FASEB J. Integrated DNA Technologies
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by BOULOUMIÉ, A.
Right arrow Articles by BUSSE, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by BOULOUMIÉ, A.
Right arrow Articles by BUSSE, R.
(The FASEB Journal. 1999;13:1231-1238.)
© 1999 FASEB

Leptin induces oxidative stress in human endothelial cells

ANNE BOULOUMIÉ1, TAKESHI MARUMO, MAX LAFONTAN* and RUDI BUSSE

Institut für Kardiovaskuläre Physiologie, Klinikum der J. W. Goethe-Universität, Frankfurt/Main, Germany; and
* INSERM U317, Institut Louis Bugnard, CHU Rangueil, Toulouse, France

1Correspondence: Institut für Kardiovaskuläre Physiologie, Klinikum der J. W. Goethe-Universität, Theodor-Stern-Kai 7, 60590 Frankfurt/Main, Germany. E-mail: bouloumie{at}em.uni-frankfurt.de


   ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Human umbilical vein endothelial cells (HUVEC) express functional receptors to leptin, the product of the ob gene. As human obesity is associated with atherosclerosis and hyperleptinemia, we investigated whether leptin, in addition to its angiogenic properties, exerts atherogenic effects through the generation of oxidative stress in endothelial cells. In HUVEC leptin increased the accumulation of reactive oxygen species (ROS), as assessed by the oxidation of 2',7'- dichlorodihydrofluorescein, in a time- and concentration-dependent manner. In addition, leptin activated the NH2-terminal c-Jun kinase/stress-activated protein kinase pathway as demonstrated by enhanced JNK activity and AP-1 DNA binding. Both effects were sensitive to antioxidant treatment with N-acetylcysteine. NF-{kappa}B, another redox-sensitive transcription factor, was also activated by leptin stimulation in an oxidant-dependent manner. Finally, activation of both AP-1 and NF-{kappa}B was associated with an enhanced expression of the monocyte chemoattractant protein-1 in HUVEC. These findings demonstrate that ROS are second messengers involved in leptin-induced signaling in endothelial cells. Thus, chronic oxidative stress in endothelial cells under hyperleptinemia may activate atherogenic processes and contribute to the development of vascular pathology.—Bouloumié, A., Marumo, T., Lafontan, M., Busse, R. Leptin induces oxidative stress in human endothelial cells.


Key Words: Jun kinase • MCP-1 • AP-1 • NF-{kappa}B • atherosclerosis • obesity


   INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
OBESITY, CHARACTERIZED BY an excess of fat mass, is clearly associated with an increased risk of cardiovascular pathology. The link between increased adipogenesis and development of atherosclerosis is still not well understood. An increasing number of reports show that adipocytes secrete growth factors and cytokines, which might exert potential atherogenic effect on the vascular wall (1) . Leptin, the product of the ob gene, is a plasma protein secreted by adipocytes and is involved in the control of body weight, mainly through its hypothalamic effects (2 3 4) . Recently, new peripheral roles for leptin have been identified, i.e., regulation of hematopoietic processes (5 , 6) and proinflammatory immune responses (7) , as well as stimulation of endothelial cell growth and angiogenesis (8 , 9) . Moreover, the leptin receptor with the longest cytoplasmic domain (Ob-Rb), which is responsible for the leptin-mediated activation of the Janus kinases (JAK)2 /STAT pathway (10) , has been found to be expressed in various peripheral cells such as endothelial cells (8 , 9) and cells from the immune system (5) . The plasma concentrations of leptin are markedly increased in human obesity and positively correlated to body fat mass (11) . As human obesity is associated with hyperleptinemia and atherosclerosis, we hypothesized that leptin, in addition to its angiogenic properties, exerts proatherogenic effect on endothelial cells.

Atherosclerotic lesions are the results of an excessive proliferative and inflammatory response that involves several cellular events, including smooth muscle cell migration and proliferation, inflammatory cell infiltration, neovascularization, production of extracellular matrix, and the accumulation of lipids (12) . Evidence suggests that the generation of oxidative stress, characterized by enhanced reactive oxygen species (ROS) formation, may play a central regulatory role in such events. ROS are potent activators of cell migration and proliferation (13) and modulate the expression of several proinflammatory molecules in endothelial cells such as adhesion molecules [vascular cell adhesion molecule-1 (14) and intercellular adhesion molecule-1 (15) ] and chemotactic factors (monocyte chemoattractant molecule-1, MCP-1) (16) . ROS appear to act as signaling messengers capable of activating intracellular transduction pathways and transcriptions factors (17) , such as NF-{kappa}B and AP-1, both of which are sensitive to changes in intracellular redox state (18) .

In the present study, we demonstrate that leptin increases the accumulation of ROS in endothelial cells and thereby might play a major role in the inflammation process and genesis of atherosclerosis.


   MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Chemicals were obtained from either Sigma (Deisenhofen, Germany) or Merck (Darmstadt, Germany). Human recombinant leptin was purchased from Biomol (Hamburg, Germany). The rabbit polyclonal antibody directed against JNK1 (C-17) and the GST-Jun fusion protein were purchased from Santa Cruz Biotechnology (Santa Cruz, Calif.), the protein G-Sepharose from Sigma, and the prestained protein marker from New England Biolabs (Beverly, Mass.). [{alpha}-32P]dCTP and [{gamma}-32P]ATP were obtained from Hartmann analytic (Braunschweig, Germany).

Cell culture
Human umbilical vein endothelial cells (HUVEC), isolated as described previously (19) , were seeded in culture dishes containing M-199 medium (Life Technologies, Eggenstein-Leopoldshafen, Germany) and 10% fetal calf serum (Biochrom, Berlin, Germany) supplemented with penicillin (50 U/ml) and streptomycin (50 µg/ml). Experiments were performed on quiescent cells from passage 1 maintained in serum-deprived M-199 supplemented with 0.1% bovine serum albumin (Life Technologies) for 24 to 36 h.

Measurement of intracellular ROS generation
The determination of intracellular oxidant production was based on the oxidation of 2',7'-dichlorodihydrofluorescein (DCHF) by peroxide, resulting in the formation of the fluorescent compound 2',7'-dichlorofluorescein (DCF) using a cytofluor 2300 multiplate fluorometer (Millipore, Bedford, Mass.) as described previously (20) . HUVEC were incubated in Hanks' balanced salt solution at 37°C for 1 h with the drugs, as indicated in the Results section, and for the last 20 min with 20 µmol/l DCHF diacetate. The cells were then washed and maintained at 37°C in Hanks' balanced salt solution. Unless otherwise indicated, the fluorescence was monitored after 30 min using excitation and emission wavelengths of 485 nm and 530 nm, respectively, and subtracted from the basal fluorescence measured before addition of leptin.

JNK/SAPK assays
Cells were lysed in Triton lysis buffer (20 mmol/l Tris-HCl, pH 8.0, containing 1% Triton X-100, 137 mmol/l NaCl, 25 mmol/l ß-glycerophosphate, 1 mmol/l Na orthovanadate, 2 mmol/l Na2H2P2O7, 2 mmol/l EDTA, pH 8.0, 10% glycerol, and protease inhibitors (100 µg/ml phenylmethylsulfonyl, 1 µg/ml aprotinin, and 1 µg/ml leupeptin). The protein extracts were incubated with 2 µl of rabbit anti-JNK1 antibody for 2 h at 4°C and then with 20 µl protein G-Sepharose. After 1 h incubation at 4°C, the immunoprecipitates were washed with Triton lysis buffer and kinase buffer (25 mmol/l HEPES, pH 7.6, 20 mmol/l MgCl2, 20 mmol/l ß-glycerophosphate, 0.1 mmol/l Na orthovanadate, 2 mmol/l DTT). The kinase assays were performed at 30°C for 30 min using 2 µg GSP-cJun as a substrate, 20 µmol/l ATP, and 5 µCi of [{gamma}-32P]dATP in 30 µl of kinase buffer. The reactions were terminated with Laemmli sample buffer and the products resolved by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (12% gel). The incorporation of [32P]phosphate was visualized by autoradiography and quantified by scanning densitometry, using as software Image master 1D (Pharmacia, Freiburg, Germany).

Electrophoretic mobility shift assays
Nuclear extracts from HUVEC were isolated as described (19) . After nuclear extraction and protein determination, the nuclear proteins were used for electrophoretic mobility shift assays. Double-stranded oligonucleotides containing the sequence of the binding site for transcription factor AP-1 (5'-CGC TTG ATG AGT CAG CCG GAA-3', Promega, Wis.) and NF-{kappa}B (5'AGTTGAGGGGACTTTCCCAGCC3' (Promega) were radiolabeled with 30 µCi [{gamma}-32P]ATP by using a 5' end labeling kit (Pharmacia Biotech, Germany). Nuclear proteins (6 µg) were incubated with 3000 counts of labeled oligonucleotide in a buffer containing HEPES, 10 mmol/l, pH 7.5; NaCl, 100 mmol/l; EDTA, 1 mmol/l; dithiothreitol, 1.5 mmol/l; 5% glycerol, and 2 µg poly(dI/dC) for 30 min at room temperature. The reaction mixture was loaded onto a 6% polyacrylamide gel buffered with Tris, 89 mmol/l; boric acid, 89 mmol/l, and EDTA, 2 mmol/l. After drying, the gel was placed in contact with X-ray film at -70°C. Densitometric analysis of the autoradiographs was performed after unsaturating exposures; the values obtained were normalized and expressed as the percentage of the binding activity in unstimulated cell extracts.

Analysis of MCP1 expression by Northern blotting
Total RNAs were extracted according to the method of Chomczynski and Sacchi (21) . Northern blots were performed using 15 µg total RNA. RNA were electrophoresed on a 1.2% formaldehyde-denatured agarose gel, visualized with ethidium bromide, transferred to a nylon membrane (porablot NY amp, Macherey-Nagel, Düren, Germany), and hybridized with either [32P]-labeled MCP-1 fragment obtained from the clone pXM-hJE34 (kindly provided by Dr. B. J. Rollins) or [32P]-labeled 18S ribosomal mouse RNA fragment. Autoradiographs were then exposed for 4 to 72 h. Quantification of MCP-1 mRNA was performed by scanning densitometry, normalized for the ribosomal RNA signal to correct loading irregularities. The autoradiographs were analyzed by scanning densitometry.

Statistics
Data are expressed as mean ± SE. Statistical analyses were performed by one-way analysis of variance, followed by a Bonferroni t test. Values of P < 0.05 were considered statistically significant.


   RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Effect of leptin on intracellular reactive oxygen species
Stimulation of DCHF-loaded HUVEC with increasing concentrations of human recombinant leptin (1 to 100 ng/ml) led to a concentration- and time-dependent increase in DCF fluorescence (Fig. 1 A).



View larger version (19K):
[in this window]
[in a new window]
 
Figure 1. Effect of leptin on intracellular accumulation of oxidizing radicals. A) Quiescent HUVEC, cultured in 24 well plates, loaded for 20 min with 20 µmol/l DCHF acetate, were treated with increasing concentrations of leptin (1, 10 and 100 ng/ml). DCF fluorescence was monitored every 15 min for 45 min. Results are means ± SE of four different wells; *P < 0.05, **P < 0.01 vs. control (0). Two independent experiments gave identical results. B) Quiescent HUVEC, cultured in 24 well plates, were pretreated for 1 h with NG-nitro-L-arginine (L-NA, 300 µmol/l), genistein (Gen, 30 µmol/l), and diethyldithiocarbamic acid (DDC, 5 mmol/l). DCF fluorescence was monitored 30 min after leptin addition. Results are means ± SE of four different wells. *P < 0.05 vs. control. Three independent experiments gave identical results.

The basal DCF fluorescence was strongly reduced in cells pretreated with the superoxide dismutase inhibitor diethyldithiocarbamic acid (DDC, 5 mmol/l) or with the tyrosine kinase inhibitor genistein (µmol/l) (Fig. 1B ). Leptin (10 ng/ml), in the presence of DDC, still enhanced significantly the DCF fluorescence (twofold increase, P < 0.05) whereas genistein pretreatment prevented the leptin-induced increase in DCF fluorescence. An identical effect was observed with another tyrosine kinase inhibitor, herbimycin (5 µmol/l) (data not shown). The presence of the inhibitor of nitric oxide synthase, NG-nitro-L-arginine (300 µmol/l), did not affect the stimulatory effect of leptin (Fig. 1B ), whereas the DCF fluorescence was completely abolished in the presence of the antioxidant N-acetylcysteine (NAC, 30 mmol/l) in control and leptin-treated cells (data not shown).

Effect of leptin on Jun kinase-dependent pathway
Because ROS act as intracellular second messengers, we tested whether leptin treatment of endothelial cells is associated with activation of stress-dependent intracellular pathway, i.e., the NH2-terminal c-Jun kinase/stress-activated protein kinase (JNK/SAPK) and its downstream target, the transcription factor AP-1.

Immunocomplex kinase assays performed to assess the activity of JNK showed that protein extracts obtained from cells stimulated with leptin exhibited a time-dependent increase in JNK activity (Fig. 2 A). Leptin (10 ng/ml) enhanced the JNK-mediated phosphorylation of the GST-Jun fusion protein, with a maximal effect after 30 min of treatment. The leptin-dependent activation of JNK was abolished when cells were pretreated with the tyrosine kinase inhibitors genistein (30 µmol/l) or herbimycin (5 µmol/l) (Fig. 2B ).



View larger version (38K):
[in this window]
[in a new window]
 
Figure 2. Effect of leptin on JNK activity. A) Quiescent HUVEC were treated for the times indicated (10, 30, and 60 min) with 10 ng/ml leptin. Immunocomplex kinase assays were then performed using the GST-Jun fusion protein as substrate for JNK. A representative autoradiograph and the densitometric analysis from three independent experiments are shown. Results are means ± SE; *P < 0.05 vs. control (0). B) Quiescent HUVEC, pretreated for 1 h with genistein (Gen, 30 µmol/l) and herbimycin (Herb, 5 µmol/l), were stimulated with leptin (10 ng/ml) for 30 min. Immunocomplex kinase assays were thereafter performed using the GST-Jun fusion protein as substrate for JNK. A representative autoradiograph and the densitometric analysis from three independent experiments are shown. Results are means ± SE. *P < 0.05 vs. control.

Moreover, pretreatment of cells with the antioxidant NAC (30 mmol/l) suppressed the leptin effect on JNK activity, whereas pretreatment of cells with pyrrolidine dithiocarbamate (PDTC), originally used as antioxidant but described to have pro-oxidant properties (22) , further increased the stimulatory effect of leptin on JNK activity (Fig. 3 A, B).



View larger version (60K):
[in this window]
[in a new window]
 
Figure 3. Effect of N-acetylcysteine and pyrrolidine dithiocarbamate on the stimulatory effect of leptin on JNK activity. Quiescent HUVEC, treated for 30 min with N-acetylcysteine (NAC, 30 mmol/l) or pyrrolidine dithiocarbamate (PDTC, 100 µmol/l), were stimulated over 30 min with 10 ng/ml leptin. Thereafter, immunocomplex kinase assays were performed using the GST-Jun fusion protein as substrate for JNK. A) A representative autoradiograph is shown. B) Densitometric analysis from three independent experiments. Results are means ± SE. *P < 0.05, **P < 0.01 vs. control (Ctl).

To further characterize the JNK-dependent pathway activated by leptin, we studied the DNA binding activity of the transcription factor AP-1. Electrophoretic mobility shift assays using [32P]AP-1 consensus sequence showed that nuclear extracts from cells stimulated with leptin evoked a time-dependent appearance of two bands, reflecting an enhanced association of nuclear proteins with the AP-1 consensus sequence (Fig. 4 A). The stimulatory effect reached a peak within 30 min (4.2-fold increase, P < 0.01, n=4) and gradually decreased after 1 h. Treatment of nuclear extracts with excess of cold AP-1 consensus sequence resulted in the suppression of the leptin effect on the upper band (Fig. 4B ). Thus, the upper band represented the specific leptin-sensitive AP-1/DNA complex. Pretreatment of cells with NAC abolished the stimulatory effect of leptin in a concentration-dependent manner (Fig. 5 A, B).



View larger version (99K):
[in this window]
[in a new window]
 
Figure 4. Effect of leptin on AP-1 activity. Nuclear extracts obtained from quiescent HUVEC, treated for the indicated time (15, 30, and 60 min) with 10 ng/ml leptin were subjected to electrophoretic mobility shift assays in the presence of AP-1-specific consensus sequence oligonucleotides. A) A representative autoradiograph from two independent experiments is shown. B) Competition assay was performed in the presence of 500-fold excess of unlabeled specific oligonucleotides. A representative autoradiograph is shown.



View larger version (42K):
[in this window]
[in a new window]
 
Figure 5. Effect of antioxidants on the stimulatory effect of leptin on AP-1 activity. Nuclear extracts obtained from quiescent HUVEC, treated for 30 min with increasing concentrations of N-acetylcysteine (NAC, 2, 10, 30 mmol/l) and stimulated for the next 30 min with 10 ng/ml leptin, were subjected to electrophoretic mobility shift assays in the presence of AP-1-specific consensus sequence oligonucleotides. A) A representative autoradiograph is shown. B) Densitometric analysis from three independent experiments performed with 30 mmol/l NAC. Results are means ± SE. **P < 0.01 vs. control.

Effect of leptin on NF-{kappa}B activity
The activity of the transcription factor NF-{kappa}B is sensitive to intracellular redox changes. Thus, we investigated the DNA binding activity of NF-{kappa}B as an index of oxidative stress after stimulation of endothelial cells with leptin. Nuclear extracts prepared from cells treated with leptin produced a time-dependent shift in the mobility of the NF-{kappa}B consensus sequence (Fig. 6 A). The activation peaked after 30 min stimulation, although to a lesser extent than that of AP-1 (1.98-fold increase, P < 0.05, n=4) and remained elevated over 1 h. Addition of specific p65- or p50-antibodies to nuclear extracts obtained from leptin-treated cells resulted in supershifts of the NF-{kappa}B/DNA complex (Fig. 6B ). This finding indicated that the p50/p65 heterodimer corresponded to the leptin-sensitive NF-{kappa}B complex. Moreover, because the p65 antibody abolished the leptin-dependent formation of NF-{kappa}B complex, it is likely that leptin activated the p65 rather than p50 component of the NF-{kappa}B complex.



View larger version (86K):
[in this window]
[in a new window]
 
Figure 6. Effect of leptin on NF-{kappa}B activity. Nuclear extracts obtained from quiescent HUVEC, treated over the indicated times (5, 15, 30, and 60 min) with 10 ng/ml leptin, were subjected to electrophoretic mobility shift assays in the presence of NF-{kappa}B specific consensus sequence oligonucleotides. A) A representative autoradiograph is shown from two independent experiments. B) Supershift assays were performed on nuclear extracts from cells stimulated with leptin for 30 min in the presence of antibodies against p65 (Anti p65) or p50 (Anti p50). A representative autoradiograph is shown.

In nuclear extracts from cells pretreated with the antioxidant NAC (30 mM, 30 min) leptin did not increase NF-{kappa}B DNA binding activity (Fig. 7 ).



View larger version (47K):
[in this window]
[in a new window]
 
Figure 7. Effect of antioxidants on the leptin-induced stimulation of NF-{kappa}B activity. Nuclear extracts obtained from quiescent HUVEC, pretreated for 30 min with 30 mmol/l N-acetylcysteine (NAC) and stimulated over the next 30 min with 10 ng/ml leptin, were subjected to electrophoretic mobility shift assays. A) A representative autoradiograph is shown. B) Densitometric analysis from three independent experiments. Results are means ± SE; **P < 0.01 vs. control.

Effect of leptin on MCP-1 expression
Since the MCP-1 promoter contains binding sites for AP-1 and NF-{kappa}B, we studied the effect of leptin on MCP-1 expression. Leptin enhanced the amount of MCP-1 transcripts, identified by Northern blot analysis, in a time-dependent manner (Fig. 8 A). Within 4 h of stimulation, a 1.6-fold increase was observed (n=4, P < 0.05). Pretreatment of cells with NAC completely abolished the stimulatory effect of leptin on MCP-1 expression (Fig. 8B ).



View larger version (32K):
[in this window]
[in a new window]
 
Figure 8. Effect of leptin on MCP-1 expression. A) mRNA, isolated from quiescent HUVEC treated during the indicated times (2, 4, 8, 24 h) with 10 ng/ml leptin were subjected to Northern blot analysis. Representative autoradiographs from three independent experiments are shown; upper panel: hybridization with [32P]MCP-1; lower panel: hybridization with [32P]18S. B) mRNA isolated from quiescent HUVEC treated for 30 min by N-acetylcysteine (30 mmol/l) and stimulated for 4 h with 10 ng/ml leptin. Upper panel: Representative autoradiograph; lower panel: densitometric analysis of three different experiments. Results are means ± SE; *P < 0.05.


   DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
In the present study, we report that stimulation of cultured human endothelial cells with leptin leads to an enhanced intracellular accumulation of reactive oxygen species (ROS). This effect was associated with activation of the JNK/SAPK-dependent pathway as well as the redox-sensitive transcription factor NF-{kappa}B. The oxidant-dependent increase in MCP-1 expression observed after leptin stimulation further supports the hypothesis that ROS play a major role in the leptin-activated intracellular signaling pathway in endothelial cells.

Our results show that stimulation of cultured human endothelial cells with leptin is associated with a significantly enhanced oxidation of DCFH, indicative of increased intracellular H2O2 or HO. generation. We have previously described that HUVEC express functional leptin receptors that, when activated, trigger the stimulation of tyrosine kinase-dependent pathways (9) . Since tyrosine kinase inhibitors suppress the stimulatory effect of leptin on DCF fluorescence, it is possible that the tyrosine kinases associated with the leptin receptor are involved in the increased intracellular ROS accumulation. N-acetylcysteine, a thiol-containing antioxidant that not only scavenges free radicals, but also increases the ratio of reduced to oxidized glutathione in endothelial cells (23) , was found to prevent the effects of leptin. Under inhibition of superoxide dismutase and nitric oxide (NO) synthase, leptin still enhanced the DCF fluorescence. These results indirectly suggest that increased peroxide formation rather than superoxide anions and/or peroxynitrite, the reaction product of NO and superoxide anion, is responsible for the increased DCF fluorescence in endothelial cells stimulated with leptin. Moreover, we did not observe in HUVEC any effect of leptin on intracellular cyclic GMP level, a standard indicator of NO formation (unpublished data).

Studies of oxidant radicals have mainly focused on toxic effects, but there is now growing evidence for ROS as second messengers, involved in the transduction of extracellular stimuli and able to modulate intracellular signal pathways (24) . Key signal molecules in intracellular pathways are MAP kinases. At least three different MAP kinases classes have been identified: Erk (extracellular-regulated kinases), JNK-SAPK (NH2-terminal c-Jun Kinase/stress-activated protein kinase), and p38. Even though they are closely related protein kinases, they appear to trigger distinct biological responses. Erk signaling has been involved in the control of cell proliferation and differentiation, whereas JNK- and p38-dependent pathways have been implicated in responses to cellular stress (25) . We previously described that activation of the endothelial leptin receptors was linked to stimulation of Erk1/2 in association with enhanced cellular proliferation (9) . In the present study, we report that leptin led to a time-dependent activation of another MAP kinase family, the JNK/SAP kinases. Since JNK is activated by oxidants such as H2O2 (26 , 27) , intracellular ROS have been suggested to provide common signals to JNK pathways (28 , 29) . Our results clearly show that activation of JNK by leptin was sensitive to the antioxidant N-acetylcysteine. However, the presence of PDTC did not affect the stimulatory effect of leptin. Some reports show that PDTC, commonly considered as antioxidant, can exert pro-oxidant effects sensitive to N-acetylcysteine and glutathione (18) , due to the binding and transport of extracellular copper ions into cells (22) . Thus, the enhanced activity of JNK under PDTC stimulation, already reported (30) , is more likely related to the pro-oxidant than the antioxidant properties of PDTC.

The transcription factor AP-1 is an inducible transcription factor that can be activated and regulated at the transcriptional and/or protein level. Changes in the phosphorylation state of c-Jun lead to the stabilization as well as enhanced trans-activation and DNA binding activity. c-Jun is a substrate for the JNKs that can bind directly to and phosphorylate c-Jun more efficiently than ERKs in vitro (31) . Our results show that the AP-1 DNA binding activity, assessed by electrophoretic mobility shift assay, is increased in a time-dependent manner after leptin treatment. The stimulatory effect of leptin was prevented in the presence of N-acetylcysteine. These findings stress further the role of ROS in the leptin-induced stimulation of the JNK-dependent pathway. Similarly, the DNA binding activity of the transcription factor NF-{kappa}B was enhanced by leptin, although to a lesser extent than AP-1. Moreover, this effect was inhibited by an antioxidant. It has recently been shown that gene therapy, involving gene transfer of recombinant mitochondrial superoxide dismutase after ischemia/reperfusion injury in the liver, was associated with a reduction in AP-1 and NF-{kappa}B activation (32) . This report, together with our findings, suggest that these immediate early transcription factors represent common pathways by which cells respond to environmental stress and more specifically to oxidative stress.

MCP-1 belongs to the class of chemotactic cytokines shown to elicit the direct migration of monocytes to inflammatory sites. Cellular MCP-1 expression has been shown to be induced by mitogenic or activation signals in a variety of cell types, including monocytes, macrophages, and T-lymphocytes, as well as in a variety of cells traditionally not part of the immune system, including smooth muscle cells and endothelial cells (33) . Moreover, expression of MCP-1 has been shown in human atherosclerotic lesions (34 , 35) . Our present data demonstrate that leptin leads to an up-regulation of MCP-1 transcripts in endothelial cells. Moreover, this stimulatory effect was suppressed in the presence of antioxidants. Since both AP-1 (TRE) and NF-{kappa}B ({kappa}B) binding motifs are present in the promoter region of MCP-1 and act in a cooperative manner (36) , our finding suggests that the ROS-dependent activation of AP-1 and NF-{kappa}B is involved in the enhanced MCP-1 expression after leptin stimulation of endothelial cells. Studies performed in rodents with genetic abnormalities in the leptin system have revealed obesity-related deficits in macrophage phagocytosis and in the expression of proinflammatory cytokines, which could be suppressed by exogenous leptin (7) . Our data extend this proinflammatory effect of leptin to human endothelial cells. Endothelial cells play an important role in the initiation and maintenance of inflammatory processes and acute tissue injuries. Indeed, the adhesion of blood-borne monocytes and migration through the endothelial surface is a prerequisite for the monocyte-macrophage conversion. It is thus tempting to speculate that the intracellular accumulation of oxidant radicals stimulated by leptin and the consecutive expression of MCP-1 in endothelial cells might play a key role in the inflammatory process. In addition, chronic endothelial oxidative stress under hyperleptinemia, as in human obesity, might be involved in the excessive inflammatory responses linked to atherosclerosis.


   ACKNOWLEDGMENTS
 
The authors gratefully acknowledge the expert technical assistance of Isabel Winter and the financial support of the Deutsche Forschungsgemeinschaft (SFB 553, B5).


   FOOTNOTES
 
2 Abbreviations: DCF, 2',7'-dichlorofluorescein; DCHF, 2',7'-dichlorodihydrofluorescein; DDC, diethyldithiocarbamic acid; Erk, extracellular-regulated kinases; HUVEC, human umbilical vein endothelial cells; JAK, Janus kinases; JNK/SAPK, NH2-terminal c-Jun kinase/stress-activated protein kinase; MCP-1, monocyte chemoattractant molecule-1; NAC, N-acetylcysteine; NO, nitric oxide; PDTC, pyrrolidine dithiocarbamate; ROS, reactive oxygen species.

Received for publication November 3, 1998. Revision received February 7, 1999.
   REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 

  1. Loskutoff, D. J., Samad, F. (1998) The adipocyte and hemostatic balance in obesity: studies of PAI-1. Arterioscl. Thromb. Vasc. 18,1-6[Free Full Text]
  2. Pelleymounter, M. M., Cullen, M., Baker, M., Hecht, R., Winters, D., Boone, T., Collins, F. (1995) Effects of the obese gene product on body weight regulation in ob/ob mice. Science 269,540-543[Abstract/Free Full Text]
  3. Halaas, J., Gajiwala, K., Maffei, M., Cohen, S., Chait, B., Rabinowitz, D., Lallone, R., Burley, S., Friedman, J. (1995) Weight-reducing effects of the plasma protein encoded by the obese gene. Science 269,543-546[Abstract/Free Full Text]
  4. Campfiel, L., Smith, F., Guisez, Y., Devos, R., Burn, P. (1995) Recombinant mouse Ob protein: evidence for a peripheral signal linking adiposity and central networks. Science 269,546-549[Abstract/Free Full Text]
  5. Gainsford, T., Willson, T. A., Metcalf, D., Handman, E., McFarlane, C., Ng, A., Nicola, N. A., Alexander, W. S., Hilton, D. J. (1996) Leptin can induce proliferation, differentiation, and functional activation of hematopoietic cells. Proc. Natl. Acad. Sci. USA 93,14564-14568[Abstract/Free Full Text]
  6. Benett, B., Solar, G., Yuan, J., Mathias, J., Thomas, G., Matthews, W. (1996) A role for leptin and its cognate receptor in hematopoiesis. Curr. Biol. 6,1170-1180[Medline]
  7. Loffreda, S., Yang, S. Q., Lin, H. Z., Karp, C. L., Brengman, M. L., Wang, D. J., Klein, A. S., Bulkley, G. B., Bao, C., Noble, P. W., Lane, M. D. (1998) Leptin regulates proinflammatory immune responses. FASEB J 12,57-65[Abstract/Free Full Text]
  8. Sierra-Honigmann, M. R., Nath, A. K., Murakami, C., Garcia-Cardena, G., Papapetropoulos, A., Sessa, W. C., Madge, L. A., Schechner, J. S., Schwabb, M. B., Polverini, P. J., Flores-Riveros, J. R. (1998) Biological action of leptin as an angiogenic factor. Science 281,1683-1686[Abstract/Free Full Text]
  9. Bouloumié, A., Drexler, H. C. A., Lafontan, M., Busse, R. (1998) Leptin, the product of Ob gene, promotes angiogenesis. Circ. Res. 83,1059-1066[Abstract/Free Full Text]
  10. Tartaglia, L. (1997) The leptin receptor. J. Biol. Chem. 272,6093-6096[Free Full Text]
  11. Caro, J., Sinha, M., Kolaczynski, J., Zhang, P., Considine, R. (1996) Leptin: the tale of an obesity gene. Diabetes 45,1455-1462[Medline]
  12. Ross, R. (1993) The pathogenesis of atherosclerosis: a perspective for the 1990s. Nature (London) 362,801-809[Medline]
  13. Rao, G. N., Berk, B. C. (1992) Active oxygen species stimulate vascular smooth muscle cell growth and proto-oncogene expression. Circ. Res. 70,593-599[Abstract/Free Full Text]
  14. Marui, N., Offermann, M. K., Swerlick, R., Kunsch, C., Rosen, C. A., Ahmad, M., Alexander, R. W., Medford, R. M. (1993) Vascular cell adhesion molecule-1 (VCAM-1) gene transcription and expression are regulated through an antioxidant-sensitive mechanism in human vascular endothelial cells. J. Clin. Invest. 92,1866-1874
  15. Cominacini, L., Garbin, U., Pasini, A. F., Davoli, A., Campagnola, M., Contessi, G. B., Pastorino, A. M., Lo Cascio, V. (1997) Antioxidants inhibit the expression of intercellular cell adhesion molecule-1 and vascular cell adhesion molecule-1 induced by oxidized LDL on human umbilical vein endothelial cells. Free Rad. Biol. Med. 22,117-127[Medline]
  16. Wung, B. S., Cheng, J. J., Hsieh, H. J., Shyy, Y. J., Wang, D. L. (1997) Cyclic strain induced monocyte chemotactic protein-1 gene expression in endothelial cells involves reactive oxygen species activation of activator protein 1. Circ. Res. 81,1-7[Abstract/Free Full Text]
  17. Palmer, H. J., Paulson, K. E. (1997) Reactive oxygen species and antioxidants in signal transduction and gene expression. Nutr. Rev. 55,353-361[Medline]
  18. Pinkus, R., Weiner, L. M., Daniel, V. (1996) Role of oxidants and antioxidants in the induction of AP-1, NF-kappaB, and glutathione S-transferase gene expression. J. Biol. Chem. 271,13422-13429[Abstract/Free Full Text]
  19. Busse, R., Lamontagne, D. (1991) Endothelium-derived bradykinin is responsible for the increase in calcium produced by angiotensin-converting enzyme inhibitors in human endothelial cells. Naunyn-Schmeidebergs. Arch. Pharmacol. 344,126-129[Medline]
  20. Marumo, T., Schini-Kerth, V. B., Brandes, R. P., Busse, R. (1998) Glucocorticoids inhibit superoxide anion production and p22 Phox mRNA expression in human aortic smooth muscle cells. Hypertension 32,1083-1088[Abstract/Free Full Text]
  21. Chomczynski, P., Sacchi, N. (1987) Single step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162,156-159[Medline]
  22. Verhaegh, G. W., Richard, M. J., Hainaut, P. (1997) Regulation of p53 by metal ions and by antioxidants: dithiocarbamate down-regulates p53 DNA-binding activity by increasing the intracellular level of copper. Mol. Cell. Biol. 17,5699-5706[Abstract/Free Full Text]
  23. Faruqi, R. M., Poptic, E. J., Ruhe Farugi, T., de la Motte, C., DiCorleto, P. E. (1997) Distinct mechanisms for N-acetylcysteine inhibition of cytokine-induced E-selectin and VCAM-1 expression. Am. J. Physiol. 273,H817-H826[Abstract/Free Full Text]
  24. Cimino, F., Esposito, F., Ammendola, R., Russo, T. (1997) Gene regulation by reactive oxygen species. Curr. Top. Cell. Regul. 35,123-147[Medline]
  25. Lewis, T. S., Shapiro, P. S., Ahn, N. G. (1998) Signal transduction through MAP kinase cascades. Adv. Cancer Res. 74,49-139[Medline]
  26. Lo, Y. Y. C., Wong, J. M. S., Cruz, T. F. (1996) Reactive oxygen species mediate cytokine activation of c-Jun NH2-terminal kinases. J. Biol. Chem. 271,15703-15707[Abstract/Free Full Text]
  27. Clerk, A., Fuller, S. J., Michael, A., Sugden, P. H. (1998) Stimulation of `stress regulated' mitogen-activated protein kinases (stress-activated protein kinases/c-Jun N-terminal kinases and p38-mitogen-activated protein kinases) in perfused rat hearts by oxidative and other stresses. J. Biol. Chem. 273,7228-7234[Abstract/Free Full Text]
  28. Luo, Y., Umegaki, H., Wang, X., Abe, R., Roth, G. S. (1998) Dopamine induces apoptosis through an oxidation-involved SAPK/JNK activation pathway. J. Biol. Chem. 273,3756-3764[Abstract/Free Full Text]
  29. Wilhelm, D., Bender, K., Knebel, A., Angel, P. (1997) The level of intracellular glutathione is a key regulator for the induction of stress-activated signal transduction pathways including Jun N-terminal protein kinases and p38 kinase by alkylating agents. Mol. Cell. Biol. 17,4792-4800[Abstract/Free Full Text]
  30. Gomez del Arco, P., Martinez-Martinez, S., Calvo, V., Armesilla, A. L., Redondo, J. M. (1996) JNK (c-Jun NH2-terminal kinase) is a target for antioxidants in T lymphocytes. J. Biol. Chem. 271,26335-26340[Abstract/Free Full Text]
  31. Pulverer, B. J., Kyriakis, J. M., Avruch, J., Nikolakaki, E., Woodgett, J. R. (1991) Phosphorylation of c-jun mediated by MAP kinases. Nature (London) 353,670-674[Medline]
  32. Zwacka, R. M., Zhou, W., Zhang, Y., Darby, C. J., Dudus, L., Halldorson, J., Oberley, L., Engelhardt, J. F. (1998) Redox gene therapy for ischemia/reperfusion injury of the liver reduces AP1 and NF-{kappa}B activation. Nat. Med. 4,698-704[Medline]
  33. Gu, L., Rutledge, B., Fiorillo, J., Ernst, C., Grewal, I., Flavell, R., Gladue, R., Rollins, B. (1997) In vivo properties of monocyte chemoattractant protein-1. J. Leukocyte Biol. 62,577-580[Abstract]
  34. Ylä-Herttuala, S., Lipton, B. A., Rosenfeld, M. E., Särkioja, T., Yoshimura, T., Leonard, E. J., Witztum, J. L., Steinberg, D. (1991) Expression of monocyte chemoattractant protein 1 in macrophage-rich areas of human and rabbit atherosclerotic lesions. Proc. Natl. Acad. Sci. USA 88,5252-5256[Abstract/Free Full Text]
  35. Nelken, N. A., Coughlin, S. R., Gordon, D., Wilcox, J. N. (1991) Monocyte chemoattractant protein-1 in human atheromatous plaques. J. Clin. Invest. 88,1121-1127
  36. Martin, T., Cardarelli, P. M., Parry, G. C., Felts, K. A., Cobb, R. R. (1997) Cytokine induction of monocyte chemoattractant protein-1 gene expression in human endothelial cells depends on the cooperative action of NF-kappa B and AP-1. Eur. J. Immunol. 27,1091-1097[Medline]



This article has been cited by other articles:


Home page
J EndocrinolHome page
J. Beltowski, G. Wojcicka, and H. Jakubowski
Modulation of paraoxonase 1 and protein N-homocysteinylation by leptin and the synthetic liver X receptor agonist T0901317 in the rat
J. Endocrinol., February 1, 2010; 204(2): 191 - 198.
[Abstract] [Full Text] [PDF]


Home page
Exp Biol MedHome page
X.-H. Shen, Q.-Y. Tang, J. Huang, and W. Cai
Vitamin E regulates adipocytokine expression in a rat model of dietary-induced obesity
Exp Biol Med, January 1, 2010; 235(1): 47 - 51.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
B. I. Ghanayem, R. Bai, G. E. Kissling, G. Travlos, and U. Hoffler
Diet-Induced Obesity in Male Mice Is Associated with Reduced Fertility and Potentiation of Acrylamide-Induced Reproductive Toxicity
Biol Reprod, January 1, 2010; 82(1): 96 - 104.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
R. C.M. van Kruijsdijk, E. van der Wall, and F. L.J. Visseren
Obesity and Cancer: The Role of Dysfunctional Adipose Tissue
Cancer Epidemiol. Biomarkers Prev., October 1, 2009; 18(10): 2569 - 2578.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
Y. Tang, S. Zheng, and A. Chen
Curcumin Eliminates Leptin's Effects on Hepatic Stellate Cell Activation via Interrupting Leptin Signaling
Endocrinology, July 1, 2009; 150(7): 3011 - 3020.
[Abstract] [Full Text] [PDF]


Home page
JDRHome page
P. Bullon, J.M. Morillo, M.C. Ramirez-Tortosa, J.L. Quiles, H.N. Newman, and M. Battino
Metabolic Syndrome and Periodontitis: Is Oxidative Stress a Common Link?
Journal of Dental Research, June 1, 2009; 88(6): 503 - 518.
[Abstract] [Full Text] [PDF]


Home page
Diabetes CareHome page
W. Lieb, L. M. Sullivan, T. B. Harris, R. Roubenoff, E. J. Benjamin, D. Levy, C. S. Fox, T. J. Wang, P. W. Wilson, W. B. Kannel, et al.
Plasma Leptin Levels and Incidence of Heart Failure, Cardiovascular Disease, and Total Mortality in Elderly Individuals
Diabetes Care, April 1, 2009; 32(4): 612 - 616.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
T. Hosoi, M. Sasaki, T. Miyahara, C. Hashimoto, S. Matsuo, M. Yoshii, and K. Ozawa
Endoplasmic Reticulum Stress Induces Leptin Resistance
Mol. Pharmacol., December 1, 2008; 74(6): 1610 - 1619.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
J. Trujillo, C. Cruz, A. Tovar, V. Vaidya, E. Zambrano, J. V. Bonventre, G. Gamba, N. Torres, and N. A. Bobadilla
Renoprotective mechanisms of soy protein intake in the obese Zucker rat
Am J Physiol Renal Physiol, November 1, 2008; 295(5): F1574 - F1582.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
M. Korda, R. Kubant, S. Patton, and T. Malinski
Leptin-induced endothelial dysfunction in obesity
Am J Physiol Heart Circ Physiol, October 1, 2008; 295(4): H1514 - H1521.
[Abstract] [Full Text] [PDF]


Home page
VASC ENDOVASCULAR SURGHome page
K. G. Maier
Nicotinamide Adenine Dinucleotide Phosphate Oxidase and Diabetes: Vascular Implications
Vascular and Endovascular Surgery, August 1, 2008; 42(4): 305 - 313.
[Abstract] [PDF]


Home page
CLIN APPL THROMB HEMOSTHome page
J. Malyszko, J.S. Malyszko, P. Kozminski, K. Pawlak, and M. Mysliwiec
Adipokines, Linking Adipocytes and Vascular Function in Hemodialyzed Patients, May Also Be Possibly Related to CD146, a Novel Adhesion Molecule
Clinical and Applied Thrombosis/Hemostasis, July 1, 2008; 14(3): 338 - 345.
[Abstract] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
B. K. Surmi, R. D. Atkinson, M. L. Gruen, K. R. Coenen, and A. H. Hasty
The role of macrophage leptin receptor in aortic root lesion formation
Am J Physiol Endocrinol Metab, March 1, 2008; 294(3): E488 - E495.
[Abstract] [Full Text] [PDF]


Home page
Alcohol AlcoholHome page
S. Djurovic, K. E. Berge, B. Birkenes, O. Braaten, and L. Retterstol
The effect of red wine on plasma leptin levels and vasoactive factors from adipose tissue: A randomized crossover trial
Alcohol Alcohol., November 1, 2007; 42(6): 525 - 528.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
F. Haugen and C. A. Drevon
Activation of Nuclear Factor-{kappa}B by High Molecular Weight and Globular Adiponectin
Endocrinology, November 1, 2007; 148(11): 5478 - 5486.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
P. F. Bodary
Links Between Adipose Tissue and Thrombosis in the Mouse
Arterioscler Thromb Vasc Biol, November 1, 2007; 27(11): 2284 - 2291.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
R. Yang and L. A. Barouch
Leptin Signaling and Obesity: Cardiovascular Consequences
Circ. Res., September 14, 2007; 101(6): 545 - 559.
[Abstract] [Full Text] [PDF]


Home page
CJASNHome page
B. C.H. Kwan, M. A. Murtaugh, and S. Beddhu
Associations of Body Size with Metabolic Syndrome and Mortality in Moderate Chronic Kidney Disease
Clin. J. Am. Soc. Nephrol., September 1, 2007; 2(5): 992 - 998.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
G. Fantuzzi and T. Mazzone
Adipose Tissue and Atherosclerosis: Exploring the Connection
Arterioscler Thromb Vasc Biol, May 1, 2007; 27(5): 996 - 1003.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
A. Bellmeyer, J. M. Martino, N. S. Chandel, G. R. Scott Budinger, D. A. Dean, and G. M. Mutlu
Leptin Resistance Protects Mice from Hyperoxia-induced Acute Lung Injury
Am. J. Respir. Crit. Care Med., March 15, 2007; 175(6): 587 - 594.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
C. Iribarren, G. Husson, A. S. Go, J. C. Lo, J. M. Fair, G. D. Rubin, M. A. Hlatky, and S. P. Fortmann
Plasma Leptin Levels and Coronary Artery Calcification in Older Adults
J. Clin. Endocrinol. Metab., February 1, 2007; 92(2): 729 - 732.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
R. A. Johnston, T. A. Theman, R. D. Terry, E. S. Williams, and S. A. Shore
Pulmonary responses to acute ozone exposure in fasted mice: effect of leptin administration
J Appl Physiol, January 1, 2007; 102(1): 149 - 156.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
H. Cui, F. Cai, and D. D. Belsham
Leptin signaling in neurotensin neurons involves STAT, MAP kinases ERK1/2, and p38 through c-Fos and ATF1
FASEB J, December 1, 2006; 20(14): 2654 - 2656.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
R. Ouedraogo, X. Wu, S.-Q. Xu, L. Fuchsel, H. Motoshima, K. Mahadev, K. Hough, R. Scalia, and B. J. Goldstein
Adiponectin Suppression of High-Glucose-Induced Reactive Oxygen Species in Vascular Endothelial Cells: Evidence for Involvement of a cAMP Signaling Pathway
Diabetes, June 1, 2006; 55(6): 1840 - 1846.
[Abstract] [Full Text] [PDF]


Home page
J Am Coll CardiolHome page
T. H. Schindler, J. Cardenas, J. O. Prior, A. D. Facta, M. C. Kreissl, X.-L. Zhang, J. Sayre, M. Dahlbom, J. Licinio, and H. R. Schelbert
Relationship Between Increasing Body Weight, Insulin Resistance, Inflammation, Adipocytokine Leptin, and Coronary Circulatory Function
J. Am. Coll. Cardiol., March 21, 2006; 47(6): 1188 - 1195.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
F. Dong, X. Zhang, and J. Ren
Leptin Regulates Cardiomyocyte Contractile Function Through Endothelin-1 Receptor-NADPH Oxidase Pathway
Hypertension, February 1, 2006; 47(2): 222 - 229.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
R. A. Johnston, T. A. Theman, and S. A. Shore
Augmented responses to ozone in obese carboxypeptidase E-deficient mice
Am J Physiol Regulatory Integrative Comp Physiol, January 1, 2006; 290(1): R126 - R133.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
M. Lappas, M. Permezel, and G. E. Rice
Leptin and Adiponectin Stimulate the Release of Proinflammatory Cytokines and Prostaglandins from Human Placenta and Maternal Adipose Tissue via Nuclear Factor-{kappa}B, Peroxisomal Proliferator-Activated Receptor-{gamma} and Extracellularly Regulated Kinase 1/2
Endocrinology, August 1, 2005; 146(8): 3334 - 3342.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
P. F. Bodary, S. Gu, Y. Shen, A. H. Hasty, J. M. Buckler, and D. T. Eitzman
Recombinant Leptin Promotes Atherosclerosis and Thrombosis in Apolipoprotein E-Deficient Mice
Arterioscler Thromb Vasc Biol, August 1, 2005; 25(8): e119 - e122.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
N. Mehebik, A.-M. Jaubert, D. Sabourault, Y. Giudicelli, and C. Ribiere
Leptin-induced nitric oxide production in white adipocytes is mediated through PKA and MAP kinase activation
Am J Physiol Cell Physiol, August 1, 2005; 289(2): C379 - C387.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
L. Li, J.-C. Mamputu, N. Wiernsperger, and G. Renier
Signaling Pathways Involved in Human Vascular Smooth Muscle Cell Proliferation and Matrix Metalloproteinase-2 Expression Induced by Leptin: Inhibitory Effect of Metformin
Diabetes, July 1, 2005; 54(7): 2227 - 2234.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
D. C. W. Lau, B. Dhillon, H. Yan, P. E. Szmitko, and S. Verma
Adipokines: molecular links between obesity and atheroslcerosis
Am J Physiol Heart Circ Physiol, May 1, 2005; 288(5): H2031 - H2041.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
G. Ferretti, T. Bacchetti, C. Moroni, S. Savino, A. Liuzzi, F. Balzola, and V. Bicchiega
Paraoxonase Activity in High-Density Lipoproteins: A Comparison between Healthy and Obese Females
J. Clin. Endocrinol. Metab., March 1, 2005; 90(3): 1728 - 1733.
[Abstract] [Full Text] [PDF]


Home page
J Am Coll CardiolHome page
R. Wolk, P. Berger, R. J. Lennon, E. S. Brilakis, B. D. Johnson, and V. K. Somers
Plasma leptin and prognosis in patients with established coronary atherosclerosis
J. Am. Coll. Cardiol., November 2, 2004; 44(9): 1819 - 1824.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
F.-P. Xu, M.-S. Chen, Y.-Z. Wang, Q. Yi, S.-B. Lin, A. F. Chen, and J.-D. Luo
Leptin Induces Hypertrophy via Endothelin-1-Reactive Oxygen Species Pathway in Cultured Neonatal Rat Cardiomyocytes
Circulation, September 7, 2004; 110(10): 1269 - 1275.
[Abstract] [Full Text] [PDF]


Home page
J Am Coll CardiolHome page
Y. Yu, K. Ohmori, Y. Chen, C. Sato, H. Kiyomoto, K. Shinomiya, H. Takeuchi, K. Mizushige, and M. Kohno
Effects of pravastatin on progression of glucose intolerance and cardiovascular remodeling in a type II diabetes model
J. Am. Coll. Cardiol., August 18, 2004; 44(4): 904 - 913.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Clin. Nutr.Home page
J. Gomez-Ambrosi, J. Salvador, and G. Fruhbeck
Is hyperleptinemia involved in the development of age-related lens opacities?
Am. J. Clinical Nutrition, May 1, 2004; 79(5): 888 - 889.
[Full Text] [PDF]


Home page
Am. J. Clin. Nutr.Home page
A. Taylor
Reply to J Gomez-Ambrosi et al
Am. J. Clinical Nutrition, May 1, 2004; 79(5): 889 - 889.
[Full Text] [PDF]


Home page
DiabetesHome page
C. A. Curat, A. Miranville, C. Sengenes, M. Diehl, C. Tonus, R. Busse, and A. Bouloumie
From Blood Monocytes to Adipose Tissue-Resident Macrophages: Induction of Diapedesis by Human Mature Adipocytes
Diabetes, May 1, 2004; 53(5): 1285 - 1292.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
C. J. Hukshorn, J. H. N. Lindeman, K. H. Toet, W. H. M. Saris, P. H. C. Eilers, M. S. Westerterp-Plantenga, and T. Kooistra
Leptin and the Proinflammatory State Associated with Human Obesity
J. Clin. Endocrinol. Metab., April 1, 2004; 89(4): 1773 - 1778.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Q. Cao, K. M. Mak, C. Ren, and C. S. Lieber
Leptin Stimulates Tissue Inhibitor of Metalloproteinase-1 in Human Hepatic Stellate Cells: RESPECTIVE ROLES OF THE JAK/STAT AND JAK-MEDIATED H2O2-DEPENDENT MAPK PATHWAYS
J. Biol. Chem., February 6, 2004; 279(6): 4292 - 4304.
[Abstract] [Full Text] [PDF]


Home page
Recent Prog Horm ResHome page
K. Rahmouni and W. G. Haynes
Leptin and the Cardiovascular System
Recent Prog. Horm. Res., January 1, 2004; 59(1): 225 - 244.
[Abstract] [Full Text]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
N. Werner and G. Nickenig
From Fat Fighter to Risk Factor: The Zigzag Trek of Leptin
Arterioscler Thromb Vasc Biol, January 1, 2004; 24(1): 7 - 9.
[Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Onuma, J. D. Bub, T. L. Rummel, and Y. Iwamoto
Prostate Cancer Cell-Adipocyte Interaction: LEPTIN MEDIATES ANDROGEN-INDEPENDENT PROSTATE CANCER CELL PROLIFERATION THROUGH c-Jun NH2-TERMINAL KINASE
J. Biol. Chem., October 24, 2003; 278(43): 42660 - 42667.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
A. D. Dobrian, S. D. Schriver, T. Lynch, and R. L. Prewitt
Effect of salt on hypertension and oxidative stress in a rat model of diet-induced obesity
Am J Physiol Renal Physiol, October 1, 2003; 285(4): F619 - F628.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
S. A. Shore, Y. M. Rivera-Sanchez, I. N. Schwartzman, and R. A. Johnston
Responses to ozone are increased in obese mice
J Appl Physiol, September 1, 2003; 95(3): 938 - 945.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
F. Maingrette and G. Renier
Leptin Increases Lipoprotein Lipase Secretion by Macrophages: Involvement of Oxidative Stress and Protein Kinase C
Diabetes, August 1, 2003; 52(8): 2121 - 2128.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
Y. W. Lee, B. Hennig, and M. Toborek
Redox-regulated mechanisms of IL-4-induced MCP-1 expression in human vascular endothelial cells
Am J Physiol Heart Circ Physiol, January 1, 2003; 284(1): H185 - H192.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
S. Goetze, A. Bungenstock, C. Czupalla, F. Eilers, P. Stawowy, U. Kintscher, C. Spencer-Hansch, K. Graf, B. Nurnberg, R. E. Law, et al.
Leptin Induces Endothelial Cell Migration Through Akt, Which Is Inhibited by PPAR{gamma}-Ligands
Hypertension, November 1, 2002; 40(5): 748 - 754.
[Abstract] [Full Text] [PDF]


Home page
JAMAHome page
G. Davi, M. T. Guagnano, G. Ciabattoni, S. Basili, A. Falco, M. Marinopiccoli, M. Nutini, S. Sensi, and C. Patrono
Platelet Activation in Obese Women: Role of Inflammation and Oxidant Stress
JAMA, October 23, 2002; 288(16): 2008 - 2014.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
H. Li, P. Junk, A. Huwiler, C. Burkhardt, T. Wallerath, J. Pfeilschifter, and U. Forstermann
Dual Effect of Ceramide on Human Endothelial Cells: Induction of Oxidative Stress and Transcriptional Upregulation of Endothelial Nitric Oxide Synthase
Circulation, October 22, 2002; 106(17): 2250 - 2256.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
A. Singhal, I. S. Farooqi, T. J. Cole, S. O'Rahilly, M. Fewtrell, M. Kattenhorn, A. Lucas, and J. Deanfield
Influence of Leptin on Arterial Distensibility: A Novel Link Between Obesity and Cardiovascular Disease?
Circulation, October 8, 2002; 106(15): 1919 - 1924.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
N.-H. Cho, S.-Y. Seong, M.-S. Huh, N.-H. Kim, M.-s. Choi, and I.-s. Kim
Induction of the Gene Encoding Macrophage Chemoattractant Protein 1 by Orientia tsutsugamushi in Human Endothelial Cells Involves Activation of Transcription Factor Activator Protein 1
Infect. Immun., September 1, 2002; 70(9): 4841 - 4850.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
A. L. Mark and W. I. Sivitz
Uncoupling Metabolism and Coupling Leptin to Cardiovascular Disease
Arterioscler Thromb Vasc Biol, June 1, 2002; 22(6): 881 - 883.
[Full Text] [PDF]


Home page
Circ. Res.Home page
P. Quehenberger, M. Exner, R. Sunder-Plassmann, K. Ruzicka, C. Bieglmayer, G. Endler, C. Muellner, W. Speiser, and O. Wagner
Leptin Induces Endothelin-1 in Endothelial Cells In Vitro
Circ. Res., April 5, 2002; 90(6): 711 - 718.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
T. Hosoi, Y. Okuma, A. Ono, and Y. Nomura
Subdiaphragmatic vagotomy fails to inhibit intravenous leptin-induced IL-1beta expression in the hypothalamus
Am J Physiol Regulatory Integrative Comp Physiol, February 1, 2002; 282(2): R627 - R631.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
K. Takekoshi, K. Ishii, T. Nanmoku, S. Shibuya, Y. Kawakami, K. Isobe, and T. Nakai
Leptin Stimulates Catecholamine Synthesis in a PKC-Dependent Manner in Cultured Porcine Adrenal Medullary Chromaffin Cells
Endocrinology, November 1, 2001; 142(11): 4861 - 4871.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
N. Wang, L. Verna, H.-l. Liao, A. Ballard, Y. Zhu, and M. B. Stemerman
Adenovirus-Mediated Overexpression of Dominant-Negative Mutant of c-Jun Prevents Intercellular Adhesion Molecule-1 Induction by LDL: A Critical Role for Activator Protein-1 in Endothelial Activation
Arterioscler Thromb Vasc Biol, September 1, 2001; 21(9): 1414 - 1420.
[Abstract] [Full Text] [PDF]


Home page
J. Thorac. Cardiovasc. Surg.Home page
X. Xu, J. Li, M. Simons, J. Li, R. J. Laham, and F. W. Sellke
Expression of vascular endothelial growth factor and its receptors is increased, but microvascular relaxation is impaired in patients after acute myocardial ischemia
J. Thorac. Cardiovasc. Surg., April 1, 2001; 121(4): 735 - 742.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
F. Caldefie-Chezet, A. Poulin, A. Tridon, B. Sion, and M-P. Vasson
Leptin: a potential regulator of polymorphonuclear neutrophil bactericidal action?
J. Leukoc. Biol., March 1, 2001; 69(3): 414 - 418.
[Abstract] [Full Text]


Home page
J. Leukoc. Biol.Home page
G. Fantuzzi and R. Faggioni
Leptin in the regulation of immunity, inflammation, and hematopoiesis
J. Leukoc. Biol., October 1, 2000; 68(4): 437 - 446.
[Abstract] [Full Text]


Home page
Hum ReprodHome page
N. Anim-Nyame, S.R. Sooranna, P.J. Steer, and M.R. Johnson
Longitudinal analysis of maternal plasma leptin concentrations during normal pregnancy and pre-eclampsia
Hum. Reprod., September 1, 2000; 15(9): 2033 - 2036.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
A. D. Dobrian, M. J. Davies, R. L. Prewitt, and T. J. Lauterio
Development of Hypertension in a Rat Model of Diet-Induced Obesity
Hypertension, April 1, 2000; 35(4): 1009 - 1015.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S.-i. Yamagishi, D. Edelstein, X.-l. Du, Y. Kaneda, M. Guzman, and M. Brownlee
Leptin Induces Mitochondrial Superoxide Production and Monocyte Chemoattractant Protein-1 Expression in Aortic Endothelial Cells by Increasing Fatty Acid Oxidation via Protein Kinase A
J. Biol. Chem., June 29, 2001; 276(27): 25096 - 25100.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. Chen, J. A. Vita, B. C. Berk, and J. F. Keaney Jr.
c-Jun N-terminal Kinase Activation by Hydrogen Peroxide in Endothelial Cells Involves Src-dependent Epidermal Growth Factor Receptor Transactivation
J. Biol. Chem., May 4, 2001; 276(19): 16045 - 16050.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C.-P. Liang and A. R. Tall
Transcriptional Profiling Reveals Global Defects in Energy Metabolism, Lipoprotein, and Bile Acid Synthesis and Transport with Reversal by Leptin Treatment in Ob/ob Mouse Liver
J. Biol. Chem., December 21, 2001; 276(52): 49066 - 49076.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
P. Quehenberger, M. Exner, R. Sunder-Plassmann, K. Ruzicka, C. Bieglmayer, G. Endler, C. Muellner, W. Speiser, and O. Wagner
Leptin Induces Endothelin-1 in Endothelial Cells In Vitro
Circ. Res., April 5, 2002; 90(6): 711 - 718.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by BOULOUMIÉ, A.
Right arrow Articles by BUSSE, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by BOULOUMIÉ, A.
Right arrow Articles by BUSSE, R.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS