FASEB J. Avanti Polar Lipids
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ramos, R. A.
Right arrow Articles by Firestone, G. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ramos, R. A.
Right arrow Articles by Firestone, G. L.
(The FASEB Journal. 1999;13:169-180.)
© 1999 FASEB


Research Communications

Dysfunctional glucocorticoid receptor with a single point mutation ablates the CCAAT/enhancer binding protein-dependent growth suppression response in a steroid-resistant rat hepatoma cell variant

Ross A. Ramosa, William J. Meilandta, Edward C. Wanga and Gary L. Firestonea,1

a Department of Molecular and Cell Biology and The Cancer Research Laboratory, University of California at Berkeley, Berkeley, California 94720, USA


   ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
We used glucocorticoid-resistant and -sensitive hepatoma cell variants to characterize the mechanism of hepatoma cell resistance to the growth inhibitory effects of glucocorticoids. BDS1 hepatoma cells express transcriptionally active glucocorticoid receptors and undergo a stringent G1 cell cycle arrest in response to glucocorticoids that is dependent on the induced expression of the CCAAT/enhancer binding protein {alpha} (C/EBP{alpha}) transcription factor. In contrast, EDR1 hepatoma cells, which express normal levels of glucocorticoid receptors, fail to growth arrest or express C/EBP{alpha} when treated with glucocorticoids. Ectopic expression of wild-type rat glucocorticoid receptors into EDR1 cells restored the growth suppression response, suggesting a defect in the EDR1 receptor. DNA sequence analysis revealed a single point mutation causing a cysteine-to-tyrosine substitution at amino acid position 457 (C457Y-GR) in the zinc finger region of the glucocorticoid receptor that mediates both receptor–DNA and receptor–protein interactions. Glucocorticoid activation of the {alpha}1-acid glycoprotein (AGP) promoter, a liver acute-phase response gene, requires receptor–DNA binding as well as an interaction with C/EBP{alpha}. In contrast to the wild-type glucocorticoid receptor, ectopic expression of C/EBP{alpha} in EDR1 cells, or coexpression of C/EBP{alpha} along with the C457Y-GR into receptor-deficient EDR3 cells was required to partially restore glucocorticoid responsiveness of the AGP promoter by the EDR1 glucocorticoid receptor. Constitutive expression of the wild-type glucocorticoid receptor, but not the C457Y-GR mutant, was sufficient to restore the glucocorticoid growth suppression response to receptor-deficient EDR3 cells. Thus, we have identified a glucocorticoid-resistant hepatoma cell variant with a single point mutation in the zinc finger region of the glucocorticoid receptor gene that ablates the glucocorticoid growth suppression response and attenuates transcriptional activation of the AGP promoter.—Ramos, R. A., Meilandt, W. J., Wang, E. C., Firestone, G. L. Dysfunctional glucocorticoid receptor with a single point mutation ablates the CCAAT/enhancer binding protein-dependent growth suppression response in a steroid-resistant rat hepatoma cell variant. FASEB J. 13, 169–180 (1999)


Key Words: glucocorticoid receptor mutation • C/EBP{alpha}2 • steroid resistance • growth suppression


   INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
NORMAL DEVELOPMENT, differentiation, metabolism, and proliferation of mammalian tissues and cells are stringently regulated by a complex combination of extracellular molecular signals and environmental constraints. These cues initiate or suppress intracellular signaling cascades that result in the activation or repression of gene expression programs that mediate these processes. Steroid hormones are among the key systemic factors that are directly involved in the proliferative control of normal and neoplastically transformed cells. Although tumor cells often proliferate uncontrollably under conditions where nontransformed cells would be quiescent (13), treatment with certain steroid agonists and antagonists can induce a cell cycle arrest or apoptotic response in many tumor cell types (410). Glucocorticoids, one class of steroid hormones, are potent anti-proliferative agents affecting a variety of cell and tissue types, with liver and mammary-derived epithelial cells being particularly sensitive to the growth inhibitory effects of this steroid (1116). Moreover, glucocorticoids are often used clinically to treat certain lymphoproliferative disorders in humans, such as leukemias and lymphomas (17, 18). Several studies characterizing mammary epithelial tumor cells, primary hepatocytes, specific hepatoma cell lines, fibroblasts, certain lymphoid cell lines and osteosarcoma cells have demonstrated that glucocorticoids elicit their anti-proliferative action by inducing a G1 block in cell cycle progression (11, 15, 1921).

Glucocorticoids mediate a wide variety of responses, including anti-proliferative effects, by binding to and potentiating a functional change in their cognate receptors, which results in either stimulated or repressed transcription of steroid regulated genes (2225). The potent effects of steroid receptor signaling on the transcription of primary response genes occur by specific binding of the steroid–receptor complex to DNA transcriptional enhancer elements (2527). Moreover, direct receptor–protein interactions can have a synergistic or antagonistic effect on the action of other transcriptional regulators, such as the AP-1 transcription complex, CCAAT/enhancer binding protein (C/EBP)2 family members, and NF-{kappa}B (25, 2832). Glucocorticoid regulation of tissue-specific gene expression is controlled by the availability of these various transcription factors. For example, glucocorticoids modulate the expression of a variety of genes involved in liver specific functions by combinations of receptor–protein and receptor–DNA interactions (3335). At the biochemical level, the distinct glucocorticoid receptor domains that specify receptor–DNA and receptor–protein interactions that mediate its transcriptional activity are well defined (22, 3638). However, the specific domains within the glucocorticoid receptor regulating biological responses to steroids, such as cell cycle progression, are not well characterized.

Glucocorticoid-sensitive and -resistant cell lines have been established from a variety of animal and human tumors. We have isolated distinct classes of rat hepatoma cell variants from rat Reuber hepatoma-derived cells (39) to determine the potential mechanisms of hepatoma cell resistance to the growth inhibitory effects of glucocorticoids. These variants express similar levels of glucocorticoid receptors and bind glucocorticoids with the same affinity, but are distinguished because they either undergo a stringent G1 phase cell cycle arrest or fail to growth arrest and continuously progress through the cell cycle upon glucocorticoid treatment (15, 19). For example, rat BDS1 hepatoma cells arrest in G1 within one cell doubling time and with the concomitant induction of anti-proliferative genes, such as C/EBP{alpha} and p21cip1/waf1 (15, 19, 40). In contrast, EDR1 cells fail to growth arrest and do not express either C/EBP{alpha} or p21cip1/waf1 in response to glucocorticoids (19, 39, 40). We have been using these hepatoma cell growth variants to determine the mechanism of glucocorticoid resistance in liver-derived cells. In this study, we have identified a single point mutation in the zinc finger region of the glucocorticoid receptor gene in glucocorticoid-resistant rat EDR1 hepatoma cells, which produce a dysfunctional receptor disrupting both the glucocorticoid growth suppression response and the transcriptional activation of a liver-specific gene.


   MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Materials
BioWhittaker (Walkersville, Md.) supplied Dulbecco's modified Eagle (DME)F12 (1:1) medium, fetal bovine serum (FBS), calcium- and magnesium-free phosphate-buffered saline (PBS), and trypsin-EDTA. Dexamethasone and propidium iodide were obtained from Sigma Chemical Co. (St. Louis, Mo.). [3H]Thymidine (84 Ci/mmol), [3H]acetyl-CoA (200 mCi/mmol), Sequetide containing [{alpha}-35S]dATP (1000–1500 Ci/mmol), and Renaissance-enhanced luminol reagents were obtained from DuPont NEN products (Boston, Mass.). DNA sequencing was performed with Sequenase 2.0 (U.S. Biochemical, Cleveland, Ohio). Avian myeloblastosis virus-reverse transcriptase (AMV-RT) and Taq DNA polymerase was purchased from Boehringer Mannheim (Indianapolis, Ind.). DNA fragments were purified with the Qiaex DNA purification kit (Qiagen; Chatsworth, Calif.). The PCR cloning vector, pGEM-T, was purchased from Promega (Madison, Wis.). Recombinant Pfu DNA polymerase was purchased from Stratagene (La Jolla, Calif.). Geneticin (G418) was purchased from Gibco-BRL (Grand Island, N.Y.). All oligonucleotide primers used for sequencing, mutagenesis, and cloning were obtained from the Microchemical Facility (Cancer Research Laboratory, University of California at Berkeley). The constitutive rat glucocorticoid receptor expression vector p6RGR (glucocorticoid receptor) and chimeric pGRE-CAT (glucocorticoid response element-chloramphenicol acetyl transferase) reporter plasmid containing six glucocorticoid response elements linked to the CAT reporter gene were a generous gift from Dr. Keith R. Yamamoto (Department of Biochemistry and Biophysics, University of California at San Francisco). Dr. Heinz Baumann (Department of Molecular and Cellular Biology, Roswell Park Cancer Institute, Buffalo, N.Y.) generously provided the chimeric {alpha}1-acid glycoprotein (AGP) promoter CAT reporter plasmid pAGP3x(GRE)CAT and the C/EBP{alpha} eukaryotic expression vector (pCD-mC/EBP). All other reagents were of highest available purity.

Hepatoma cell lines and methods of culture
Glucocorticoid-sensitive BDS1 cells and glucocorticoid-resistant, receptor-positive EDR1 and receptor-negative EDR3 cells are epithelial tumor cells derived from the rat Reuber hepatoma (39). EDR1 cells were infected with a replication defective recombinant retrovirus to generate the stable E1G cell line that expresses the wild-type glucocorticoid receptor, as well as the neomycin resistance gene, which confers resistance to cytotoxic concentrations of G418. Cell lines were routinely grown in DME/F-12/10% FBS at 37°C in humidified air containing 5% CO2. E1G cells were maintained in medium supplemented with 400 µg/ml G418. Cell culture medium was routinely changed every 48 h. Dexamethasone was added to a final concentration of 1 µM as indicated.

Transfection procedures
Logarithmically growing hepatoma cells were transfected by electroporation as described previously (19). Briefly, single-cell suspensions were washed twice with sterile PBS, resuspended in electroporation buffer, and dispensed into sterile cuvettes. In all transfection experiments, the cells and 30 µg of expression vector DNA were gently mixed, electrically pulsed five times using a BTX 800 Transfector apparatus (BTX Inc., San Diego, Calif.), and incubated on ice for 10 min. Transfected cells were plated into prewarmed DME/F12/10% FBS in 100 mm tissue culture dishes and propagated at 37°C. Twenty-four hours after transfection, cells were washed twice with PBS. For reporter gene assays, cells were refed with fresh medium with or without 1 µM dexamethasone and harvested after 48 h. For the growth suppression assays, cells were refed with medium supplemented with 400 µg/ml G418. To assess glucocorticoid receptor function, glucocorticoid receptor-deficient EDR3 cells hepatoma cells were cotransfected with 10 µg of pAGP(3xGRE)-CAT, either with or without 5 µg of the C/EBP{alpha} expression vector pCD-mC/EBP, and 10 µg of the wild-type or mutant glucocorticoid expression vectors p6RGR and pC457T-GR. To analyze the effect of the point mutant glucocorticoid receptor on the glucocorticoid growth suppression response, EDR3 cells were stably cotransfected with 30 µg of either wild-type (p6RGR) or mutant (pC457T-GR) glucocorticoid receptor expression vectors and 3 µg of a neomycin resistance expression vector. Medium was changed every 24 h and transfectants were selected for 2 wk in 800 µg/ml G418. Equivalent numbers (103) of single-cell suspensions were replated on 100 mm tissue culture plates and cultured for 2 wk. Plates were washed three times in PBS and stained with crystal violet/formalin, as described previously (19). Cell foci greater than or equal to 1 mm were counted by direct visualization.

Reporter gene assays
Cells were harvested by washing twice in PBS, resuspended in buffer, and lysed by freeze thawing. Cell lysates were heated at 68°C for 15 min, centrifuged at 1.2 x 104 x g for 10 min, and the supernatant fractions were recovered. CAT activity in the cell extracts containing 20–50 µg of lysate protein was measured by a quantitative nonchromatographic assay (19). The enzyme assay was conducted in a Tris buffer containing aqueous chloramphenicol and [3H]acetyl coenzyme A in a final reaction volume of 250 µl. The reaction mixture was gently overlaid with Econofluor water immiscible scintillation fluorochrome (DuPont NEN). Reaction mixtures were incubated at 37°C for 3–8 h. Cells transfected with the neomycin resistance expression vector were used to establish basal level activity. CAT activity was monitored by direct measurement of radioactivity by way of liquid scintillation counting. Measurements of CAT activity were in the linear range of the assay as determined by a standard curve using bacterial CAT enzyme (0.01 units; Pharmacia, Uppsala, Sweden) as a positive control for CAT enzymatic activity. The enzyme activity was expressed as relative fold induction (as a function of [3H]acetylated chloramphenicol produced per microgram of protein present in corresponding cell lysates) by comparing induced levels of CAT activity with uninduced basal levels.

Assay of DNA synthesis by [3H]thymidine incorporation
Triplicate samples of asynchronously growing hepatoma cells were treated for the times indicated with dexamethasone, pulsed radiolabeled for 3 h with 6 gmCi [3H]thymidine (84 Ci/mmol), washed three times with ice-cold 10% trichloroacetic acid, and lysed with 300 gml 0.3 N NaOH. Lysates (100 µl) were transferred directly into vials containing liquid scintillation cocktail; radioactivity was quantitated by scintillation counting.

Reverse transcription and DNA sequencing of wild-type and mutant glucocorticoid receptor cDNAs
Total RNA was extracted by sodium dodecyl sulfate-acid phenol/chloroform extraction. Approximately 5 µg of total RNA from glucocorticoid growth-suppressible BDS1 and resistant EDR1 hepatoma cells was denatured by heating to 65°C for 5 min and subsequently reverse transcribed with 15 units of AMV-RT in 50 mM Tris-Cl pH 8.5, 0.8 mM MgCl2, 30 mM KCl, 1 mM dithiothreitol (DTT), 1 mM dNTPs, and 0.6 µg of random hexamers for 1 h at 42°C. Various regions of the glucocorticoid receptor gene were amplified by the polymerase chain reaction (PCR) as follows. Reverse transcription reactions were mixed with 50 pmol of glucocorticoid receptor-specific forward and reverse primers, 125 µM of nucleotide (dATP, dCTP, dGTP, dTTP), and 5 units of Taq DNA polymerase in 10 mM Tris-Cl pH 8.3, 50 mM KCl, 1.5 mM MgCl2 in a total reaction volume of 100 µl, and layered with 50 µl of mineral oil. The cDNAs were heated to 94°C for 5 min to denature RNA:cDNA hybrids and amplified for 30 cycles (denaturing at 94°C, 1 min, annealing at 55°C, 1 min, and extension at 72°C, 1 min). The specific primers used for PCR and sequencing were 5' primers: 5'nucl43–71for: 'CCCCG-GGCTCACATTAATATTTGCCAATG3'; 5'nucl673–692for: 5'TGAAATTGTATCCCACAGAC3'; primer pair #1: 5'nucl-1336–1355for: 5'GCTCTCCTCCATCCAGCTCG3'; 3'nucl-1620–1639rev: 'GCAGTGGCTTGCTGAATCCC3'; primer pair #2: 5'nucl378–397for: 'TCACTGTCCATGGGGCTGTA3'; 3'nucl-1630–1649rev: 'GAGACTCCTGCAGTGGCTTG3'; 3' primer: 3'nucl2450–2469rev: 5'CTTAGTAAGGCAGTCATTTTTG3'. PCR products were electrophoretically fractionated in 1.5% agarose/1x TAE (40 mM Tris-acetate, 1 mM EDTA). DNA was stained with ethidium bromide and visualized on an UV transilluminator. DNA fragments of the predicted mobility were excised from the gel and purified with the Qiaex DNA purification kit per manufacturer's recommendations. The purified DNA fragments were cloned into the PCR cloning vector, pGEM-T (Promega), by ligation with the Takara DNA ligation kit (Panvera, Madison, Wis.). Competent NovaBlue Escherichia coli (NovaGen, Madison, Wis.) were transformed by adding 2 µl of the ligation reaction to 20 µl of bacteria and incubating on ice for 30 min. The bacteria were heat-shocked for 45 s at 42°C and chilled on ice for 2 min. SOC broth (100 µl) was added to the transformed bacteria and the cultures were incubated for 1 h at 37°C with vigorous shaking. Cultures were streaked onto LB-ampicillin (100 µg/ml)-XGal (40 µg/ml)-100 µM IPTG plates and incubated (inverted) overnight at 37°C. White colonies were selected and grown overnight in LB-amp. DNA was prepared and positive clones were identified by restriction analysis.

DNA sequencing of double-stranded plasmid DNA by dideoxy chain termination (41) was performed using the Sequenase version 2.0 sequencing kit 35Sequetide, containing [{alpha}-35S]dATP, nonradiolabeled dCTP, dGTP, dTTP, and a set of synthetic oligonucleotide sequencing primers. Samples were electrophoretically separated on a 6% polyacrylamide gel, then dried and exposed to autoradiography film.

PCR mutagenesis of a rat glucocorticoid receptor expression vector
The glucocorticoid receptor expression vector p6RGR was used as template DNA for PCR-mediated site-directed mutagenesis as follows. A 1070 basepair 5' fragment and a 224 basepair 3' fragment of the glucocorticoid receptor DNA binding domain were amplified in separate reactions from 5 ng of p6RGR in 83 µM of nucleotide (dATP, dCTP, dGTP, dTTP), 50 pmol of each primer, and 2.5 units of recombinant Pfu DNA polymerase in 20 mM Tris-Cl, pH 8.75, 10 mM KCl, 10 mM (NH4)2SO4, 2 mM MgSO4, 0.1% Triton X-100, 100 µg/ml BSA in a total reaction volume of 100 µl and layered with 50 µl of mineral oil. The template was amplified for 30 cycles (denaturing at 95°C, 1 min, annealing at 55°C, 1 min, and extension at 75°C, 1 min). The specific primers used for PCR mutagenesis were 5' DNA binding domain fragment: 5'nucl378–397for: 5'TCACTGTCCATGGGGCTGTA3'; 3'C457Yrev: 5'GTGCTGACAT_ATGGAAGCTG3'; 3' DNA binding domain fragment: 5'C457Yfor: 5'CAGCTTCCA_TATGTCAGCAC3'; 3' nucl1630–1649rev: 5'GAGACTCCTGCAGTGGCTTG3'. The nucleotide generating the mutant receptor is underlined in the primer sequences listed above.

PCR products were resolved in 2.5% agarose/1x TAE gels, visualized on a UV transilluminator, and excised and purified from the gel into 40 µl H2O with Qiaex gel extraction reagents according to the manufacturer's recommendations. One-tenth of a volume from each purified PCR product was mixed together to serve as template:primers for PCR generation of a full-length DNA binding domain fragment. The reaction mixture contained 83 µM of nucleotide (dATP, dCTP, dGTP, dTTP) and 2.5 units of recombinant Pfu DNA polymerase in 20 mM Tris-Cl pH 8.75, 10 mM KCl, 10 mM (NH4)2SO4, 2 mM MgSO4, 0.1% Triton X-100, 100 µg/ml BSA in a total reaction volume of 100 µl, and was layered with 50 µl of mineral oil. The template:primer was denatured at 95°C for 5 min and amplified for 10 cycles (1 cycle is denaturing at 95°C, 2 min, annealing at 50°C, 2 min, and extension at 75°C, 1 min). Fifty picomoles of 5'nucl378–397for and 3'nucl1630–1649rev primers were added to the mixture and the product was amplified for 30 cycles (1 cycle is denaturing at 95°C, 1 min, annealing at 50°C, 1 min, and extension at 75°C, 1 min). The mineral oil overlay was extracted with chloroform and the reaction products were precipitated by addition of NaOAc to 0.3 M and two volumes of ice-cold 100% EtOH. The product was pelleted by centrifugation, air-dried, and resuspended in H2O. The PCR product was digested with Nco I and Pst I restriction endonucleases, resolved in 2.5% agarose/1x TAE gels, visualized on a UV transilluminator, and excised and purified from the gel into 40 µl H2O with Qiaex gel extraction reagents. The resulting DNA fragments were subcloned into purified p6RGR previously digested with Nco I and Pst I to generate a full-length glucocorticoid receptor expression vector. NovaBlue competent E. coli were transformed with plasmid DNA, streaked onto LB-amp (100 µg/ml) plates, and incubated (inverted) at 37°C overnight. Individual colonies were miniscreened by digestion with Nde I because the oligonucleotides used to create the mutation within the zinc finger region generate a unique Nde I site. One clone was expanded; DNA was extracted and sequenced by standard procedures using the Sequenase version 2.0 kit (USB; Cleveland, Ohio).


   RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Ectopic expression of a wild-type glucocorticoid receptor gene partially rescues the glucocorticoid growth suppression phenotype in EDR1 hepatoma cells
EDR1 cells, which were initially isolated by their resistance to the glucocorticoid growth suppression response, express normal levels of glucocorticoid receptors. To determine whether a glucocorticoid receptor defect was responsible for this phenotype, a wild-type rat glucocorticoid receptor expression vector was introduced into EDR1 cells by retroviral-mediated gene transfer, generating the stable E1G cell line (39). DNA synthesis was quantitated by monitoring the incorporation of [3H]thymidine in cells treated with or without the synthetic glucocorticoid, dexamethasone; the percent of growth suppression was determined at the times indicated. As shown in the top panel of Fig. 1, expression of the wild-type glucocorticoid receptor gene partially restored the growth suppression response in E1G cells when compared to EDR1 cells. By 48 h in dexamethasone, the E1G cell population displayed a 45% growth arrest, whereas less than 1% of the glucocorticoid-resistant EDR1 cells growth arrested and continued to incorporate [3H]thymidine throughout the 48 h of dexamethasone treatment. The glucocorticoid-sensitive BDS1 hepatoma cells were 95% growth arrested after 48 h treatment with dexamethasone, thus representing a positive control for the glucocorticoid growth suppression response, whereas proliferation of the glucocorticoid receptor-deficient EDR3 hepatoma cells was unaffected by glucocorticoids ( Fig. 1, lower panel). Together, these data indicated that EDR1 hepatoma cells are resistant to dexamethasone in part because of a defect in the glucocorticoid receptor gene.



View larger version (22K):
[in this window]
[in a new window]
 
Figure 1. Partial rescue of the glucocorticoid growth suppression response in a glucocorticoid receptor-defective EDR1 hepatoma cell variant. A wild-type glucocorticoid receptor expression vector was introduced into glucocorticoid growth-resistant EDR1 cells by retroviral-mediated gene transfer to generate E1G cells (39). Parental EDR1 cells and E1G cells were treated for the times indicated with 1 µM dexamethasone and assayed for DNA synthesis by quantitating the incorporation of [3H]thymidine (top panel). Parallel cultures of glucocorticoid-sensitive BDS1 and glucocorticoid receptor-deficient EDR3 cells were treated for the times indicated with 1 µM dexamethasone, assayed for DNA synthesis by quantitating the incorporation of [3H]thymidine (lower panel), and served as positive and negative controls, respectively, for the glucocorticoid growth suppression response. The percentage of growth suppression is determined by comparison with untreated cells at each time point.

EDR1 cells express mutant glucocorticoid receptors due to a single point mutation within the first zinc finger of the DNA binding domain
It has been shown by others that decreased levels of glucocorticoid receptor gene expression, mutation in the ligand binding domain, and nuclear translocation signal mutation can account for the loss of glucocorticoid responsiveness (4247). However, the zinc finger region mediates the transcriptional activity of the glucocorticoid receptor, which mediates both receptor–DNA interactions and receptor–protein interactions that induce or repress the expression of glucocorticoid regulated genes. EDR1 cells express wild-type levels of glucocorticoid receptors and bind wild-type levels of glucocorticoid (39), but are defective in the ability to transactivate certain liver-specific genes such as C/EBP{alpha} and AGP, suggesting that the EDR1 glucocorticoid receptor gene has sustained one or more mutations in the zinc finger region. To directly test this notion, DNA sequence analysis was performed on full-length cDNA clones generated by conventional cloning techniques from the total RNA (PCR amplified, reverse transcribed) of glucocorticoid-sensitive BDS1 and the glucocorticoid-resistant EDR1 hepatoma cells. Sequence analysis revealed a single point mutation resulting in a single G-to-A nucleotide substitution in the glucocorticoid receptor gene of EDR1 cells in 80% of independent molecular clones ( Fig. 2, arrow). The origin of the 20% wild-type sequences obtained is not known. It is possible that allelic expression may have resulted in the generation of these wild-type clones. Alternatively, but less likely, Taq polymerase infidelity may have generated these wild-type clones. This single G-to-A nucleotide substitution in 80% of the molecular clones resulted in a cysteine-to-tyrosine substitution at amino acid 457, forming a mutant glucocorticoid receptor denoted as C457Y-GR. Amino acid 457 is the third zinc chelating cysteine in the first zinc finger and is critical for both receptor–DNA binding as well as receptor–protein interactions (23, 26, 27).



View larger version (30K):
[in this window]
[in a new window]
 
Figure 2. DNA sequence comparison of the first zinc finger region of the glucocorticoid receptor in glucocorticoid growth-suppressible BDS1 and resistant EDR1 hepatoma cell variants. Glucocorticoid receptor cDNAs were generated by reverse transcription of total RNA from glucocorticoid growth-suppressible BDS1 cells and growth-resistant EDR1 cells. The cDNAs were gel purified and cloned into a sequencing vector and subsequently subjected to DNA sequence by the dideoxy chain termination method (41). The upper portion of the figure shows the mutation, as indicated by the arrow, that causes a cysteine-to-tyrosine substitution at amino acid residue 457 in the EDR1 glucocorticoid receptor. The lower portion of the figure illustrates the cysteine-to-tyrosine substitution at amino acid residue 457 in the context of the first zinc finger of the rat glucocorticoid receptor.

Glucocorticoid-resistant EDR1 cells are defective in the activation of the AGP promoter
We have previously shown that the glucocorticoid stimulated expression of C/EBP{alpha} is a necessary event in the glucocorticoid-induced G1 cell cycle arrest of rat hepatoma cells (19). Glucocorticoid activation of the AGP promoter, a liver acute-phase response gene, requires receptor–DNA binding as well as an interaction with C/EBP{alpha} (48), and thus provides a target gene mechanistically linked to the growth suppression response to further investigate the functional defects in the EDR1 glucocorticoid receptor. To test the glucocorticoid regulated transcriptional activation of the AGP promoter, glucocorticoid-resistant EDR1 cells and glucocorticoid-sensitive BDS1 cells were cotransfected with an AGP promoter CAT reporter plasmid, pAGP(3xGRE)-CAT, with or without a C/EBP{alpha} expression vector. In glucocorticoid-sensitive BDS1 cells, AGP promoter activity was induced approximately twofold by dexamethasone treatment, whereas transient transfection of a C/EBP{alpha} expression vector increased the basal AGP promoter activity in BDS1 cells by approximately twofold ( Fig. 3, top panels). Dexamethasone stimulated AGP promoter activity approximately 10-fold in BDS1 cells cotransfected with the C/EBP{alpha} expression vector ( Fig. 3, top panel), which shows the synergistic relationship between glucocorticoid receptor activation and the C/EBP{alpha} transcription factor in these glucocorticoid-sensitive hepatoma cells. In contrast, dexamethasone failed to induce AGP promoter activity in the glucocorticoid-resistant EDR1 cells, even though a reporter plasmid containing six glucocorticoid regulated elements (pGRE-CAT) was dexamethasone responsive ( Fig. 3, middle panel). C/EBP{alpha} is not stimulated by dexamethasone in glucocorticoid-resistant EDR1 cells (19, 40). Transient transfection of EDR1 cells with the C/EBP{alpha} expression vector was sufficient to restore wild-type levels of basal AGP promoter activity as well as partially restore the glucocorticoid induction of the AGP promoter in EDR1 cells ( Fig. 3, middle panel). As expected, dexamethasone failed to stimulate either AGP promoter activity, with or without coexpressed C/EBP{alpha}, or the pGRE-CAT plasmid in the glucocorticoid receptor-deficient EDR3 hepatoma cells ( Fig. 3, lower panel). Transfection of all three cells lines with a constitutive reporter plasmid, pRSV-CAT, displayed similar levels of CAT activity (data not shown), indicating that these three cell lines transfect with approximately the same efficiency. Together, these data implicate the C457Y point mutation in the abrogation of hormonal transactivation of a liver-specific promoter by the EDR1 glucocorticoid receptor.



View larger version (28K):
[in this window]
[in a new window]
 
Figure 3. Partial rescue of the glucocorticoid-regulated {alpha}1-acid glycoprotein (AGP) promoter activity by ectopic expression of C/EBP in glucocorticoid receptor-defective EDR1 cells. Glucocorticoid-resistant EDR1 cells were transiently cotransfected with the glucocorticoid and C/EBP{alpha}-responsive pAGP3X(GRE)-CAT promoter linked to the CAT reporter gene and either the pCD-mC/EBP expression vector for C/EBP{alpha} or the pCD vector control (middle panel; left side). Glucocorticoid-sensitive BDS1 and receptor-deficient EDR3 hepatoma cells were similarly transfected and served as positive and negative controls (upper and lower panels; left side, respectively) for AGP promoter activation by dexamethasone and C/EBP{alpha}. Parallel sets of hepatoma cells were transfected with the pGRE-CAT reporter plasmid to monitor general glucocorticoid responsiveness (upper, middle, and lower panels; right side). Transfected cells were treated with 1 µM dexamethasone for 48 h and assayed for CAT activity by a quantitative assay. The results are the average of three experiments performed in duplicate, and error bars represent the standard error.

The C457Y mutation is sufficient to ablate glucocorticoid receptor-mediated transcriptional activation of the AGP promoter
To demonstrate that the impaired regulation of the AGP promoter in EDR1 cells is due to the C457Y point mutation in the glucocorticoid receptor, PCR mutagenesis was employed to introduce a single point mutation corresponding to a cysteine-to-tyrosine substitution at amino acid 457 in the wild-type rat glucocorticoid receptor gene. Constitutive expression vectors for this altered receptor gene (denoted C457Y-GR) and for the wild-type glucocorticoid receptor gene were constructed and transiently cotransfected into the glucocorticoid receptor-deficient EDR3 cells along with the AGP promoter reporter plasmid. Reporter activity was monitored in dexamethasone-treated and untreated cells. Dexamethasone stimulated AGP promoter activity by greater than twofold in EDR3 cells transfected with the wild-type glucocorticoid receptor expression vector ( Fig. 4, wtGR). However, glucocorticoids failed to induce AGP promoter activity in EDR3 cells transiently transfected with the mutant glucocorticoid receptor expression vector (C457Y-GR). The dexamethasone stimulation of AGP promoter activity was indistinguishable in cells cotransfected with a C/EBP{alpha} expression vector with either the wild-type (wtGR) or mutant glucocorticoid receptor C457Y-GR ( Fig. 4). Transfection of the constitutive C/EBP{alpha} expression vector without either receptor gene increased basal AGP promoter activity and was not responsive to glucocorticoids. Glucocorticoid treatment of control BDS1 cells transfected with the AGP promoter resulted in a four- to eightfold induction. Discrepancies between the results in Figs. 3 and 4are not known. It is conceivable that this variance may be due to transfection efficiency from experiment to experiment and may be affected by cell density or cell passage number at the time of transfection. Alternatively, cell density at the time of transfection or harvest may affect promoter activity. But we observed a consistent trend. Together, these data suggest that the C457Y amino acid substitution impairs receptor–DNA interactions, but not receptor–protein interactions.



View larger version (39K):
[in this window]
[in a new window]
 
Figure 4. Ectopic expression of C/EBP{alpha} rescues the defective activation of the AGP promoter by the C457Y mutant glucocorticoid receptor in receptor-deficient EDR3 cells. EDR3 cells were transfected with combinations of vectors that express the wild-type or mutant glucocorticoid receptors (C457Y-GR) as well as C/EBP{alpha} (left panel). Cells were treated for 48 h with or without 1 µM dexamethasone, as indicated. Cells were harvested and assayed for CAT activity by a quantitative assay. The results are the average of two experiments performed in triplicate, and error bars represent the standard error. BDS1 (right panel) and EDR3 cells (left panel, first two bars) transfected with an empty expression vector; the AGP promoter reporter plasmid served as positive and negative controls for glucocorticoid responsiveness, respectively.

The C457Y receptor point mutation accounts for the loss of the glucocorticoid-mediated growth suppression response in EDR1 cells
To test whether the C457Y receptor point mutation observed in EDR1 cells accounts for its resistance to glucocorticoid growth suppression, glucocorticoid receptor-deficient EDR3 cells were stably cotransfected with either the wild-type or mutant glucocorticoid receptor expression vector and a neomycin resistance gene that confers G418 resistance to positively transfected cells. After selection of positively transfected cells for 2 wk in G418, equivalent numbers of cells were replated and treated with or without dexamethasone. As positive controls for the growth suppression response and for the transfection procedure, glucocorticoid-sensitive BDS1 hepatoma cells and glucocorticoid receptor-deficient EDR3 cells were transfected with only the neomycin resistance gene and an empty expression vector. When cell foci approached 1 mm in diameter, foci were fixed and stained with crystal violet/formalin and counted. Significantly fewer (mean=27) foci grew on dexamethasone-treated cultures of EDR3 cells transfected with the wild-type glucocorticoid receptor expression vector compared to cells not treated with steroid (mean=109) ( Fig. 5, upper panel). In contrast, glucocorticoids were unable to suppress the growth of EDR3 cells transfected with the C457Y-GR expression vector. As shown in Fig. 5(upper panel), similar numbers of cell foci were observed in dexamethasone-treated and -untreated EDR3 cells transfected with the mutant glucocorticoid receptor expression vector (mean=97 and 91, respectively). As expected, significantly fewer foci were observed on cultures of glucocorticoid-sensitive BDS1 cells treated with dexamethasone compared to untreated cultures of BDS1 cells or to glucocorticoid-treated or untreated EDR3 cells ( Fig. 5, lower panel). These data collectively identify a single point mutation at amino acid residue 457 in the glucocorticoid receptor that ablates its transactivation potential of a liver-specific gene promoter as well as the glucocorticoid growth suppression response in rat hepatoma cells.



View larger version (69K):
[in this window]
[in a new window]
 
Figure 5. Failure of the EDR1 mutant glucocorticoid receptor to confer the glucocorticoid growth suppression response to glucocorticoid receptor-deficient EDR3 hepatoma cells. EDR3 cells were cotransfected with either the wild-type (wtGR) or mutant (C457Y-GR) glucocorticoid receptor expression vector (upper panel) and a neomycin resistance expression vector conferring resistance to cytotoxic doses of G418. G418-resistant cells were selected for 2 wk, and equivalent numbers of cells were replated in the presence or absence of 1 µM dexamethasone. Cultures were propagated for 2 wk and subsequently stained with crystal violet. Cell foci greater than or equal to 1 mm were counted and graphically represented. The numbers of foci are an average of three plates from two separate experiments per cell line; error bars represent the standard error. BDS1 and EDR3 cells transfected with the neomycin resistance expression vector (lower panel) served as positive and negative controls, respectively, for the glucocorticoid growth suppression response.


   DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Glucocorticoids have potent anti-proliferative effects in a variety of normal and transformed liver cells and cultured cell lines derived from humans and rodents (12, 14, 49). We have previously established that glucocorticoids induce a transcriptional cascade that ultimately results in a G1 cell cycle arrest of minimal deviation rat hepatoma cells. Upon glucocorticoid treatment of glucocorticoid-sensitive rat BDS1 hepatoma cells, expression of C/EBP{alpha} transcription factor is rapidly induced (19). Subsequently, C/EBP{alpha} targets the promoters and stimulates expression of the p21waf1/cip1 cyclin-dependent kinase inhibitor gene and the AGP acute-phase response gene (19, 40). The glucocorticoid signaling pathway that leads to a G1 cell cycle arrest is complex because the ligand-bound glucocorticoid receptor must induce the expression of C/EBP{alpha} and then physically associate with this transcription factor. One approach to understanding the glucocorticoid receptor signaling pathway that mediates the growth arrest of rat hepatoma cells has been to compare the functional characteristics of glucocorticoids receptors that are expressed in glucocorticoid-sensitive and -resistant cell variants. Glucocorticoid-resistant EDR1 hepatoma cells were originally selected for their inability to be growth suppressed by glucocorticoids (39). Glucocorticoids fail to induce the expression of C/EBP{alpha} or p21waf1/cip1 in EDR1 cells, resulting in disruption of the growth suppression cascade (19, 40). It was reported earlier that introduction of a wild-type glucocorticoid receptor expression vector by retroviral-mediated gene transfer to generate the stable E1G cell line results in wild-type levels of glucocorticoid-induced AGP expression (39), suggesting that E1G cells produce near wild-type levels of functional glucocorticoid receptors. In this study, we observed that the glucocorticoid-resistant phenotype of EDR1 cells can be made glucocorticoid sensitive by ectopic expression of wild-type rat glucocorticoid receptors, resulting in a partial rescue of the glucocorticoid growth suppression response, which suggests that a defect in the glucocorticoid receptor accounts for the phenotype of this hepatoma cell variant. It is conceivable that only a partial rescue of the glucocorticoid growth suppression response was observed in E1G cells because transcriptional cascades involved in this response are not fully active to mutant receptor interference upon dimerization with ectopically expressed wild-type receptors.

The glucocorticoid receptor is comprised of several functional domains, which are responsible for nuclear translocation, association with heat shock protein and the basal transcriptional machinery, receptor dimerization, transactivation, ligand binding, and DNA binding (22, 26). The glucocorticoid receptor contains two zinc finger regions that selectively recognize glucocorticoid-responsive elements in the promoters of glucocorticoid regulated genes, as well as physically interact with specific transcription factors required for the transcriptional activation of the promoter. We discovered that the natural hepatoma cell variant EDR1 expresses a dysfunctional glucocorticoid receptor with a single point mutation that causes a cysteine-to-tyrosine substitution at amino acid residue 457. This mutation occurs at a critical amino acid in the zinc finger region of the receptor, which mediates both receptor–DNA and receptor–protein interactions. Our functional characterization of this mutant receptor revealed that both the growth suppression response and the transcriptional activation of the AGP promoter and a simple GRE in this hepatoma cell variant were ablated. The glucocorticoid-induced transcriptional activation of the AGP promoter could be recovered by ectopic expression of C/EBP{alpha} in EDR1 cells or EDR3 cells cotransfected with the C457Y mutant glucocorticoid receptor, suggesting that this amino acid substitution disrupts receptor–DNA interactions, but not receptor–protein interactions, although we have no direct evidence for the loss of DNA binding activity. Moreover, with the recent advances in receptor signaling pathways, it is conceivable that the C457Y mutant glucocorticoid receptor may be unable to induce a simple GRE because of a possible disruption in receptor–coactivator interactions. Consistent with our observations, a cysteine-to-glycine substitution at the analogous cysteine residue in the human glucocorticoid receptor ablated both glucocorticoid-induced transactivation of a GRE reporter plasmid in CV-1 cells and in vitro DNA binding of a consensus GRE (50). Similarly, others have shown that mutation of this cysteine residue in the glucocorticoid receptor disrupted transactivation of a consensus GRE and DNA binding of a consensus GRE (50, 51). However, in contrast to these in vitro results, ectopic expression of C/EBP{alpha} rescued the glucocorticoid responsiveness of the AGP promoter by the C457Y mutant glucocorticoid receptor expressed in EDR1 cells, implying that receptor–protein interactions remain functional. More recently, it was shown that a glucocorticoid receptor with a single point mutation near the carboxyl terminus of the zinc finger region and devoid of the ligand binding domain still retained partial transcriptional activity, presumably through protein–protein interactions and not DNA binding of glucocorticoid-responsive elements in a glucocorticoid-regulated promoter (52). Furthermore, it has been shown that transgenic mice that are homozygous for the murine glucocorticoid receptor containing a zinc finger mutation are viable. This mutant receptor is unable to bind DNA, yet still retains transcriptional activity via receptor–protein interactions.

We previously identified a specific impairment in the glucocorticoid transcriptional activation of AGP gene expression that correlated with the loss of the glucocorticoid growth suppression response (19, 39). Because the glucocorticoid receptor regulates gene expression by receptor–protein interactions as well as receptor–DNA interactions, it is possible that a factor necessary to control the glucocorticoid growth suppression response in BDS1 cells is unavailable for the cooperative regulation of glucocorticoid-induced AGP gene expression in EDR1 cells. Recently, we found that glucocorticoids induce the expression of C/EBP{alpha}, which is required for maximal glucocorticoid induction of AGP gene expression in glucocorticoid growth-suppressible rat BDS1 hepatoma cells (19). We also demonstrated that ectopic expression of the C/EBP{alpha} transcription factor caused a G1 cell cycle arrest of BDS1 hepatoma cells in the absence of glucocorticoids, whereas ablation of C/EBP{alpha} expression resulted in the loss of glucocorticoid growth suppression (19). However, glucocorticoids failed to induce the synthesis of C/EBP{alpha} and its target gene, AGP, in glucocorticoid-resistant EDR1 hepatoma cells (19, 39). The attenuated transcriptional activity of the mutant glucocorticoid receptor expressed in EDR1 cells can be rescued by ectopic expression of C/EBP{alpha}, suggesting that this defective receptor maintains its crucial protein–protein interactions with this transcription factor. These studies indicate the fundamental role of the C/EBP{alpha} transcription factor in developmental regulation of proliferation and in mediating the glucocorticoid growth suppression response. C/EBP{alpha} is a key regulator of tissue-specific genes, liver regeneration, and proliferation in normal and neoplastically transformed liver cells and preadipocytes (19, 33, 5356). For example, adenoviral transfer of the C/EBP{alpha} gene caused a dramatic decrease in rat hepatoma cell proliferation (57). Moreover, overexpression of C/EBP{alpha} in hepatoma cells resulted in impaired proliferation in vitro and dramatically decreased the number of palpable tumors in heterotransplanted athymic mice (58). In contrast, C/EBP{alpha} knockout mice had serious metabolic defects due to liver dysfunction and died within a few hours after birth (59, 60). Some C/EBP family members have been shown to physically associate with glucocorticoid receptors (32). Together, these studies support our observations that this transcription factor is a crucial intermediate in the glucocorticoid signaling pathway that regulates the growth suppression response (19).

Steroid hormones have potent antiproliferative effects on a variety of tumor cell types and are often part of the chemotherapeutic repertoire in cancer treatment (6163). For example, glucocorticoids cause a rapid remission in most leukemia and lymphoma patients (17, 61, 62); however, after prolonged steroid therapy, glucocorticoid resistance frequently occurs (61, 64). Numerous studies have identified multiple mechanisms of hormone resistance associated with the emergence of steroid-resistant tumors, such as reduced numbers of glucocorticoid receptors, decreased receptor affinity for ligand, thermolabile glucocorticoid receptors that do not translocate to the nucleus, and glucocorticoid receptors with decreased affinity for DNA (6568). Furthermore, glucocorticoid-resistant leukemia and lymphoma cells frequently arise from primary human tumor cells (61). One clinical study examined glucocorticoid receptors in a panel of chronic lymphocytic leukemia patients and found no defects (63). Moreover, examination of an established glucocorticoid-resistant leukemia cell line revealed that glucocorticoid receptor function was intact (69). Presumably, the mechanism for glucocorticoid resistance in these patients and this cell line is due to reduced numbers of glucocorticoid receptors (63, 69). Furthermore, a single point mutation was identified in the ligand binding domain of the glucocorticoid receptor of a resistant human leukemia cell line that ablated both receptor transcriptional activity and glucocorticoid-induced apoptosis (70).

Several human disease states have been attributed to alterations in glucocorticoid receptor responsiveness (43, 71, 72) that were shown to be due to either specific mutations in the glucocorticoid receptor or a decreased receptor expression that affects its cell signaling pathway, as well as specific alterations in the expression and/or activity of glucocorticoid receptor target genes. For example, primary cortisol resistance can be caused by decreased receptor affinity for ligand (43, 46, 47, 72, 73) due to point mutations in the ligand binding domain of the receptor. A particularly well-characterized human condition in which defects in glucocorticoid receptor function can result in a variety of clinical conditions is familial glucocorticoid resistance (74). Analyses of familial glucocorticoid resistance patients with a partial phenotype revealed point mutations in the glucocorticoid receptor that compromise glucocorticoid receptor function, a microdeletion of the receptor gene, and decreased intracellular concentration in target tissues (74). In one patient with primary glucocorticoid resistance, both the number of glucocorticoid receptors and the affinity for cortisol were shown to be decreased, which suggests the occurrence of distinct alterations in receptor expression and function (75). Cortisol resistance in another patient was attributed to thermolabile glucocorticoid receptors that do not translocate to the nucleus (45). In addition, it has been reported that a patient with glucocorticoid resistance syndrome produced glucocorticoid receptors with decreased affinity for DNA, with no effect on ligand binding (44). Other related disease states show an impressive range of glucocorticoid receptor defects that have added to our understanding of receptor signaling. For example, a patient with sporadic generalized glucocorticoid resistance was shown to express a glucocorticoid receptor with a novel heterozygous missense mutation (isoleucine-to-asparagine at amino acid residue 559), which caused the receptor to exhibit a strong dominant-negative phenotype on the ability of the wild-type receptor to stimulate gene transcription in an in vitro assay (72). Collectively, these studies indicate that the mechanisms of glucocorticoid resistance are complex and that transformed cells, which are initially glucocorticoid responsive, develop resistance that overrides the glucocorticoid growth suppression response. Our study represents the first molecular characterization of glucocorticoid resistance in hepatoma cells in which a natural single amino acid substitution has been shown to account for the loss of the growth suppression response.


   ACKNOWLEDGMENTS
 
We would like to thank Ivonne Archebeque, Wei-ming Kao, Huy Nguyen, Tran Van, Minnie Wu, and Linda Yu for their technical assistance. We would also like to thank Anna Fung for her assistance in preparing the manuscript. We extend our gratitude to Jerry Kapler for his photography. This work was supported by grant RPG-90–001–08-BE from the American Cancer Society. R.A.R. received an individual National Research Service Award (1 F32 CA61577–01) from the National Institutes of Health and an American Liver Foundation Postdoctoral Fellowship award.


   FOOTNOTES
 
1 Correspondence: Department of Molecular and Cell Biology and the Cancer Research Laboratory, 591 Life Sciences Addition, University of California, Berkeley, CA 94720, USA. E-mail: glfire{at}uclink4.berkeley.edu

2 Abbreviations: C/EBP{alpha}, CCAAT/enhancer binding protein {alpha}; AGP, {alpha}1-acid glycoprotein; GR, glucocorticoid receptor; GRE, glucocorticoid response element; CAT, chloramphenicol acetyl transferase; DME, Dulbecco's modified Eagle; PCR, polymerase chain reaction; AMV-RT, avian myeloblastosis virus-reverse transcriptase; PBS, phosphate-buffered saline; FBS, fetal bovine serum.

Received for publication June 18, 1998. Revision received September 4, 1998.
   REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 

  1. Bishop, J. M. (1991) Molecular themes in oncogenesis. Cell 64, 235–248[Medline]
  2. Pardee, A. B. (1989) G1 events and regulation of cell proliferation. Science 246, 603–608[Abstract/Free Full Text]
  3. Aaronson, S. A., Miki, T., Meyers, K., and Chan, A. (1993) Growth factors and malignant transformation. Adv. Exp. Med. Biol. 348, 7–22[Medline]
  4. Ben-Rafael, Z., Varello, M. A., Meloni, F., Fateh, M., Mastroianni, L., Jr., and Flickinger, G. L. (1987) Flow cytometric analysis of deoxyribonucleic acid in human granulosa cells from in vitro fertilization cycles: relationships to oocyte maturity and fertilizability and to follicular fluid steroids. J. Clin. Endocrinol. Metab. 65, 602–605[Abstract/Free Full Text]
  5. de Launoit, Y., Veilleux, R., Dufour, M., Simard, J., and Labrie, F. (1991) Characteristics of the biphasic action of androgens and of the potent antiproliferative effects of the new pure antiestrogen EM-139 on cell cycle kinetic parameters in LNCaP human prostatic cancer cells. Cancer Res. 51, 5165–5170[Abstract/Free Full Text]
  6. Dong, X. F., Berthois, Y., Colomb, E., and Martin, P. M. (1991) Cell cycle phase dependence of estrogen and epidermal growth factor (EGF) receptor expression in MCF-7 cells: implications in antiestrogen and EGF cell responsiveness. Endocrinology 129, 2719–2728[Abstract/Free Full Text]
  7. Fernberg, J. O., Lewensohn, R., and Skog, S. (1991) Interaction of melphalan and dexamethasone in a human myeloma cell line. Anticancer Drugs 2, 565–570[Medline]
  8. Garvy, B. A., King, L. E., Telford, W. G., Morford, L. A., and Fraker, P. J. (1993) Chronic elevation of plasma corticosterone causes reductions in the number of cycling cells of the B lineage in murine bone marrow and induces apoptosis. Immunology 80, 587–592[Medline]
  9. Hatakeyama, S., Suzuki, A., Yoshizumi, N., Sato, M., and Nishiya, I. (1991) Glucocorticoid-induced G1 arrest and the release effect of epidermal growth factor on the human salivary gland adenocarcinoma cell. Cell. Biol. Int. Rep. 15, 55–65[Medline]
  10. Csoka, M., Bocsi, J., Falus, A., Szalai, C., Klujber, V., Szende, B., and Schuler, D. (1997) Glucocorticoid-induced apoptosis and treatment sensitivity in acute lymphoblastic leukemia of children. Pediatr. Hematol. Oncol. 14, 433–442[Medline]
  11. Goya, L., Maiyar, A. C., Ge, Y., and Firestone, G. L. (1993) Glucocorticoids induce a G1/G0 cell cycle arrest of Con8 rat mammary tumor cells that is synchronously reversed by steroid withdrawal or addition of transforming growth factor-alpha. Mol. Endocrinol. 7, 1121–1132[Abstract/Free Full Text]
  12. Leung, P., and Gidari, A. S. (1982) Glucocorticoids inhibit the growth of murine fetal liver erythroid burst-forming cells. Endocrinology 111, 1121–1126[Abstract/Free Full Text]
  13. Smith, R. G., Syms, A. J., Nag, A., Lerner, S., and Norris, J. S. (1985) Mechanism of the glucocorticoid regulation of growth of the androgen-sensitive prostate-derived R3327H-G8-A1 tumor cell line. J. Biol. Chem. 260, 12454–12463[Abstract/Free Full Text]
  14. Vintermyr, O. K., and Doskeland, S. O. (1989) Characterization of the inhibitory effect of glucocorticoids on the DNA replication of adult rat hepatocytes growing at various cell densities. J. Cell Physiol. 138, 29–37[Medline]
  15. Sanchez, I., Goya, L., Vallerga, A. K., and Firestone, G. L. (1993) Glucocorticoids reversibly arrest rat hepatoma cell growth by inducing an early G1 block in cell cycle progression. Cell Growth Differ. 4, 215–225[Abstract]
  16. Spydevold, O., Sorensen, H., Clausen, O. P., and Gautvik, K. M. (1990) Dexamethasone inhibition of rat hepatoma cell growth and cell cycle traverse is reversed by insulin. Biochim. Biophys. Acta 1052, 221–228[Medline]
  17. Gaynon, P. S., and Lustig, R. H. (1995) The use of glucocorticoids in acute lymphoblastic leukemia of childhood. Molecular, cellular, and clinical considerations. J. Pediatr. Hematol. Oncol. 17, 1–12[Medline]
  18. Ito, C., Evans, W. E., McNinch, L., Coustan-Smith, E., Mahmoud, H., Pui, C. H., and Campana, D. (1996) Comparative cytotoxicity of dexamethasone and prednisolone in childhood acute lymphoblastic leukemia. J. Clin. Oncol. 14, 2370–2376[Abstract]
  19. Ramos, R. A., Nishio, Y., Maiyar, A. C., Simon, K. E., Ridder, C. C., Ge, Y., and Firestone, G. L. (1996) Glucocorticoid-stimulated CCAAT/enhancer-binding protein alpha expression is required for steroid-induced G1 cell cycle arrest of minimal-deviation rat hepatoma cells. Mol. Cell. Biol. 16, 5288–5301[Abstract/Free Full Text]
  20. Leffert, H. L., Koch, K. S., Moran, T., and Rubalcava, B. (1979) Hormonal control of rat liver regeneration. Gastroenterology 76, 1470–1482[Medline]
  21. Rogatsky, I., Trowbridge, J. M., and Garabedian, M. J. (1997) Glucocorticoid receptor-mediated cell cycle arrest is achieved through distinct cell-specific transcriptional regulatory mechanisms. Mol. Cell. Biol. 17, 3181–3193[Abstract/Free Full Text]
  22. Bamberger, C. M., Schulte, H. M., and Chouros, G. P. (1996) Molecular determinants of glucocorticoid receptor function and tissue sensitivity to glucocorticoids. Endocr. Rev. 17, 245–261[Abstract/Free Full Text]
  23. Beato, M., and Sanchez-Pacheco, A. (1996) Interaction of steroid hormone receptors with the transcription initiation complex. Endocr. Rev. 17, 587–609[Abstract/Free Full Text]
  24. Gronemeyer, H. (1992) Control of transcription activation by steroid hormone receptors. FASEB J. 6, 2524–2529[Abstract]
  25. Truss, M., and Beato, M. (1993) Steroid hormone receptors: interaction with deoxyribonucleic acid and transcription factors. Endocr. Rev. 14, 459–479[Abstract/Free Full Text]
  26. Beato, M., Herrlich, P., and Schutz, G. (1995) Steroid hormone receptors: many actors in search of a plot. Cell 83, 851–857[Medline]
  27. Zilliacus, J., Wright, A. P., Carlstedt-Duke, J., and Gustafsson, J. A. (1995) Structural determinants of DNA-binding specificity by steroid receptors. Mol. Endocrinol. 9, 389–400[Free Full Text]
  28. Diamond, M. I., Miner, J. N., Yoshinaga, S. K., and Yamamoto, K. R. (1990) Transcription factor interactions: selectors of positive or negative regulation from a single DNA element. Science 249, 1266–1272[Abstract/Free Full Text]
  29. Jonat, C., Rahmsdorf, H. J., Park, K. K., Cato, A. C., Gebel, S., Ponta, H., and Herrlich, P. (1990) Antitumor promotion and antiinflammation: down-modulation of AP-1 (Fos/Jun) activity by glucocorticoid hormone. Cell 62, 1189–1204[Medline]
  30. Mukaida, N., Morita, M., Ishikawa, Y., Rice, N., Okamoto, S., Kasahara, T., and Matsushima, K. (1994) Novel mechanism of glucocorticoid-mediated gene repression. Nuclear factor-kappa B is target for glucocorticoid-mediated interleukin 8 gene repression. J. Biol. Chem. 269, 13289–13295[Abstract/Free Full Text]
  31. Ray, A., and Prefontaine, K. E. (1994) Physical association and functional antagonism between the p65 subunit of transcription factor NF-kappa B and the glucocorticoid receptor. Proc. Natl. Acad. Sci. USA 91, 752–756[Abstract/Free Full Text]
  32. Nishio, Y., Isshiki, H., Kishimoto, T., and Akira, S. (1993) A nuclear factor for interleukin-6 expression (NF-IL6) and the glucocorticoid receptor synergistically activate transcription of the rat alpha 1-acid glycoprotein gene via direct protein–protein interaction. Mol. Cell. Biol. 13, 1854–1862[Abstract/Free Full Text]
  33. Baumann, H., Morella, K. K., Campos, S. P., Cao, Z., and Jahreis, G. P. (1992) Role of CAAT-enhancer binding protein isoforms in the cytokine regulation of acute-phase plasma protein genes. J. Biol. Chem. 267, 19744–19751[Abstract/Free Full Text]
  34. Faber, S., O'Brien, R. M., Imai, E., Granner, D. K., and Chalkley, R. (1993) Dynamic aspects of DNA/protein interactions in the transcriptional initiation complex and the hormone-responsive domains of the phosphoenolpyruvate carboxykinase promoter in vivo. J. Biol. Chem. 268, 24976–24985[Abstract/Free Full Text]
  35. Imai, E., Miner, J. N., Mitchell, J. A., Yamamoto, K. R., and Granner, D. K. (1993) Glucocorticoid receptor-cAMP response element-binding protein interaction and the response of the phosphoenolpyruvate carboxykinase gene to glucocorticoids. J. Biol. Chem. 268, 5353–5356[Abstract/Free Full Text]
  36. Muller, M., Baniahmad, C., Kaltschmidt, C., and Renkawitz, R. (1991) Multiple domains of the glucocorticoid receptor involved in synergism with the CACCC box factor(s). Mol. Endocrinol. 5, 1498–1503[Abstract/Free Full Text]
  37. Pearce, D., and Yamamoto, K. R. (1993) Mineralocorticoid and glucocorticoid receptor activities distinguished by nonreceptor factors at a composite response element [see comments]. Science 259, 1161–1165[Abstract/Free Full Text]
  38. Touray, M., Ryan, F., Jaggi, R., and Martin, F. (1991) Characterisation of functional inhibition of the glucocorticoid receptor by Fos/Jun. Oncogene 6, 1227–1234[Medline]
  39. Cook, P. W., Swanson, K. T., Edwards, C. P., and Firestone, G. L. (1988) Glucocorticoid receptor-dependent inhibition of cellular proliferation in dexamethasone-resistant and hypersensitive rat hepatoma cell variants. Mol. Cell. Biol. 8, 1449–1459[Abstract/Free Full Text]
  40. Cram, E. J., Ramos, R. A., Wang, E. C., Cha, H. H., Nishio, Y., and Firestone, G. L. (1998) Role of the CCAAT/enhancer binding protein-alpha transcription factor in the glucocorticoid stimulation of p21waf1/cip1 gene promoter activity in growth-arrested rat hepatoma cells. J. Biol. Chem. 273, 2008–2014[Abstract/Free Full Text]
  41. Sanger, F., Nicklen, S., and Coulson, A. R. (1977) DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74, 5463–5467[Abstract/Free Full Text]
  42. Iida, S., Gomi, M., Moriwaki, K., Itoh, Y., Hirobe, K., Matsuzawa, Y., Katagiri, S., Yonezawa, T., and Tarui, S. (1985) Primary cortisol resistance accompanied by a reduction in glucocorticoid receptors in two members of the same family. J. Clin. Endocrinol. Metab. 60, 967–971[Abstract/Free Full Text]
  43. Chrousos, G. P., Vingerhoeds, A., Brandon, D., Eil, C., Pugeat, M., DeVroede, M., Loriaux, D. L., and Lipsett, M. B. (1982) Primary cortisol resistance in man. A glucocorticoid receptor-mediated disease. J. Clin. Invest. 69, 1261–1269
  44. Nawata, H., Sekiya, K., Higuchi, K., Kato, K., and Ibayashi, H. (1987) Decreased deoxyribonucleic acid binding of glucocorticoid-receptor complex in cultured skin fibroblasts from a patient with the glucocorticoid resistance syndrome. J. Clin. Endocrinol. Metab. 65, 219–226[Abstract/Free Full Text]
  45. Bronnegard, M., Werner, S., and Gustafsson, J. A. (1986) Primary cortisol resistance associated with a thermolabile glucocorticoid receptor in a patient with fatigue as the only symptom. J. Clin. Invest. 78, 1270–1278
  46. Malchoff, D. M., Brufsky, A., Reardon, G., McDermott, P., Javier, E. C., Bergh, C. H., Rowe, D., and Malchoff, C. D. (1993) A mutation of the glucocorticoid receptor in primary cortisol resistance. J. Clin. Invest. 91, 1918–1925
  47. Lamberts, S. W., Koper, J. W., Biemond, P., H., d. H. F., and de Jong, F. H. (1992) Cortisol receptor resistance: the variability of its clinical presentation and response to treatment. J Clin. Endocrinol. Metab. 74, 313–321[Abstract]
  48. Alam, T., An, M. R., Mifflin, R. C., Hsieh, C. C., Ge, X., and Papaconstantinou, J. (1993) Trans-activation of the alpha 1-acid glycoprotein gene acute phase responsive element by multiple isoforms of C/EBP and glucocorticoid receptor. J. Biol. Chem. 268, 15681–15688[Abstract/Free Full Text]
  49. Wollenberg, G. K., LaMarre, J., Semple, E., Farber, E., Gauldie, J., and Hayes, M. A. (1991) Counteracting effects of dexamethasone and alpha 2-macroglobulin on inhibition of proliferation of normal and neoplastic rat hepatocytes by transforming growth factors-beta type 1 and type 2. Int. J. Cancer 47, 311–316[Medline]
  50. Hollenberg, S. M., and Evans, R. M. (1988) Multiple and cooperative trans-activation domains of the human glucocorticoid receptor. Cell 55, 899–906[Medline]
  51. Schena, M., Freedman, L. P., and Yamamoto, K. R. (1989) Mutations in the glucocorticoid receptor zinc finger region that distinguish interdigitated DNA binding and transcriptional enhancement activities. Genes & Dev. 3, 1590–1601[Abstract/Free Full Text]
  52. Chen, H., Srinivasan, G., and Thompson, E. B. (1997) Protein–protein interactions are implied in glucocorticoid receptor mutant 465*-mediated cell death. J. Biol. Chem. 272, 25873–25880[Abstract/Free Full Text]
  53. Lin, F.-T., and Lane, M. D. (1994) CCAAT/enhancer binding protein alpha is sufficient to initiate the 3T3-L1 adipocyte differentiation program. Proc. Natl. Acad. Sci. USA 91, 8757–8761[Abstract/Free Full Text]
  54. Mischoulon, D., Rana, B., Bucher, N. L., and Farmer, S. R. (1992) Growth-dependent inhibition of CCAAT enhancer-binding protein (C/EBP alpha) gene expression during hepatocyte proliferation in the regenerating liver and in culture. Mol. Cell. Biol. 12, 2553–2560[Abstract/Free Full Text]
  55. O'Brien, R. M., Lucas, P. C., Yamasaki, T., Noisin, E. L., and Granner, D. K. (1994) Potential convergence of insulin and cAMP signal transduction systems at the phosphoenolpyruvate carboxykinase (PEPCK) gene promoter through CCAAT/enhancer binding protein (C/EBP). J. Biol. Chem. 269, 30419–30428[Abstract/Free Full Text]
  56. Trautwein, C., Rakemann, T., Pietrangelo, A., Plumpe, J., Montosi, G., and Manns, M. P. (1996) C/EBP-beta/LAP controls down-regulation of albumin gene transcription during liver regeneration. J. Biol. Chem. 271, 22262–22270[Abstract/Free Full Text]
  57. Diehl, A. M., Johns, D. C., Yang, S., Lin, H., Yin, M., Matelis, L. A., and Lawrence, J. H. (1996) Adenovirus-mediated transfer of CCAAT/enhancer-binding protein-alpha identifies a dominant antiproliferative role for this isoform in hepatocytes. J. Biol. Chem. 271, 7343–7350[Abstract/Free Full Text]
  58. Watkins, P. J., Condreay, J. P., Huber, B. E., Jacobs, S. J., and Adams, D. J. (1996) Impaired proliferation and tumorigenicity induced by CCAAT/enhancer-binding protein. Cancer Res. 56, 1063–1067[Abstract/Free Full Text]
  59. Wang, N. D., Finegold, M. J., Bradley, A., Ou, C. N., Abdelsayed, S. V., Wilde, M. D., Taylor, L. R., Wilson, D. R., and Darlington, G. J. (1995) Impaired energy homeostasis in C/EBP alpha knockout mice. Science 269, 1108–1112[Abstract/Free Full Text]
  60. Flodby, P., Antonson, P., Barlow, C., Blanck, A., Porsch-Hallstrom, I., and Xanthopoulos, K. G. (1993) Differential patterns of expression of three C/EBP isoforms, HNF-1, and HNF-4 after partial hepatectomy in rats. Exp. Cell Res. 208, 248–256[Medline]
  61. Kaspers, G. J., Pieters, R., Klumper, E., De Waal, F. C., and Veerman, A. J. (1994) Glucocorticoid resistance in childhood leukemia. Leuk. Lymphoma 13, 187–201[Medline]
  62. Pui, C. H., Boyett, J. M., Hancock, M. L., Pratt, C. B., Meyer, W. H., and Crist, W. M. (1995) Outcome of treatment for childhood cancer in black as compared with white children. The St. Jude Children's Research Hospital experience, 1962 through 1992 [see comments]. J. Am. Med. Assoc. 273, 633–637[Abstract/Free Full Text]
  63. Soufi, M., Kaiser, U., Schneider, A., Beato, M., and Westphal, H. M. (1995) The DNA and steroid binding domains of the glucocorticoid receptor are not altered in mononuclear cells of treated CLL patients. Exp. Clin. Endocrinol. Diabetes 103, 175–183[Medline]
  64. Klumper, E., Pieters, R., Veerman, A. J., Huismans, D. R., Loonen, A. H., Hahlen, K., Kaspers, G. J., van Wering, E. R., Hartmann, R., and Henze, G. (1995) In vitro cellular drug resistance in children with relapsed/refractory acute lymphoblastic leukemia. Blood 86, 3861–3868[Abstract/Free Full Text]
  65. Danielsen, M., Northrop, J. P., and Ringold, G. M. (1986) The mouse glucocorticoid receptor: mapping of functional domains by cloning, sequencing and expression of wild-type and mutant receptor proteins. EMBO J. 5, 2513–2522[Medline]
  66. Dieken, E. S., Meese, E. U., and Miesfeld, R. L. (1990) nti glucocorticoid receptor transcripts lack sequences encoding the amino-terminal transcriptional modulatory domain. Mol. Cell. Biol. 10, 4574–4581[Abstract/Free Full Text]
  67. Darbre, P. D., and King, R. J. (1987) Progression to steroid insensitivity can occur irrespective of the presence of functional steroid receptors. Cell 51, 521–528[Medline]
  68. Rabindran, S. K., Danielsen, M., and Stallcup, M. R. (1987) Glucocorticoid-resistant lymphoma cell variants that contain functional glucocorticoid receptors. Mol. Cell. Biol. 7, 4211–4217[Abstract/Free Full Text]
  69. Zawydiwski, R., Harmon, J. M., and Thompson, E. B. (1983) Glucocorticoid-resistant human acute lymphoblastic leukemic cell line with functional receptor. Cancer Res. 43, 3865–3873[Abstract/Free Full Text]
  70. Ashraf, J., and Thompson, E. B. (1993) Identification of the activation-labile gene: a single point mutation in the human glucocorticoid receptor presents as two distinct receptor phenotypes. Mol. Endocrinol. 7, 631–642[Abstract/Free Full Text]
  71. DeRijk, R., and Sternberg, E. M. (1997) Corticosteroid resistance and disease. Ann. Med. 29, 79–82[Medline]
  72. Karl, M., Lamberts, S. W., Koper, J. W., Katz, D. A., Huizenga, N. E., Kino, T., Haddad, B. R., Hughes, M. R., and Chrousos, G. P. (1996) Cushing's disease preceded by generalized glucocorticoid resistance: clinical consequences of a novel, dominant-negative glucocorticoid receptor mutation. Proc. Assoc. Am. Physicians 108, 296–307[Medline]
  73. Malchoff, C. D., Javier, E. C., Malchoff, D. M., Martin, T., Rogol, A., Brandon, D., Loriaux, D. L., and Reardon, G. E. (1990) Primary cortisol resistance presenting as isosexual precocity. J. Clin. Endocrinol. Metab. 70, 503–507[Abstract/Free Full Text]
  74. Stratakis, C. A., Karl, M., Schulte, H. M., and Chrousos, G. P. (1994) Glucocorticosteroid resistance in humans. Elucidation of the molecular mechanisms and implications for pathophysiology. Ann. N.Y. Acad. Sci. 746, 362–376
  75. Kawakubo, A., Suzuki, A., Yokoi, H., Kakiya, S., Morikawa, M., Oiso, Y., and Yamamoto, M. (1995) A case of primary glucocorticoid resistance. Nagoya J. Med. Sci. 58, 143–147[Medline]



This article has been cited by other articles:


Home page
J Mol EndocrinolHome page
M. Woltje, B. Tschoke, V. von Bulow, R. Westenfeld, B. Denecke, S. Graber, and W. Jahnen-Dechent
CCAAT enhancer binding protein beta and hepatocyte nuclear factor 3beta are necessary and sufficient to mediate dexamethasone-induced up-regulation of alpha2HS-glycoprotein/fetuin-A gene expression.
J. Mol. Endocrinol., April 1, 2006; 36(2): 261 - 277.
[Abstract] [Full Text] [PDF]


Home page
NEJMHome page
D. I. Levy, M. Roth, P. Borger, and M. Tamm
C/EBP{alpha} in Asthma
N. Engl. J. Med., November 18, 2004; 351(21): 2236 - 2237.
[Full Text] [PDF]


Home page
NEJMHome page
M. Roth, P. R.A. Johnson, P. Borger, M. P. Bihl, J. J. Rudiger, G. G. King, Q. Ge, K. Hostettler, J. K. Burgess, J. L. Black, et al.
Dysfunctional Interaction of C/EBP{alpha} and the Glucocorticoid Receptor in Asthmatic Bronchial Smooth-Muscle Cells
N. Engl. J. Med., August 5, 2004; 351(6): 560 - 574.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. A. Piccinni, A.-L. Bolcato-Bellemin, A. Klein, V. W. Yang, M. Kedinger, P. Simon-Assmann, and O. Lefebvre
Kruppel-like Factors Regulate the Lama1 Gene Encoding the Laminin {alpha}1 Chain
J. Biol. Chem., March 5, 2004; 279(10): 9103 - 9114.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
J. J. RUDIGER, M. ROTH, M. P. BIHL, B. C. CORNELIUS, M. JOHNSON, R. ZIESCHE, and L.-H. BLOCK
Interaction of C/EBP{alpha} and the glucocorticoid receptor in vivo and in nontransformed human cells
FASEB J, February 1, 2002; 16(2): 177 - 184.
[Abstract] [Full Text] [PDF]


Home page
JNCI J Natl Cancer InstHome page
K. Nishimura, N. Nonomura, E. Satoh, Y. Harada, M. Nakayama, T. Tokizane, T. Fukui, Y. Ono, H. Inoue, M. Shin, et al.
Potential Mechanism for the Effects of Dexamethasone on Growth of Androgen-Independent Prostate Cancer
J Natl Cancer Inst, November 21, 2001; 93(22): 1739 - 1746.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ramos, R. A.
Right arrow Articles by Firestone, G. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ramos, R. A.
Right arrow Articles by Firestone, G. L.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS