6-hydroxydopamine HBr (6-OHDA, Sigma) dissolved in sterile 1% ascorbic acid was injected at the dose of 50 µg/mouse i.c.v. (26) and 100 mg/kg intraperitoneal (i.p.) (10) , respectively, 3 days before the nicotine injection. As shown in Table 1 , an i.p. injection of 6-OHDA (100 mg/kg) induced a selective decrease of norepinephrine content in the spleen to 13% of control values 3 days after the injection. On the other hand, an i.c.v. injection of 6-OHDA (50 µg/mouse) caused a selective decrease of norepinephrine content in the hypothalamus to 14% of control values 3 days after the injection (Table 1) . To study the effect of adrenergic receptor antagonists, the antagonist was injected i.p. 15 min prior to the i.c.v. injection of nicotine.


View this table:
[in this window]
[in a new window]
 
Table 1. Effects of pretreatment with intracerebroventricular (i.c.v.) and intraperitoneal (i.p.) 6-hydroxydopamine (6-OHDA) on catecholamine levels in the hypothalamus and spleena

Plasma cytokine assay
The plasma levels of IL-6, IL-1ß, and TNF-{alpha} were determined 60 min after an i.c.v. injection of nicotine with an enzyme-linked immunoassay kit (Genzyme, Cambridge, Mass.). Assays were performed exactly as described by the manufacturers.

RT-PCR
Total cellular RNAs were extracted from mouse tissues using a rapid guanidine thiocyanate-water saturated phenol/chloroform extraction and subsequent precipitation with acidic sodium acetate (27) . The number of animals used for each experiment was seven for pituitary, five for adrenals, and three for the rest of the tissues. Total cellular RNAs in the aqueous phase were precipitated with cold isopropyl alcohol. Isolated RNA samples were subjected to spectrophotometric analysis at 260 and 280 nm, and samples were stored at -70°C until used. Incubating it at 70°C for 5 min denatured the RNA and then chilled quickly to 4°C. cDNA synthesis was conducted on 1–3 µg total RNA. The reaction mixture for the synthesis of cDNA by RT reaction included the following: 15 mM MgCl2; 5x reaction buffer containing 375 mM KCl and 250 mM Tris-HCl (pH 8.3); 100 mM each dATP, dCTP, dGTP, and dTTP (Pharmacia, Piscataway, N.J.); ribonuclease inhibitor (RNasin, 40 U/µl, Promega, Madison, Wis.); and Moloney murine leukemia virus reverse transcriptase (200 U/µl, GibcoBRL, Grand Island, N.Y.). One to 3 µg of sample RNA was added to 20 µM oligo(dT)16 primer, RT master mix, which contained 10 mM each dNTP, and 1 U of RNasin. The RT reaction mixture was incubated in a Techine-PHCZ thermal cycler at 25°C for 10 min, 37°C for 60 min, 99°C for 5 min, and 4°C for 5 min, and stored at -20°C. The PCR mixture contained 15 mM MgCl2; 10x reaction buffer containing 500 mM KCl, 100 mM Tris-HCl (pH 8.3), and 0.01% (w/v) gelatin as well as Taq DNA polymerase (5 U/µl, Perkin-Elmer, Norwalk, Conn.). The primers for IL-6 and ß-actin were synthesized at Bohan Biomedical Inc. (Seoul, S. Korea). The sequences of these primers were as described previously (28) ; ß-actin, 5'TGGAATCCTGTGGCATCCATGAAAC3', 5'TAAAACGCAGCTCAGTAACAGTCCG3' (348 bp); IL-6, 5'TGGAGTCACAGAAGGAGTGGCTAAG3', 5'TCTGACCACAGTGAGGAATGTCCAC3' (155 bp). For each reaction, 30 µl of master mix containing 10x reaction buffer, 0.5 U of Taq DNA polymerase, and 20 µM each primer was added to a tube containing 3 µl of the cDNA synthesized in the RT reaction. The tubes were incubated in a thermal cycler at 95°C for 2 min (once), 94°C for 45 s, 67°C for 2 min, 72°C for 3 min (28–30 cycles), and 72°C for 10 min, then held at 4°C. PCR products were visualized by ethidium bromide staining after agarose (1.2%) gel electrophoresis. The IL-6/ß-actin ratio was quantified using a BIO-1D image analyzer.

Statistical analysis
Statistical analysis was carried out by one- (Table 1 and Fig. 1 B) or two-way (see Figs. 1 A, 2, 4, 5, 6B, and 7) analysis of variance. Bonferroni test was used for post hoc comparisons. Student's t test was used for Fig. 3 and Fig. 6A . P values less than 0.05 were considered to indicate statistical significance.



View larger version (22K):
[in this window]
[in a new window]
 
Figure 1. A) Time course of i.c.v. nicotine-induced plasma IL-6 levels. Either saline or nicotine (105 ng/mouse) was administered i.c.v. and blood was collected at various time after the injection. B) Dose-response of the central nicotine-induced plasma IL-6 levels. Either saline or various doses of nicotine (0.3–350 ng/mouse) was administered i.c.v., and blood was collected 3 h after the injection. The data are means ± SE of 8–10 animals. *P <0.05, **P <0.01, ***P <0.001, significantly different from the saline-treated controls.



View larger version (14K):
[in this window]
[in a new window]
 
Figure 3. Effects of nicotine on plasma IL-1ß and TNF-{alpha} levels in mice. Plasma levels of cytokines were measured 70 min after an i.c.v. injection of either saline or nicotine (105 ng/mouse). The data are means ± SE of 10 animals. *P <0.05, significantly different from the respective saline-treated controls.



View larger version (27K):
[in this window]
[in a new window]
 
Figure 6. A) Injection (i.c.v.) of nicotine increased IL-6 mRNA expression in the liver and spleen. The effect of nicotine (105 ng/mouse) on the IL-6 mRNA expression was evaluated at 45 min after the injection. **P<0.01, significantly different from the respective saline-treated controls. B) Time course of an i.c.v. nicotine-induced IL-6 mRNA expression in the liver and spleen. Either saline or nicotine (105 ng/mouse) was administered i.c.v., and the liver and spleen were collected at various times after the injection. *P <0.05, **P <0.01, significantly different from time 0. The data shown are from 3 repeated experiments. The number of animals used for each experiment was 7 for the pituitary, 5 for the adrenals, and 3 for the rest of the tissues.


   RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Effect of i.c.v. nicotine on plasma IL-6 levels
An i.c.v. administration of nicotine (105 ng/mouse) induced an increase in plasma IL-6 levels, which peaked at 3 h and approached basal levels 6 h after injection (Fig. 1A ). Figure 1B shows the dose-response relationship of central nicotine-induced plasma IL-6 levels; the lowest effective dose was 0.3 ng/mouse and the maximal effect was attained with the dose of 105 ng/mouse. On the other hand, an i.p. administration of nicotine (105 and 350 ng/mouse) did not affect the plasma IL-6 levels (6.2 ± 0.9, 5.2 ± 0.9, and 7 ± 1.1 pg/ml for saline, 105 ng nicotine, and 350 ng nicotine, respectively). The central nicotine (105 ng/mouse, i.c.v.)-induced increase in the plasma IL-6 levels was completely blocked by coadministration of mecamylamine, a nicotinic receptor antagonist (2.5 µg/mouse, i.c.v.) (Fig. 2 ). IL-6 together with IL-1ß and TNF-{alpha} comprises major proinflammatory cytokines. Thus, it was of interest to study the effects of nicotine on the plasma levels of IL-1ß and TNF-{alpha}. As shown in Fig. 3 , nicotine (105 ng/mouse, i.c.v.) also significantly increased plasma IL-1ß but not TNF-{alpha} levels.



View larger version (15K):
[in this window]
[in a new window]
 
Figure 2. Blockade of the nicotine-induced increase in the plasma IL-6 levels by coadministration of mecamylamine. Either saline or nicotine (105 ng/mouse) was coinjected i.c.v. with saline or mecamylamine (2.5 µg/mouse, i.c.v.) and blood was collected 70 min after the injection. The data are means ± SE of 10–12 animals. **P <0.01, significantly different from the respective saline-treated controls. +P <0.05.

Central administration of nicotine increases plasma levels of norepinephrine and epinephrine (21 , 22) and induces norepinephrine release in the CNS (29 , 30) . Thus, we tested whether central or peripheral norepinephrine is involved in the central nicotine-induced peripheral IL-6 responses. 6-OHDA is unable to pass the blood-brain barrier, and thus is a useful tool to selectively deplete central and peripheral norepinephrine by i.c.v. (26) and i.p. (10) administration, respectively. We examined the involvement of sympathetic postganglionic neurons in the nicotine-induced increases in plasma IL-6 levels. In mice pretreated with i.p. 6-OHDA (100 mg/kg) 3 days before the nicotine injection, the nicotine-induced plasma IL-6 levels were decreased by 57% (Fig. 4 A), suggesting the involvement of sympathetic postganglionic neurons in this response. Depletion of central norepinephrine by pretreatment with i.c.v. 6-OHDA (50 µg/mouse) 3 days before the injection of nicotine did not affect the rise of plasma IL-6 induced by i.c.v. nicotine (Fig. 4B ).



View larger version (17K):
[in this window]
[in a new window]
 
Figure 4. A) Effects of pretreatment with an i.p. 6-OHDA on the i.c.v. nicotine-induced increase in the plasma IL-6 levels. Mice were injected i.p. with either vehicle or 6-OHDA (100 mg/kg). Three days later, the effect of nicotine (105 ng/mouse, i.c.v.) on the plasma IL-6 levels was evaluated. B) Effects of pretreatment with an i.c.v. 6-OHDA on the nicotine-induced increase in the plasma IL-6 levels. Mice were injected i.c.v. with either vehicle or 6-OHDA (50 µg/mouse). Three days later, the effect of nicotine (105 ng/mouse, i.c.v.) on the plasma IL-6 levels was evaluated. Blood was collected 70 min after the nicotine injection. The data are means ± SE of 11–16 animals. **P <0.01, significantly different from the respective saline-treated controls. ++P <0.01.

To determine the adrenoreceptor subtypes involved in the nicotine-induced plasma IL-6 levels, either phentolamine, an {alpha}-adrenoreceptor antagonist, or propranolol, a ß-adrenoreceptor antagonist, was injected i.p. 15 min prior to the nicotine injection. As shown in Fig. 5 A, pretreatment with either phentolamine mesylate (2 mg/kg) or propranolol HCl (10 mg/kg) significantly inhibited the nicotine (105 ng/mouse, i.c.v.)-induced plasma IL-6 levels. Phentolamine or propranolol per se did not affect plasma IL-6 levels. To determine the involvement of the subtypes of {alpha}- and ß-adrenoreceptors in the nicotine-induced plasma IL-6 levels, either prazosin HCl (an {alpha}1-adrenoreceptor antagonist; 0.5 mg/kg), yohimbine HCl (an {alpha}2-adrenoreceptor antagonist; 1 mg/kg), betaxolol HCl (a ß1-adrenoreceptor antagonist; 2 mg/kg, i.p.), or ICI-118,551 HCl (a ß2-adrenoreceptor antagonist; 2 mg/kg, i.p.) was injected i.p. 15 min prior to the nicotine injection. As shown in Fig. 5B, C , pretreatment with prazosin, yohimbine, or ICI-118,551, but not betaxolol, significantly inhibited the nicotine (105 ng/mouse, i.c.v.)-induced plasma IL-6 levels. Prazosin, yohimbine, and ICI-118,551 per se did not affect plasma IL-6 levels; on the other hand, betaxolol per se slightly but significantly increased plasma IL-6 levels.



View larger version (17K):
[in this window]
[in a new window]
 
Figure 5. Effects of adrenoreceptor antagonists injected i.p. on the i.c.v. nicotine-induced plasma IL-6 levels in mice. Either saline (A), phentolamine mesylate (2 mg/kg), or propranolol HCl (10 mg/kg), (B) prazosin HCl (0.5 mg/kg) or yohimbine HCl (1 mg/kg), (C) betaxolol HCl (2 mg/kg) or ICI-118,551 HCl (2 mg/kg) were given as pretreatment i.p. 15 min before the nicotine (105 ng/mouse) injection. Blood was collected 70 min after the nicotine injection. The data are means ± SE of 8–14 animals. *P <0.05, **P <0.01, significantly different from the respective saline-treated controls. +P <0.05.

Effect of i.c.v. nicotine on IL-6 mRNA expression
To identify the source of plasma IL-6 induced by nicotine, we examined IL-6 mRNA expression, as revealed by RT-PCR, in a variety of peripheral organs including the pituitary, adrenals, heart, lung, liver, spleen, and lymph nodes. An i.c.v. injection of nicotine (105 ng/mouse) induced an increase in IL-6 mRNA expression in the liver and spleen, but not in the pituitary, adrenals, heart, lung, or lymph nodes (Fig. 6 A). The spleen and lymph nodes displayed higher basal IL-6 mRNA expression than other organs examined. Hepatic IL-6 mRNA expression began to increase 30 min after nicotine (105 ng/mouse) injection, peaked at 45 min, and increased for up to 2 h after injection (Fig. 6B ). Splenic IL-6 mRNA expression was markedly increased at 45 min after injection and rapidly returned to control levels 1 h after injection (Fig. 6B ). Next, we investigated the effects of peripheral norepinephrine depletion on the central nicotine-induced IL-6 mRNA levels in the liver and spleen. Pretreatment of animals with an i.p. 6-OHDA (100 mg/kg) significantly inhibited the nicotine-induced increase in IL-6 mRNA expression in the liver and spleen, the inhibitory effect being more marked in the spleen (Fig. 7 ). Pretreatment of animals with i.p. 6-OHDA (100 mg/kg) alone tended to decrease the basal IL-6 mRNA expression in the liver and spleen (Fig. 7) .



View larger version (33K):
[in this window]
[in a new window]
 
Figure 7. Pretreatment with i.p. 6-OHDA inhibited the nicotine-induced increase in the IL-6 mRNA expression in the liver and spleen. Mice were injected i.p. with either vehicle or 6-OHDA (100 mg/kg i.p.). Three days later, the effect of nicotine on the IL-6 mRNA expression was evaluated at 45 min after the injection. The gel data shown are from the representative experiments. The bar data are means ± SE of 3 repeated experiments. The number of animals used for each experiment was 3. *P <0.05,**P <0.01, significantly different from the respective saline-treated controls. +P <0.05.


   DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
We found that i.c.v. administration of a low dose of nicotine (the threshold dose was 0.3 ng/mouse) increases plasma IL-6 levels. To our knowledge, this is the first report of nicotine modulation of plasma cytokine levels. The nicotine-induced increase in plasma cytokine levels extended to plasma IL-1ß. However, plasma levels of TNF-{alpha}, another potent proinflammatory cytokine, were not increased by central nicotine administration.

The marked inhibition of central nicotine-induced plasma IL-6 levels by chemical sympathectomy suggests that the peripheral sympathetic nervous system is crucially involved in the phenomenon. Central administration of nicotine has been shown to stimulate sympathetic outflow, as demonstrated by increased plasma norepinephrine levels (21 , 22) . The result that centrally administered nicotine, but not the maximally effective doses (105 or 350 ng/mouse) of peripherally administered nicotine, induces an increase in plasma IL-6 levels strongly suggests that the site of nicotinic receptor modulation of peripheral IL-6 response resides in the CNS. However, the central noradrenergic system may not be involved in the central nicotine-induced plasma IL-6 increase, because an i.c.v. pretreatment with 6-OHDA did not affect the i.c.v. nicotine-induced increase in the plasma IL-6 levels. This is in contrast with the case of the increased plasma levels of ACTH and prolactin induced by stimulation of the central nicotinic receptors, where an i.c.v. pretreatment with 6-OHDA effectively inhibited these nicotine-induced responses (19 , 31) .

We found that the induction of IL-6 mRNA expression by an i.c.v. nicotine injection is very selective in that among the various peripheral organs we examined, only liver and spleen displayed the increased IL-6 mRNA response. The selective increase in IL-6 mRNA expression in the spleen and liver may suggest that the nicotine-induced IL-6 may particularly influence immunological and acute-phase responses. Although the reason for the selective increase in IL-6 mRNA expression in the spleen and liver is unclear at present, the target peripheral organs demonstrating increased IL-6 mRNA expression induced by a CNS stimulation may vary according to the specific stimuli: whereas the central nicotine administration induced an increase in IL-6 mRNA expression in the liver and spleen (the present study), central administration of lipopolysaccharide induced an increase in IL-6 mRNA expression in a wider spectrum of peripheral organs, i.e., pituitary, adrenals, heart, liver, spleen, and lymph nodes (32) , and central MK-801 injection induced an increase in IL-6 mRNA expression only in lymph nodes among the various organs examined (unpublished observation). Thus, it is proposed that a specific CNS stimulus may be coupled to a specific set of peripheral organs in the CNS modulation of peripheral IL-6 mRNA expression.

Note that immobilization stress induces IL-6 expression in liver and spleen (33) , and the immobilization stress-induced plasma IL-6 levels are inhibited by a peripheral 6-OHDA pretreatment (10) . Thus, it can be speculated that both immobilization stress and central nicotine administration may share some of the neural pathways regulating the peripheral IL-6 expression.

The sympathetic nervous system has an important role in the modulation of immune responses (34 , 35) . Specifically, catecholamines have been shown to be intimately involved in the regulation of plasma IL-6 levels. Systemic injection of epinephrine was shown to induce plasma IL-6 levels via ß-adrenergic receptors (36 , 37) . And stress-induced plasma IL-6 levels were inhibited by pretreatment with propranolol, a ß-adrenergic receptor antagonist (38) . Lipopolysaccharide-induced plasma IL-6 levels were inhibited by pretreatment with {alpha}-adrenergic receptor antagonists (39) . Furthermore, norepinephrine has been shown to increase IL-6 levels in rat spleen lymphocyte culture supernatant and to enhance the effect of IL-1ß on the IL-6 release by spleen lymphocytes (40) . For the central nicotine-induced plasma IL-6 response, the results of the present study suggest that {alpha}1-, {alpha}2-, and ß2-adrenoreceptors may be involved. The finding suggesting the involvement of ß2-adrenoreceptors implicates epinephrine in the nicotine-induced plasma IL-6 response, because norepinephrine is a very weak agonist for ß2-adrenoreceptors compared with epinephrine, and plasma levels of epinephrine as well as norepinephrine have been shown to increase after central administration of nicotine (21 , 22) .

IL-6 is produced by a variety of cells, including monocyte/macrophages, endothelial cells, fibroblasts, lymphocytes, and mast cells (41) . In addition, hepatic nonparenchymal cells (42) and hepatocytes (33) have been shown to express IL-6 in acute-phase response and in immobilization stress, respectively. The types of cells with increased IL-6 mRNA expression in the liver and spleen in response to the central nicotine injection in the present study should be characterized and the precise mechanism of adrenoreceptor involvement needs to be investigated in future studies.

IL-6 is a major cytokine that is responsible for inducing the acute-phase proteins in liver (5) . The results of the present study suggest that stimulation of nicotinic receptors in the brain can induce hepatic and splenic IL-6, which may subsequently lead to the increase in the hepatic acute-phase protein synthesis and in plasma concentration of acute-phase proteins. Although the nicotine-induced increase of IL-6 mRNA expression in the liver was less marked than that in the spleen, considering the ~12- to 13-fold greater organ weight of the liver compared with the spleen in male ICR mouse used in the present study, the contribution of liver to nicotine-induced plasma IL-6 levels may not be less, and may even be more, than that of spleen. This central nicotine-induced increase in plasma IL-6 response may be related at least in part to the increase reported in plasma concentrations of IL-6 and acute-phase proteins (such as fibrinogen and C reactive protein) associated with cigarette smoking (43 44 45 46 47 48) . In addition, because IL-6 can affect various immunological parameters (49) , the nicotine-induced IL-6 responses demonstrated in the present study may also contribute to the reported changes in immune functions induced by nicotine administration (23 , 50 51 52 53) . Last, as IL-6 is very effective in stimulating ACTH secretion (54) , it can be speculated that central nicotine-induced plasma levels of IL-6 may at least partly contribute to the central nicotine-induced increase in hypothalamo-pituitary-adrenal axis (18 , 53) .

In conclusion, the results of the present study suggest that stimulation of central nicotinic receptors induces plasma IL-6 levels and IL-6 mRNA expression in the liver and spleen via the peripheral sympathetic nervous system. Pharmacological evidence for the involvement of {alpha}1-, {alpha}2-, and ß2-adrenoreceptors was presented. The modulation of plasma cytokine levels by stimulation of central nicotinic receptors may add a new aspect of the complex pharmacological effects of nicotine, one of the drugs most widely used by humans.


   ACKNOWLEDGMENTS
 
We thank G. Slysz for reviewing the English style of the manuscript. This study was supported by grants (95–0403-19–01-3, 971-0704-027–2) from The Korea Science and Engineering Foundation.


   FOOTNOTES
 
2 Abbreviations: ACTH, adrenocorticotropic hormone; CNS, central nervous system; i.c.v., intracerebroventricular; IL, interleukin; i.p., intraperitoneal; 6-OHDA, 6-hydroxydopamine; RT-PCR, reverse-transcription-polymerase chain reaction; TNF, tumor necrosis factor.

Received for publication May 26, 1998. Revision received February 15, 1999.
   REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 

  1. Liuzzo, G., Biasucci, L. M., Gallimore, J. R., Grillo, R. L., Rebuzzi, A. G., Pepys, M. B., Maseri, A. (1994) The prognostic value of C-reactive protein and serum amyloid A protein in severe unstable angina. N. Engl. J. Med. 331,417-424[Abstract/Free Full Text]
  2. Haverkate, F., Thompson, S. G., Pyke, S. D. M., Gallimore, J. R., Pepys, M. B. (1997) Production of C-reactive protein and risk of coronary events in stable and unstable angina. Lancet 349,462-466[Medline]
  3. Ridker, P. M., Cushman, M., Stampfer, M. J., Tracy, R. P., Hennekens, C. H. (1997) Inflammation, aspirin, and the risk of cardiovascular disease in apparently healthy men. N. Engl. J. Med. 336,973-979[Abstract/Free Full Text]
  4. Ridker, P. M., Cushman, M., Stampfer, M. J., Tracy, R. P., Hennekens, C. H. (1998) Plasma concentration of C-reactive protein and the risk of developing peripheral vascular disease. Circulation 97,425-428[Abstract/Free Full Text]
  5. Heinrich, P. C., Castell, J. V., Andus, T. (1990) Interleukin-6 and the acute phase response. Biochem. J. 265,621-636[Medline]
  6. Moshage, H. (1997) Cytokines and the hepatic acute phase response. J. Pathol. 181,257-266[Medline]
  7. LeMay, L. G., Vander, A. J., Kluger, M. J. (1990) The effects of psychological stress on plasma interleukin-6 activity in rats. Physiol. Behav. 47,957-961[Medline]
  8. Zhou, D., Kusnecov, A. W., Shurin, M. R., DePaoli, M., Rabin, B. S. (1993) Exposure to physical and psychological stressors elevates plasma interleukin 6: relationship to the activation of hypothalamic-pituitary-adrenal axis. Endocrinology 133,2523-2530[Abstract/Free Full Text]
  9. Komaki, G., Gottschall, P. E., Somogyvari-Vigh, A., Tatsuno, I., Yatohgo, T., Arimura, A. (1994) Rapid increase in plasma interleukin-6 after hemorrhage, and posthemorrhage reduction of the IL-6 response to LPS, in conscious rats: Interrelation with plasma corticosterone levels. Neuroimmunomodulation 1,127-134[Medline]
  10. Takaki, A., Huang, Q. H., Somogyvari-Vigh, A., Arimura, A. (1994) Immobilization stress may increase plasma interleukin-6 via central and peripheral catecholamines. Neuroimmunomodulation 1,335-342[Medline]
  11. Papanicolaou, D. A., Petrides, J. S., Tsigos, C., Bina, S., Kalogeras, K. T., Wilder, R., Gold, P. W., Deuster, P. A., Chrousos, G. P. (1996) Exercise stimulates interleukin- 6 secretion: inhibition by glucocorticoids and correlation with catecholamines. Am. J. Physiol. 271,E601-E605
  12. De Simoni, M. G., Sironi, M., De Luigi, A., Manfridi, A., Mantovani, A., Ghezzi, P. (1990) Intracerebroventricular injection of interleukin-1 induces high circulating levels of interleukin-6. J. Exp. Med. 171,1773-1778[Abstract/Free Full Text]
  13. De Simoni, M. G., De Luigi, A., Gemma, L., Sironi, M., Manfridi, A., Ghezzi, P. (1993) Modulation of systemic interleukin-6 induction by central interleukin-1. Am. J. Physiol. 265,R739-R742
  14. Gottschall, P. E., Komaki, G., Arimura, A. (1992) Increased circulating interleukin-1 and interleukin-6 after intracerebroventricular injection of lipopolysaccharide. Neuroendocrinology 56,935-938[Medline]
  15. Song, D. K., Suh, H. W., Jung, J. S., Wie, M. B., Song, J. H., Kim, Y. H. (1996) Involvement of N-methyl-D-aspartate receptor in the regulation of plasma interleukin-6 levels in mice. Eur. J. Pharmacol. 316,165-169[Medline]
  16. Song, D. K., Suh, H. W., Huh, S. O., Jung, J. S., Ihn, B. M., Choi, I. G., Kim, Y. H. (1998) Central GABAA and GABAB receptor modulation of basal and stress-induced plasma interleukin-6 levels in mice. J. Pharmacol. Exp. Ther. 287,144-149[Abstract/Free Full Text]
  17. O'Brien, C. P. (1996) Drug addiction and drug abuse. Hardman, J. G.et al eds. Goodman & Gilman's The Pharmacological Basis of Therapeutics ,557-577 McGraw-Hill New York.
  18. Matta, S. G., Beyer, H. S., McAllen, K. M., Sharp, B. M. (1987) Nicotine elevates rat plasma ACTH by a central mechanism. J. Pharmacol. Exp. Ther. 243,217-226[Abstract/Free Full Text]
  19. Matta, S. G., Sharp, B. M. (1992) The role of the fourth cerebroventricle in nicotine-stimulated prolactin release in the rat: involvement of catecholamines. J. Pharmacol. Exp. Ther. 260,1285-1291[Abstract/Free Full Text]
  20. Fu, Y., Matta, S. G., Valentine, J. D., Sharp, B. M. (1997) Adrenocorticotropin response and nicotine-induced norepinephrine secretion in the rat paraventricular nucleus are mediated through brainstem receptors. Endocrinology 138,1935-1943[Abstract/Free Full Text]
  21. Yokotani, K., Okuma, Y., Osumi, Y. (1987) Intracerebroventricularly administered nicotine inhibits vagally stimulated gastric acid output in rats by activating the central sympatho-adrenal outflow. Jpn. J. Pharmacol. 45,288-291[Medline]
  22. Van Loon, G. R., Kiritsy-Roy, J., Pierzchala, K., Dong, L., Bobbitt, F. A., Marson, L., Brown, L. (1989) Differential brain and peripheral nicotinic regulation of sympathoadrenal secretion. Prog. Brain Res. 79,217-223[Medline]
  23. Sopori, M. L., Kozak, W., Savage, S. M., Geng, Y., Soszynski, D., Kluger, M. J., Perryman, E. K., Snow, G. E. (1998) Effect of nicotine on the immune system: possible regulation of immune responses by central and peripheral mechanisms. Psychoneuroendocrinology 23,189-204[Medline]
  24. Laursen, S. E., Belknap, J. K. (1986) Intracerebroventricular injections in mice. J. Pharmacol. Methods 16,355-357[Medline]
  25. Haley, T. J., McCormick, W. G. (1957) Pharmacological effects produced by intracerebral injection of drugs in the conscious mouse. Br. J. Pharmacol. 12,12-15[Medline]
  26. Suaudeau, C., Dourmap, N., Costentin, J. (1995) Rapid and long lasting reduction of the hypothalamic effect of a D2 dopamine agonist after an intracerebroventricular injection of 6-hydroxydopamine. Neuropharmacology 34,101-105[Medline]
  27. Chomczynski, P., Sacchi, N. (1987) Single-step method of RNA isolation by acid guanidium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162,156-159[Medline]
  28. Faulkner, C. B., Simecka, J. W., Davidson, M. K., Davis, J. K., Schoeb, T. R., Lindsey, J. R., Everson, M. P. (1995) Gene expression and production of tumor necrosis alpha, interleukin 1, interleukin 6, and gamma interferon in C3H/HeN and C57BL/6N mice in acute Mycoplasma pulmonis disease. Infect. Immun. 63,4084-4090[Abstract/Free Full Text]
  29. Fu, Y., Matta, S. G., Sharp, B. M. (1998) Nicotine-induced norepinephrine release in the rat amygdala and hippocampus is mediated through brainstem nicotinic cholinergic receptors. J. Pharmacol. Exp. Ther. 284,1188-1196[Abstract/Free Full Text]
  30. Li, X., Rainnie, D. G., McCarley, R. W., Greene, R. W. (1998) Presynaptic nicotinic receptors facilitate monoaminergic transmission. J. Neurosci. 18,1904-1912[Abstract/Free Full Text]
  31. Matta, S. G., Singh, J., Sharp, B. M. (1990) Catecholamines mediate nicotine-induced adrenocorticotropin secretion via alpha adrenergic receptors. Endocrinology 127,1646-1655[Abstract/Free Full Text]
  32. Song, D. K., Im, Y. B., Jung, J. S., Suh, H. W., Huh, S. O., Park, S. W., Wie, M. B., Kim, Y. H. (1999) Differential involvement of central and peripheral norepinephrine in the central LPS-induced IL-6 responses in mice. J. Neurochem. 72,1625-1633[Medline]
  33. Kitamura, H., Konno, A., Morimatsu, M., Jung, B. D., Kimura, K., Saito, M. (1997) Immobilization stress increases hepatic IL-6 expression in mice. Biochem. Biophys. Res. Commun. 238,707-711[Medline]
  34. Madden, K. S., Sanders, V. M., Felten, D. L. (1995) Catecholamine influences and sympathetic neural modulation of immune responsiveness. Annu. Rev. Pharmacol. Toxicol. 35,417-448[Medline]
  35. Felten, S. Y., Madden, K. S., Bellinger, D. L., Kruszewska, B., Moynihan, J. A., Felten, D. L. (1998) The role of the sympathetic nervous system in the modulation of immune responses. Adv. Pharmacol. 42,583-587
  36. Van Gool, J., Van Vugt, H., Helle, M., Aarden, L. A. (1990) The relation among stress, adrenalin, interleukin 6 and acute phase proteins in the rat. Clin. Immunol. Immunopathol. 57,200-210[Medline]
  37. DeRijk, R. H., Boelen, A., Tilders, F. J. H., Berkenbosch, F. (1994) Induction of plasma interleukin-6 by circulating adrenaline in the rat. Psychoneuroendocrinology 19,155-163[Medline]
  38. Soszynski, D., Kozak, W., Conn, C. A., Rudolph, K., Kluger, M. J. (1996) Beta- adrenoceptor antagonists suppress elevation in body temperature and increase in plasma IL-6 in rats exposed to open field. Neuroendocrinology 63,459-467[Medline]
  39. Finck, B. N., Dantzer, R., Kelley, K. W., Woods, J. A., Johnson, R. W. (1997) Central lipopolysaccharide elevates plasma IL-6 concentration by an {alpha}-adrenoceptor- mediated mechanism. Am. J. Physiol. 272,R1880-R1887[Abstract/Free Full Text]
  40. Huang, Q. -H., Takaki, A., Arimura, A. (1997) Central noradrenergic system modulates plasma interleukin-6 production by peripheral interleukin-1. Am. J. Physiol. 273,R731-R738[Abstract/Free Full Text]
  41. Terebuh, P. D., Otterness, I. G., Strieter, R. M., Lincoln, P. M., Danforth, J. M., Kunkel, S. L., Chensue, S. W. (1992) Biologic and immunohistochemical of interleukin-6 expression in vivo. Constitutive and induced expression in murine polymorphonuclear and mononuclear phagocytes. Am. J. Pathol. 140,649-657[Abstract]
  42. Billiar, T. R., Curran, R. D., Williams, D. L., Kispert, P. H. (1992) Liver nonparenchymal cells are stimulated to provide interleukin 6 for induction of the hepatic acute-phase response in endotoxemia but not in remote localized inflammation. Arch. Surg. 127,31-37[Abstract/Free Full Text]
  43. Das, I. (1985) Raised C-reactive protein levels in serum from smokers. Clin. Chim. Acta 153,9-13[Medline]
  44. Tappia, P. S., Troughton, K. L., Langley-Evans, S. C., Grimble, R. F. (1995) Cigarette smoking influences cytokine production and antioxidant defenses. Clin. Sci. (Colch.) 88,485-489[Medline]
  45. Sato, S., Iso, H., Naito, Y., Kiyama, M., Kitamura, A., Iida, M., Shimamoto, T., Komachi, Y. (1996) Plasma fibrinogen and its correlates in urban Japanese men. Int. J. Epidemiol. 25,521-527[Abstract/Free Full Text]
  46. de Maat, M. P. M., Pietersma, A., Kofflard, M., Sluiter, W., Kluft, C. (1996) Association of plasma fibrinogen levels with coronary artery disease, smoking and inflammatory markers. Atherosclerosis 121,185-191[Medline]
  47. Mendall, M. A., Patel, P., Ballam, L., Strachan, D. P., Northfield, T. C. (1996) C reactive protein and its relation to cardiovascular risk factors: a population based cross sectional study. Br. Med. J. 312,1061-1065[Abstract/Free Full Text]
  48. Mendall, M. A., Patel, P., Asante, M., Ballam, L., Morris, J., Strachan, D. P., Camm, A. J., Northfield, T. C. (1997) Relation of serum cytokine concentrations to cardiovascular risk factors and coronary heart disease. Heart 78,273-277[Abstract/Free Full Text]
  49. Hirano, T. (1998) Interleukin-6. Thomson, A. W. eds. The Cytokine Handbook ,197-228 Academic Press London.
  50. Geng, Y., Savage, S. M., Johnson, L. J., Seagrave, J., Sopori, M. L. (1995) Effect of nicotine on the immune function. I. Chronic exposure to nicotine impairs antigen receptor-mediated signal transduction in lymphocytes. Toxicol. Appl. Pharmacol. 135,268-278[Medline]
  51. Geng, Y., Savage, S. M., Razanai-Boroujerdi, S., Sopori, M. L. (1996) Effects of nicotine on the immune response. II. Chronic nicotine treatment induces T cell anergy. J. Immunol. 156,2384-2390[Abstract]
  52. McAllister-Sistilli, C. G., Caggiula, A. R., Knopf, S., Rose, C. A., Miller, A. L., Donny, E. C. (1998) The effects of nicotine on the immune system. Psychoneuroendocrinology 23,175-187[Medline]
  53. Rosecrans, J. A., Karin, L. D. (1998) Effects of nicotine on the hypothalamic-pituitary-axis (HPA) and immune function. Psychoneuroendocrinology 23,95-102[Medline]
  54. Naitoh, Y., Fukata, J., Tominaga, T., Nakai, Y., Tamai, S., Mori, K., Imura, H. (1988) Interleukin-6 stimulates the secretion of adrenocorticotropic hormone in conscious, freely-moving rats. Biochem. Biophys. Res. Commun. 155,1459-1463[Medline]



This article has been cited by other articles:


Home page
J. Appl. Physiol.Home page
M. Nickerson, S. L. Kennedy, J. D. Johnson, and M. Fleshner
Sexual dimorphism of the intracellular heat shock protein 72 response
J Appl Physiol, August 1, 2006; 101(2): 566 - 575.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
H. Tsuneki, R. Salas, and J. A Dani
Mouse muscle denervation increases expression of an {alpha}7 nicotinic receptor with unusual pharmacology
J. Physiol., February 15, 2003; 547(1): 169 - 179.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
K. Arai, K. Kim, K. Kaneko, M. Iketani, A. Otagiri, N. Yamauchi, and T. Shibasaki
Nicotine infusion alters leptin and uncoupling protein 1 mRNA expression in adipose tissues of rats
Am J Physiol Endocrinol Metab, June 1, 2001; 280(6): E867 - E876.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
C. R. Sterling and A. W. Tank
Adrenal Tyrosine Hydroxylase Activity and Gene Expression Are Increased by Intraventricular Administration of Nicotine
J. Pharmacol. Exp. Ther., January 1, 2001; 296(1): 15 - 21.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by SONG, D.-K.
Right arrow Articles by KIM, Y.-H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by SONG, D.-K.
Right arrow Articles by KIM, Y.-H.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS