|
|
||||||||
Institut für Kardiovaskuläre Physiologie, Klinikum der J. W. Goethe-Universität, Frankfurt/Main, Germany; and
* INSERM U317, Institut Louis Bugnard, CHU Rangueil, Toulouse, France
1Correspondence: Institut für Kardiovaskuläre Physiologie, Klinikum der J. W. Goethe-Universität, Theodor-Stern-Kai 7, 60590 Frankfurt/Main, Germany. E-mail: bouloumie{at}em.uni-frankfurt.de
| ABSTRACT |
|---|
|
|
|---|
B, another redox-sensitive transcription
factor, was also activated by leptin stimulation in an
oxidant-dependent manner. Finally, activation of both AP-1 and NF-
B
was associated with an enhanced expression of the monocyte
chemoattractant protein-1 in HUVEC. These findings demonstrate that ROS
are second messengers involved in leptin-induced signaling in
endothelial cells. Thus, chronic oxidative stress in endothelial cells
under hyperleptinemia may activate atherogenic processes and contribute
to the development of vascular pathology.Bouloumié, A., Marumo,
T., Lafontan, M., Busse, R. Leptin induces oxidative stress in human
endothelial cells.
Key Words: Jun kinase MCP-1 AP-1 NF-
B atherosclerosis obesity
| INTRODUCTION |
|---|
|
|
|---|
Atherosclerotic lesions are the results of an excessive
proliferative and inflammatory response that involves several cellular
events, including smooth muscle cell migration and proliferation,
inflammatory cell infiltration, neovascularization, production of
extracellular matrix, and the accumulation of lipids (12)
. Evidence
suggests that the generation of oxidative stress, characterized by
enhanced reactive oxygen species (ROS) formation, may play a central
regulatory role in such events. ROS are potent activators of cell
migration and proliferation (13)
and modulate the expression of several
proinflammatory molecules in endothelial cells such as adhesion
molecules [vascular cell adhesion molecule-1 (14)
and intercellular
adhesion molecule-1 (15)
] and chemotactic factors (monocyte
chemoattractant molecule-1, MCP-1) (16)
. ROS appear to act as signaling
messengers capable of activating intracellular transduction pathways
and transcriptions factors (17)
, such as NF-
B and AP-1, both of
which are sensitive to changes in intracellular redox state (18)
.
In the present study, we demonstrate that leptin increases the accumulation of ROS in endothelial cells and thereby might play a major role in the inflammation process and genesis of atherosclerosis.
| MATERIALS AND METHODS |
|---|
|
|
|---|
-32P]dCTP and
[
-32P]ATP were obtained from Hartmann
analytic (Braunschweig, Germany).
Cell culture
Human umbilical vein endothelial cells (HUVEC), isolated as
described previously (19)
, were seeded in culture dishes containing
M-199 medium (Life Technologies, Eggenstein-Leopoldshafen, Germany) and
10% fetal calf serum (Biochrom, Berlin, Germany) supplemented with
penicillin (50 U/ml) and streptomycin (50 µg/ml). Experiments were
performed on quiescent cells from passage 1 maintained in
serum-deprived M-199 supplemented with 0.1% bovine serum albumin (Life
Technologies) for 24 to 36 h.
Measurement of intracellular ROS generation
The determination of intracellular oxidant production was
based on the oxidation of 2',7'-dichlorodihydrofluorescein (DCHF) by
peroxide, resulting in the formation of the fluorescent compound
2',7'-dichlorofluorescein (DCF) using a cytofluor 2300 multiplate
fluorometer (Millipore, Bedford, Mass.) as described previously (20)
.
HUVEC were incubated in Hanks' balanced salt solution at 37°C for
1 h with the drugs, as indicated in the Results section, and for
the last 20 min with 20 µmol/l DCHF diacetate. The cells were then
washed and maintained at 37°C in Hanks' balanced salt solution.
Unless otherwise indicated, the fluorescence was monitored after 30 min
using excitation and emission wavelengths of 485 nm and 530 nm,
respectively, and subtracted from the basal fluorescence measured
before addition of leptin.
JNK/SAPK assays
Cells were lysed in Triton lysis buffer (20 mmol/l Tris-HCl, pH
8.0, containing 1% Triton X-100, 137 mmol/l NaCl, 25 mmol/l
ß-glycerophosphate, 1 mmol/l Na orthovanadate, 2 mmol/l
Na2H2P2O7,
2 mmol/l EDTA, pH 8.0, 10% glycerol, and protease inhibitors (100
µg/ml phenylmethylsulfonyl, 1 µg/ml aprotinin, and 1 µg/ml
leupeptin). The protein extracts were incubated with 2 µl of rabbit
anti-JNK1 antibody for 2 h at 4°C and then with 20 µl protein
G-Sepharose. After 1 h incubation at 4°C, the immunoprecipitates
were washed with Triton lysis buffer and kinase buffer (25 mmol/l
HEPES, pH 7.6, 20 mmol/l MgCl2, 20 mmol/l
ß-glycerophosphate, 0.1 mmol/l Na orthovanadate, 2 mmol/l DTT). The
kinase assays were performed at 30°C for 30 min using 2 µg GSP-cJun
as a substrate, 20 µmol/l ATP, and 5 µCi of
[
-32P]dATP in 30 µl of kinase buffer. The
reactions were terminated with Laemmli sample buffer and the products
resolved by sodium dodecyl sulfate-polyacrylamide gel electrophoresis
(12% gel). The incorporation of [32P]phosphate
was visualized by autoradiography and quantified by scanning
densitometry, using as software Image master 1D (Pharmacia, Freiburg,
Germany).
Electrophoretic mobility shift assays
Nuclear extracts from HUVEC were isolated as described (19)
.
After nuclear extraction and protein determination, the nuclear
proteins were used for electrophoretic mobility shift assays.
Double-stranded oligonucleotides containing the sequence of the binding
site for transcription factor AP-1 (5'-CGC TTG ATG AGT CAG CCG GAA-3',
Promega, Wis.) and NF-
B (5'AGTTGAGGGGACTTTCCCAGCC3' (Promega) were
radiolabeled with 30 µCi [
-32P]ATP by
using a 5' end labeling kit (Pharmacia Biotech, Germany). Nuclear
proteins (6 µg) were incubated with 3000 counts of labeled
oligonucleotide in a buffer containing HEPES, 10 mmol/l, pH 7.5; NaCl,
100 mmol/l; EDTA, 1 mmol/l; dithiothreitol, 1.5 mmol/l; 5% glycerol,
and 2 µg poly(dI/dC) for 30 min at room temperature. The reaction
mixture was loaded onto a 6% polyacrylamide gel buffered with Tris, 89
mmol/l; boric acid, 89 mmol/l, and EDTA, 2 mmol/l. After drying, the
gel was placed in contact with X-ray film at -70°C. Densitometric
analysis of the autoradiographs was performed after unsaturating
exposures; the values obtained were normalized and expressed as the
percentage of the binding activity in unstimulated cell extracts.
Analysis of MCP1 expression by Northern blotting
Total RNAs were extracted according to the method of Chomczynski
and Sacchi (21)
. Northern blots were performed using 15 µg total RNA.
RNA were electrophoresed on a 1.2% formaldehyde-denatured agarose gel,
visualized with ethidium bromide, transferred to a nylon membrane
(porablot NY amp, Macherey-Nagel, Düren, Germany), and hybridized
with either [32P]-labeled MCP-1 fragment
obtained from the clone pXM-hJE34 (kindly provided by Dr. B. J.
Rollins) or [32P]-labeled 18S ribosomal mouse
RNA fragment. Autoradiographs were then exposed for 4 to 72 h.
Quantification of MCP-1 mRNA was performed by scanning densitometry,
normalized for the ribosomal RNA signal to correct loading
irregularities. The autoradiographs were analyzed by scanning
densitometry.
Statistics
Data are expressed as mean ± SE. Statistical
analyses were performed by one-way analysis of variance, followed by a
Bonferroni t test. Values of P < 0.05 were
considered statistically significant.
| RESULTS |
|---|
|
|
|---|
|
The basal DCF fluorescence was strongly reduced in cells
pretreated with the superoxide dismutase inhibitor
diethyldithiocarbamic acid (DDC, 5 mmol/l) or with the tyrosine kinase
inhibitor genistein (µmol/l) (Fig. 1B
). Leptin (10 ng/ml),
in the presence of DDC, still enhanced significantly the DCF
fluorescence (twofold increase, P < 0.05) whereas genistein
pretreatment prevented the leptin-induced increase in DCF fluorescence.
An identical effect was observed with another tyrosine kinase
inhibitor, herbimycin (5 µmol/l) (data not shown). The presence of
the inhibitor of nitric oxide synthase, NG-nitro-L-arginine
(300 µmol/l), did not affect the stimulatory effect of leptin (Fig. 1B
), whereas the DCF fluorescence was completely abolished
in the presence of the antioxidant N-acetylcysteine (NAC, 30 mmol/l) in
control and leptin-treated cells (data not shown).
Effect of leptin on Jun kinase-dependent pathway
Because ROS act as intracellular second messengers, we tested
whether leptin treatment of endothelial cells is associated with
activation of stress-dependent intracellular pathway, i.e., the
NH2-terminal c-Jun kinase/stress-activated
protein kinase (JNK/SAPK) and its downstream target, the transcription
factor AP-1.
Immunocomplex kinase assays performed to assess the activity of JNK
showed that protein extracts obtained from cells stimulated with leptin
exhibited a time-dependent increase in JNK activity (Fig. 2
A). Leptin (10 ng/ml) enhanced the JNK-mediated
phosphorylation of the GST-Jun fusion protein, with a maximal effect
after 30 min of treatment. The leptin-dependent activation of JNK was
abolished when cells were pretreated with the tyrosine kinase
inhibitors genistein (30 µmol/l) or herbimycin (5 µmol/l) (Fig. 2B
).
|
Moreover, pretreatment of cells with the antioxidant NAC (30 mmol/l)
suppressed the leptin effect on JNK activity, whereas pretreatment of
cells with pyrrolidine dithiocarbamate (PDTC), originally used as
antioxidant but described to have pro-oxidant properties (22)
, further
increased the stimulatory effect of leptin on JNK activity (Fig. 3
A, B).
|
To further characterize the JNK-dependent pathway activated by leptin,
we studied the DNA binding activity of the transcription factor AP-1.
Electrophoretic mobility shift assays using
[32P]AP-1 consensus sequence showed that
nuclear extracts from cells stimulated with leptin evoked a
time-dependent appearance of two bands, reflecting an enhanced
association of nuclear proteins with the AP-1 consensus sequence
(Fig. 4
A). The stimulatory effect reached a peak within 30 min
(4.2-fold increase, P < 0.01, n=4) and gradually
decreased after 1 h. Treatment of nuclear extracts with excess of
cold AP-1 consensus sequence resulted in the suppression of the leptin
effect on the upper band (Fig. 4B
). Thus, the upper band
represented the specific leptin-sensitive AP-1/DNA complex.
Pretreatment of cells with NAC abolished the stimulatory effect of
leptin in a concentration-dependent manner (Fig. 5
A, B).
|
|
Effect of leptin on NF-
B activity
The activity of the transcription factor NF-
B is sensitive to
intracellular redox changes. Thus, we investigated the DNA binding
activity of NF-
B as an index of oxidative stress after stimulation
of endothelial cells with leptin. Nuclear extracts prepared from cells
treated with leptin produced a time-dependent shift in the mobility of
the NF-
B consensus sequence (Fig. 6
A). The activation peaked after 30 min stimulation, although
to a lesser extent than that of AP-1 (1.98-fold increase, P
< 0.05, n=4) and remained elevated over 1 h. Addition
of specific p65- or p50-antibodies to nuclear extracts obtained from
leptin-treated cells resulted in supershifts of the NF-
B/DNA complex
(Fig. 6B
). This finding indicated that the p50/p65
heterodimer corresponded to the leptin-sensitive NF-
B complex.
Moreover, because the p65 antibody abolished the leptin-dependent
formation of NF-
B complex, it is likely that leptin activated the
p65 rather than p50 component of the NF-
B complex.
|
In nuclear extracts from cells pretreated with the antioxidant NAC (30
mM, 30 min) leptin did not increase NF-
B DNA binding activity
(Fig. 7
).
|
Effect of leptin on MCP-1 expression
Since the MCP-1 promoter contains binding sites for AP-1 and
NF-
B, we studied the effect of leptin on MCP-1 expression. Leptin
enhanced the amount of MCP-1 transcripts, identified by Northern blot
analysis, in a time-dependent manner (Fig. 8
A). Within 4 h of stimulation, a 1.6-fold increase was
observed (n=4, P < 0.05). Pretreatment of cells
with NAC completely abolished the stimulatory effect of leptin on MCP-1
expression (Fig. 8B
).
|
| DISCUSSION |
|---|
|
|
|---|
B. The oxidant-dependent
increase in MCP-1 expression observed after leptin stimulation further
supports the hypothesis that ROS play a major role in the
leptin-activated intracellular signaling pathway in endothelial cells.
Our results show that stimulation of cultured human endothelial cells
with leptin is associated with a significantly enhanced oxidation of
DCFH, indicative of increased intracellular
H2O2 or
HO. generation. We have previously described that
HUVEC express functional leptin receptors that, when activated, trigger
the stimulation of tyrosine kinase-dependent pathways (9)
. Since
tyrosine kinase inhibitors suppress the stimulatory effect of leptin on
DCF fluorescence, it is possible that the tyrosine kinases associated
with the leptin receptor are involved in the increased intracellular
ROS accumulation. N-acetylcysteine, a thiol-containing antioxidant that
not only scavenges free radicals, but also increases the ratio of
reduced to oxidized glutathione in endothelial cells (23)
, was found to
prevent the effects of leptin. Under inhibition of superoxide dismutase
and nitric oxide (NO) synthase, leptin still enhanced the DCF
fluorescence. These results indirectly suggest that increased peroxide
formation rather than superoxide anions and/or peroxynitrite, the
reaction product of NO and superoxide anion, is responsible for the
increased DCF fluorescence in endothelial cells stimulated with leptin.
Moreover, we did not observe in HUVEC any effect of leptin on
intracellular cyclic GMP level, a standard indicator of NO formation
(unpublished data).
Studies of oxidant radicals have mainly focused on toxic effects, but
there is now growing evidence for ROS as second messengers, involved in
the transduction of extracellular stimuli and able to modulate
intracellular signal pathways (24)
. Key signal molecules in
intracellular pathways are MAP kinases. At least three different MAP
kinases classes have been identified: Erk (extracellular-regulated
kinases), JNK-SAPK (NH2-terminal c-Jun
Kinase/stress-activated protein kinase), and p38. Even though they are
closely related protein kinases, they appear to trigger distinct
biological responses. Erk signaling has been involved in the control of
cell proliferation and differentiation, whereas JNK- and p38-dependent
pathways have been implicated in responses to cellular stress (25)
. We
previously described that activation of the endothelial leptin
receptors was linked to stimulation of Erk1/2 in association with
enhanced cellular proliferation (9)
. In the present study, we report
that leptin led to a time-dependent activation of another MAP kinase
family, the JNK/SAP kinases. Since JNK is activated by oxidants such as
H2O2 (26
, 27)
,
intracellular ROS have been suggested to provide common signals to JNK
pathways (28
, 29)
. Our results clearly show that activation of JNK by
leptin was sensitive to the antioxidant N-acetylcysteine. However, the
presence of PDTC did not affect the stimulatory effect of leptin. Some
reports show that PDTC, commonly considered as antioxidant, can exert
pro-oxidant effects sensitive to N-acetylcysteine and glutathione (18)
,
due to the binding and transport of extracellular copper ions into
cells (22)
. Thus, the enhanced activity of JNK under PDTC stimulation,
already reported (30)
, is more likely related to the pro-oxidant than
the antioxidant properties of PDTC.
The transcription factor AP-1 is an inducible transcription factor that
can be activated and regulated at the transcriptional and/or protein
level. Changes in the phosphorylation state of c-Jun lead to the
stabilization as well as enhanced trans-activation and DNA
binding activity. c-Jun is a substrate for the JNKs that can bind
directly to and phosphorylate c-Jun more efficiently than ERKs in
vitro (31)
. Our results show that the AP-1 DNA binding activity,
assessed by electrophoretic mobility shift assay, is increased in a
time-dependent manner after leptin treatment. The stimulatory effect of
leptin was prevented in the presence of N-acetylcysteine. These
findings stress further the role of ROS in the leptin-induced
stimulation of the JNK-dependent pathway. Similarly, the DNA binding
activity of the transcription factor NF-
B was enhanced by leptin,
although to a lesser extent than AP-1. Moreover, this effect was
inhibited by an antioxidant. It has recently been shown that gene
therapy, involving gene transfer of recombinant mitochondrial
superoxide dismutase after ischemia/reperfusion injury in the liver,
was associated with a reduction in AP-1 and NF-
B activation (32)
.
This report, together with our findings, suggest that these immediate
early transcription factors represent common pathways by which cells
respond to environmental stress and more specifically to oxidative
stress.
MCP-1 belongs to the class of chemotactic cytokines shown to elicit the
direct migration of monocytes to inflammatory sites. Cellular MCP-1
expression has been shown to be induced by mitogenic or activation
signals in a variety of cell types, including monocytes, macrophages,
and T-lymphocytes, as well as in a variety of cells traditionally not
part of the immune system, including smooth muscle cells and
endothelial cells (33)
. Moreover, expression of MCP-1 has been shown in
human atherosclerotic lesions (34
, 35)
. Our present data demonstrate
that leptin leads to an up-regulation of MCP-1 transcripts in
endothelial cells. Moreover, this stimulatory effect was suppressed in
the presence of antioxidants. Since both AP-1 (TRE) and NF-
B (
B)
binding motifs are present in the promoter region of MCP-1 and act in a
cooperative manner (36)
, our finding suggests that the ROS-dependent
activation of AP-1 and NF-
B is involved in the enhanced MCP-1
expression after leptin stimulation of endothelial cells. Studies
performed in rodents with genetic abnormalities in the leptin system
have revealed obesity-related deficits in macrophage phagocytosis and
in the expression of proinflammatory cytokines, which could be
suppressed by exogenous leptin (7)
. Our data extend this
proinflammatory effect of leptin to human endothelial cells.
Endothelial cells play an important role in the initiation and
maintenance of inflammatory processes and acute tissue injuries.
Indeed, the adhesion of blood-borne monocytes and migration through the
endothelial surface is a prerequisite for the monocyte-macrophage
conversion. It is thus tempting to speculate that the intracellular
accumulation of oxidant radicals stimulated by leptin and the
consecutive expression of MCP-1 in endothelial cells might play a key
role in the inflammatory process. In addition, chronic endothelial
oxidative stress under hyperleptinemia, as in human obesity, might be
involved in the excessive inflammatory responses linked to
atherosclerosis.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
Received for publication November 3, 1998.
Revision received February 7, 1999.
| REFERENCES |
|---|
|
|
|---|
B activation. Nat. Med. 4,698-704[Medline]
This article has been cited by other articles:
![]() |
Y. Tang, S. Zheng, and A. Chen Curcumin Eliminates Leptin's Effects on Hepatic Stellate Cell Activation via Interrupting Leptin Signaling Endocrinology, July 1, 2009; 150(7): 3011 - 3020. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Lieb, L. M. Sullivan, T. B. Harris, R. Roubenoff, E. J. Benjamin, D. Levy, C. S. Fox, T. J. Wang, P. W. Wilson, W. B. Kannel, et al. Plasma Leptin Levels and Incidence of Heart Failure, Cardiovascular Disease, and Total Mortality in Elderly Individuals Diabetes Care, April 1, 2009; 32(4): 612 - 616. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Hosoi, M. Sasaki, T. Miyahara, C. Hashimoto, S. Matsuo, M. Yoshii, and K. Ozawa Endoplasmic Reticulum Stress Induces Leptin Resistance Mol. Pharmacol., December 1, 2008; 74(6): 1610 - 1619. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Trujillo, C. Cruz, A. Tovar, V. Vaidya, E. Zambrano, J. V. Bonventre, G. Gamba, N. Torres, and N. A. Bobadilla Renoprotective mechanisms of soy protein intake in the obese Zucker rat Am J Physiol Renal Physiol, November 1, 2008; 295(5): F1574 - F1582. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Korda, R. Kubant, S. Patton, and T. Malinski Leptin-induced endothelial dysfunction in obesity Am J Physiol Heart Circ Physiol, October 1, 2008; 295(4): H1514 - H1521. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. G. Maier Nicotinamide Adenine Dinucleotide Phosphate Oxidase and Diabetes: Vascular Implications Vascular and Endovascular Surgery, August 1, 2008; 42(4): 305 - 313. [Abstract] [PDF] |
||||
![]() |
J. Malyszko, J.S. Malyszko, P. Kozminski, K. Pawlak, and M. Mysliwiec Adipokines, Linking Adipocytes and Vascular Function in Hemodialyzed Patients, May Also Be Possibly Related to CD146, a Novel Adhesion Molecule Clinical and Applied Thrombosis/Hemostasis, July 1, 2008; 14(3): 338 - 345. [Abstract] [PDF] |
||||
![]() |
B. K. Surmi, R. D. Atkinson, M. L. Gruen, K. R. Coenen, and A. H. Hasty The role of macrophage leptin receptor in aortic root lesion formation Am J Physiol Endocrinol Metab, March 1, 2008; 294(3): E488 - E495. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Djurovic, K. E. Berge, B. Birkenes, O. Braaten, and L. Retterstol The effect of red wine on plasma leptin levels and vasoactive factors from adipose tissue: A randomized crossover trial Alcohol Alcohol., November 1, 2007; 42(6): 525 - 528. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Haugen and C. A. Drevon Activation of Nuclear Factor-{kappa}B by High Molecular Weight and Globular Adiponectin Endocrinology, November 1, 2007; 148(11): 5478 - 5486. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. F. Bodary Links Between Adipose Tissue and Thrombosis in the Mouse Arterioscler. Thromb. Vasc. Biol., November 1, 2007; 27(11): 2284 - 2291. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Yang and L. A. Barouch Leptin Signaling and Obesity: Cardiovascular Consequences Circ. Res., September 14, 2007; 101(6): 545 - 559. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. C.H. Kwan, M. A. Murtaugh, and S. Beddhu Associations of Body Size with Metabolic Syndrome and Mortality in Moderate Chronic Kidney Disease Clin. J. Am. Soc. Nephrol., September 1, 2007; 2(5): 992 - 998. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Fantuzzi and T. Mazzone Adipose Tissue and Atherosclerosis: Exploring the Connection Arterioscler. Thromb. Vasc. Biol., May 1, 2007; 27(5): 996 - 1003. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Bellmeyer, J. M. Martino, N. S. Chandel, G. R. Scott Budinger, D. A. Dean, and G. M. Mutlu Leptin Resistance Protects Mice from Hyperoxia-induced Acute Lung Injury Am. J. Respir. Crit. Care Med., March 15, 2007; 175(6): 587 - 594. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Iribarren, G. Husson, A. S. Go, J. C. Lo, J. M. Fair, G. D. Rubin, M. A. Hlatky, and S. P. Fortmann Plasma Leptin Levels and Coronary Artery Calcification in Older Adults J. Clin. Endocrinol. Metab., February 1, 2007; 92(2): 729 - 732. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. A. Johnston, T. A. Theman, R. D. Terry, E. S. Williams, and S. A. Shore Pulmonary responses to acute ozone exposure in fasted mice: effect of leptin administration J Appl Physiol, January 1, 2007; 102(1): 149 - 156. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Cui, F. Cai, and D. D. Belsham Leptin signaling in neurotensin neurons involves STAT, MAP kinases ERK1/2, and p38 through c-Fos and ATF1 FASEB J, December 1, 2006; 20(14): 2654 - 2656. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Ouedraogo, X. Wu, S.-Q. Xu, L. Fuchsel, H. Motoshima, K. Mahadev, K. Hough, R. Scalia, and B. J. Goldstein Adiponectin Suppression of High-Glucose-Induced Reactive Oxygen Species in Vascular Endothelial Cells: Evidence for Involvement of a cAMP Signaling Pathway Diabetes, June 1, 2006; 55(6): 1840 - 1846. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. H. Schindler, J. Cardenas, J. O. Prior, A. D. Facta, M. C. Kreissl, X.-L. Zhang, J. Sayre, M. Dahlbom, J. Licinio, and H. R. Schelbert Relationship Between Increasing Body Weight, Insulin Resistance, Inflammation, Adipocytokine Leptin, and Coronary Circulatory Function J. Am. Coll. Cardiol., March 21, 2006; 47(6): 1188 - 1195. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Dong, X. Zhang, and J. Ren Leptin Regulates Cardiomyocyte Contractile Function Through Endothelin-1 Receptor-NADPH Oxidase Pathway Hypertension, February 1, 2006; 47(2): 222 - 229. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. A. Johnston, T. A. Theman, and S. A. Shore Augmented responses to ozone in obese carboxypeptidase E-deficient mice Am J Physiol Regulatory Integrative Comp Physiol, January 1, 2006; 290(1): R126 - R133. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Lappas, M. Permezel, and G. E. Rice Leptin and Adiponectin Stimulate the Release of Proinflammatory Cytokines and Prostaglandins from Human Placenta and Maternal Adipose Tissue via Nuclear Factor-{kappa}B, Peroxisomal Proliferator-Activated Receptor-{gamma} and Extracellularly Regulated Kinase 1/2 Endocrinology, August 1, 2005; 146(8): 3334 - 3342. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. F. Bodary, S. Gu, Y. Shen, A. H. Hasty, J. M. Buckler, and D. T. Eitzman Recombinant Leptin Promotes Atherosclerosis and Thrombosis in Apolipoprotein E-Deficient Mice Arterioscler. Thromb. Vasc. Biol., August 1, 2005; 25(8): e119 - e122. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Mehebik, A.-M. Jaubert, D. Sabourault, Y. Giudicelli, and C. Ribiere Leptin-induced nitric oxide production in white adipocytes is mediated through PKA and MAP kinase activation Am J Physiol Cell Physiol, August 1, 2005; 289(2): C379 - C387. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Li, J.-C. Mamputu, N. Wiernsperger, and G. Renier Signaling Pathways Involved in Human Vascular Smooth Muscle Cell Proliferation and Matrix Metalloproteinase-2 Expression Induced by Leptin: Inhibitory Effect of Metformin Diabetes, July 1, 2005; 54(7): 2227 - 2234. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. C. W. Lau, B. Dhillon, H. Yan, P. E. Szmitko, and S. Verma Adipokines: molecular links between obesity and atheroslcerosis Am J Physiol Heart Circ Physiol, May 1, 2005; 288(5): H2031 - H2041. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Ferretti, T. Bacchetti, C. Moroni, S. Savino, A. Liuzzi, F. Balzola, and V. Bicchiega Paraoxonase Activity in High-Density Lipoproteins: A Comparison between Healthy and Obese Females J. Clin. Endocrinol. Metab., March 1, 2005; 90(3): 1728 - 1733. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Wolk, P. Berger, R. J. Lennon, E. S. Brilakis, B. D. Johnson, and V. K. Somers Plasma leptin and prognosis in patients with established coronary atherosclerosis J. Am. Coll. Cardiol., November 2, 2004; 44(9): 1819 - 1824. [Abstract] [Full Text] [PDF] |
||||
![]() |
F.-P. Xu, M.-S. Chen, Y.-Z. Wang, Q. Yi, S.-B. Lin, A. F. Chen, and J.-D. Luo Leptin Induces Hypertrophy via Endothelin-1-Reactive Oxygen Species Pathway in Cultured Neonatal Rat Cardiomyocytes Circulation, September 7, 2004; 110(10): 1269 - 1275. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Yu, K. Ohmori, Y. Chen, C. Sato, H. Kiyomoto, K. Shinomiya, H. Takeuchi, K. Mizushige, and M. Kohno Effects of pravastatin on progression of glucose intolerance and cardiovascular remodeling in a type II diabetes model J. Am. Coll. Cardiol., August 18, 2004; 44(4): 904 - 913. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Gomez-Ambrosi, J. Salvador, and G. Fruhbeck Is hyperleptinemia involved in the development of age-related lens opacities? Am. J. Clinical Nutrition, May 1, 2004; 79(5): 888 - 889. [Full Text] [PDF] |
||||
![]() |
A. Taylor Reply to J Gomez-Ambrosi et al Am. J. Clinical Nutrition, May 1, 2004; 79(5): 889 - 889. [Full Text] [PDF] |
||||
![]() |
C. A. Curat, A. Miranville, C. Sengenes, M. Diehl, C. Tonus, R. Busse, and A. Bouloumie From Blood Monocytes to Adipose Tissue-Resident Macrophages: Induction of Diapedesis by Human Mature Adipocytes Diabetes, May 1, 2004; 53(5): 1285 - 1292. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. J. Hukshorn, J. H. N. Lindeman, K. H. Toet, W. H. M. Saris, P. H. C. Eilers, M. S. Westerterp-Plantenga, and T. Kooistra Leptin and the Proinflammatory State Associated with Human Obesity J. Clin. Endocrinol. Metab., April 1, 2004; 89(4): 1773 - 1778. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Cao, K. M. Mak, C. Ren, and C. S. Lieber Leptin Stimulates Tissue Inhibitor of Metalloproteinase-1 in Human Hepatic Stellate Cells: RESPECTIVE ROLES OF THE JAK/STAT AND JAK-MEDIATED H2O2-DEPENDENT MAPK PATHWAYS J. Biol. Chem., February 6, 2004; 279(6): 4292 - 4304. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Rahmouni and W. G. Haynes Leptin and the Cardiovascular System Recent Prog. Horm. Res., January 1, 2004; 59(1): 225 - 244. [Abstract] [Full Text] |
||||
![]() |
N. Werner and G. Nickenig From Fat Fighter to Risk Factor: The Zigzag Trek of Leptin Arterioscler. Thromb. Vasc. Biol., January 1, 2004; 24(1): 7 - 9. [Full Text] [PDF] |
||||
![]() |
M. Onuma, J. D. Bub, T. L. Rummel, and Y. Iwamoto Prostate Cancer Cell-Adipocyte Interaction: LEPTIN MEDIATES ANDROGEN-INDEPENDENT PROSTATE CANCER CELL PROLIFERATION THROUGH c-Jun NH2-TERMINAL KINASE J. Biol. Chem., October 24, 2003; 278(43): 42660 - 42667. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. D. Dobrian, S. D. Schriver, T. Lynch, and R. L. Prewitt Effect of salt on hypertension and oxidative stress in a rat model of diet-induced obesity Am J Physiol Renal Physiol, October 1, 2003; 285(4): F619 - F628. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Shore, Y. M. Rivera-Sanchez, I. N. Schwartzman, and R. A. Johnston Responses to ozone are increased in obese mice J Appl Physiol, September 1, 2003; 95(3): 938 - 945. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Maingrette and G. Renier Leptin Increases Lipoprotein Lipase Secretion by Macrophages: Involvement of Oxidative Stress and Protein Kinase C Diabetes, August 1, 2003; 52(8): 2121 - 2128. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. W. Lee, B. Hennig, and M. Toborek Redox-regulated mechanisms of IL-4-induced MCP-1 expression in human vascular endothelial cells Am J Physiol Heart Circ Physiol, January 1, 2003; 284(1): H185 - H192. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Goetze, A. Bungenstock, C. Czupalla, F. Eilers, P. Stawowy, U. Kintscher, C. Spencer-Hansch, K. Graf, B. Nurnberg, R. E. Law, et al. Leptin Induces Endothelial Cell Migration Through Akt, Which Is Inhibited by PPAR{gamma}-Ligands Hypertension, November 1, 2002; 40(5): 748 - 754. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Davi, M. T. Guagnano, G. Ciabattoni, S. Basili, A. Falco, M. Marinopiccoli, M. Nutini, S. Sensi, and C. Patrono Platelet Activation in Obese Women: Role of Inflammation and Oxidant Stress JAMA, October 23, 2002; 288(16): 2008 - 2014. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Li, P. Junk, A. Huwiler, C. Burkhardt, T. Wallerath, J. Pfeilschifter, and U. Forstermann Dual Effect of Ceramide on Human Endothelial Cells: Induction of Oxidative Stress and Transcriptional Upregulation of Endothelial Nitric Oxide Synthase Circulation, October 22, 2002; 106(17): 2250 - 2256. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Singhal, I. S. Farooqi, T. J. Cole, S. O'Rahilly, M. Fewtrell, M. Kattenhorn, A. Lucas, and J. Deanfield Influence of Leptin on Arterial Distensibility: A Novel Link Between Obesity and Cardiovascular Disease? Circulation, October 8, 2002; 106(15): 1919 - 1924. [Abstract] [Full Text] [PDF] |
||||
![]() |
N.-H. Cho, S.-Y. Seong, M.-S. Huh, N.-H. Kim, M.-s. Choi, and I.-s. Kim Induction of the Gene Encoding Macrophage Chemoattractant Protein 1 by Orientia tsutsugamushi in Human Endothelial Cells Involves Activation of Transcription Factor Activator Protein 1 Infect. Immun., September 1, 2002; 70(9): 4841 - 4850. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. L. Mark and W. I. Sivitz Uncoupling Metabolism and Coupling Leptin to Cardiovascular Disease Arterioscler. Thromb. Vasc. Biol., June 1, 2002; 22(6): 881 - 883. [Full Text] [PDF] |
||||
![]() |
P. Quehenberger, M. Exner, R. Sunder-Plassmann, K. Ruzicka, C. Bieglmayer, G. Endler, C. Muellner, W. Speiser, and O. Wagner Leptin Induces Endothelin-1 in Endothelial Cells In Vitro Circ. Res., April 5, 2002; 90(6): 711 - 718. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Hosoi, Y. Okuma, A. Ono, and Y. Nomura Subdiaphragmatic vagotomy fails to inhibit intravenous leptin-induced IL-1beta expression in the hypothalamus Am J Physiol Regulatory Integrative Comp Physiol, February 1, 2002; 282(2): R627 - R631. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Takekoshi, K. Ishii, T. Nanmoku, S. Shibuya, Y. Kawakami, K. Isobe, and T. Nakai Leptin Stimulates Catecholamine Synthesis in a PKC-Dependent Manner in Cultured Porcine Adrenal Medullary Chromaffin Cells Endocrinology, November 1, 2001; 142(11): 4861 - 4871. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Wang, L. Verna, H.-l. Liao, A. Ballard, Y. Zhu, and M. B. Stemerman Adenovirus-Mediated Overexpression of Dominant-Negative Mutant of c-Jun Prevents Intercellular Adhesion Molecule-1 Induction by LDL: A Critical Role for Activator Protein-1 in Endothelial Activation Arterioscler. Thromb. Vasc. Biol., September 1, 2001; 21(9): 1414 - 1420. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Xu, J. Li, M. Simons, J. Li, R. J. Laham, and F. W. Sellke Expression of vascular endothelial growth factor and its receptors is increased, but microvascular relaxation is impaired in patients after acute myocardial ischemia J. Thorac. Cardiovasc. Surg., April 1, 2001; 121(4): 735 - 742. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Caldefie-Chezet, A. Poulin, A. Tridon, B. Sion, and M-P. Vasson Leptin: a potential regulator of polymorphonuclear neutrophil bactericidal action? J. Leukoc. Biol., March 1, 2001; 69(3): 414 - 418. [Abstract] [Full Text] |
||||
![]() |
G. Fantuzzi and R. Faggioni Leptin in the regulation of immunity, inflammation, and hematopoiesis J. Leukoc. Biol., October 1, 2000; 68(4): 437 - 446. [Abstract] [Full Text] |
||||
![]() |
N. Anim-Nyame, S.R. Sooranna, P.J. Steer, and M.R. Johnson Longitudinal analysis of maternal plasma leptin concentrations during normal pregnancy and pre-eclampsia Hum. Reprod., September 1, 2000; 15(9): 2033 - 2036. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. D. Dobrian, M. J. Davies, R. L. Prewitt, and T. J. Lauterio Development of Hypertension in a Rat Model of Diet-Induced Obesity Hypertension, April 1, 2000; 35(4): 1009 - 1015. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-i. Yamagishi, D. Edelstein, X.-l. Du, Y. Kaneda, M. Guzman, and M. Brownlee Leptin Induces Mitochondrial Superoxide Production and Monocyte Chemoattractant Protein-1 Expression in Aortic Endothelial Cells by Increasing Fatty Acid Oxidation via Protein Kinase A J. Biol. Chem., June 29, 2001; 276(27): 25096 - 25100. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Chen, J. A. Vita, B. C. Berk, and J. F. Keaney Jr. c-Jun N-terminal Kinase Activation by Hydrogen Peroxide in Endothelial Cells Involves Src-dependent Epidermal Growth Factor Receptor Transactivation J. Biol. Chem., May 4, 2001; 276(19): 16045 - 16050. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-P. Liang and A. R. Tall Transcriptional Profiling Reveals Global Defects in Energy Metabolism, Lipoprotein, and Bile Acid Synthesis and Transport with Reversal by Leptin Treatment in Ob/ob Mouse Liver J. Biol. Chem., December 21, 2001; 276(52): 49066 - 49076. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Quehenberger, M. Exner, R. Sunder-Plassmann, K. Ruzicka, C. Bieglmayer, G. Endler, C. Muellner, W. Speiser, and O. Wagner Leptin Induces Endothelin-1 in Endothelial Cells In Vitro Circ. Res., April 5, 2002; 90(6): 711 - 718. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |