(The FASEB Journal. 1998;12:461-467.)
© 1998 FASEB
Apoptosis caused by oxidized LDL is manganese superoxide dismutase and p53 dependent
Ralf Kinscherfa,
Ralf Clausb,
Martin Wagnera,
Christof Gehrkea,
Huse Kamencica,
Dongming Houa,
Olaf Nauena,
Walther Schmiedtd,
Gyula Kovacsc,
Johannes Pille,
Jürgen Metza,
and Hans-peter Deignerb,1
a Department of Anatomy and Cell Biology III, University of Heidelberg, 69120 Heidelberg, Germany
b Institute of Pharmaceutical Chemistry, University of Heidelberg, 69120 Heidelberg, Germany
c Department of Urology, University of Heidelberg, 69120 Heidelberg, Germany
d Department of Cardiothoracic and Vascular Surgery, 55101 Mainz, Germany
e Department of Preclinical Research Boehringer-Mannheim, 68298 Mannheim, Germany
 |
ABSTRACT
|
|---|
Oxidized low density lipoprotein (oxLDL) induces apoptosis in human macrophages (M
), a significant feature in atherogenesis. We found that induction of apoptosis in M
by oxLDL, C2-ceramide, tumor necrosis factor
(TNF-
), and hydrogen peroxide (H2O2) was associated with enhanced expression of manganese superoxide dismutase (MnSOD) and p53. Treatment of cells with p53 or MnSOD antisense oligonucleotides prior to stimulation with oxLDL, C2-ceramide, TNF-
, or H2O2 caused an inhibition of the expression of the respective protein together with a marked reduction of apoptosis. Exposure to N-acetylcysteine before treatment with oxLDL, C2-ceramide, TNF-
, or H2O2 reversed a decrease in cellular glutathione concentrations as well as the enhanced production of p53 and MnSOD mRNA and protein. In apoptotic macrophages of human atherosclerotic plaques, colocalization of MnSOD and p53 immunoreactivity was found. These results indicate that in oxLDL-induced apoptosis, a concomitant induction of p53 and MnSOD is critical, and suggest that it is at least in part due to an enhancement of the sphingomyelin/ceramide pathway.Kinscherf, R., Claus, R., Wagner, M., Gehrke, C., Kamencic, H., Hou, D., Nauen, O., Schmiedt, W., Kovacs, G., Pill, J., Metz, J., Deigner, H.-P. Apoptosis caused by oxidized LDL is manganese superoxide dismutase and p53 dependent. FASEB J. 12, 461467 (1998)
Key Words: atherosclerosis macrophages glutathione TNF-
antibodies immunohistochemistry
 |
INTRODUCTION
|
|---|
A HIGH LEVEL of low density lipoprotein (LDL)2 is a risk factor for atherosclerosis, and it is generally accepted that atherosclerotic lesions are initiated by an enhancement of LDL uptake by monocytes and macrophages (1). LDL must be modified prior to uptake; detection of oxidatively modified LDL (oxLDL) in atherosclerotic lesions supports a role for this process in vivo (2). Macrophages (M
) exposed to oxLDL subsequently form foam cells, one of the first stages of atherogenesis (3).
Oxidized LDL is capable of inducing signal transduction leading to activation of protein kinase C (4) or modulation of transcription factor activities (5, 6). One feature with potential implications for atherogenesis (7) is the ability of inducing apoptosis (810). We have recently shown that incubation of human M
with oxLDL results in an increase in the concentration of ceramide (11), a lipid mediator involved in stress-induced signaling (12, 13). Ceramide is considered to be an endogenous regulator of apoptosis (13, 14) and is also generated in response to the occupation of the tumor necrosis factor
(TNF-
) receptor (14). TNF-
, however, is a cytokine released by M
upon exposure to oxLDL (15) and is capable of inducing oxidative stress by the generation of reactive oxygen species (ROS) from mitochondria (16, 17). Hence, direct or mediated signaling stimulated by oxLDL may involve oxidative stress (18, 19). Genotoxic stress in general, however, implicates activation of the oncosuppressor gene p53 (20), and p53 levels have been shown to determine the extent of the apoptotic response of, for example, tumor cells (21). Although there is some data about p53 in restenotic lesions (22), no information is available about its role in oxLDL-induced apoptosis.
The aim of this work was to gain insight into stress-related mechanisms that cause apoptosis in M
exposed to oxLDL. For this purpose, we quantified the extent of apoptosis upon treatment with oxLDL, C2-ceramide, TNF-
, or H2O2 and determined the level of p53 and H2O2-generating mitochondrial manganese superoxide dismutase (MnSOD, E.C.1.15.1.1). To study the contribution of p53 and MnSOD to oxLDL-induced apoptosis, experiments were performed using cells pretreated with stable p53 or MnSOD antisense oligonucleotides (AS-ODN). In addition, the presence of p53 and MnSOD immunoreactivity (IR) was examined in lesional apoptotic M
.
 |
METHODS
|
|---|
LDL preparation and cell culture
LDL was isolated (23) and oxidized by exposure to human endothelial cells as described (24); oxLDL obtained by this procedure contained 2.2 ± 0.5 nmol thiobarbituric acid-reactive substances/mg (LDL concentrations refer to 500 kDa apoB100). Human peripheral blood mononuclear cells from venous blood of healthy volunteers were prepared by Ficoll-Paque (Sigma, Deisenhofen, Germany) density gradient centrifugation, as described by the manufacturer's instructions, and were cultivated in RPMI 1640 supplemented with 10% fetal calf serum, glutamine, and penicillin (100 units/ml)/streptomycin (100 µg/ml) at 37°C in humidified CO2 (5%) atmosphere for 5 days. Nonadherent cells were removed by washing with supplemented RPMI. Differentiated M
were cultured with lipoprotein-deficient serum (prepared by ultracentrifugation of fetal calf serum, P>1.21) (23) for 24 h prior to experimentation, then exposed to oxLDL, C2-ceramide, H2O2, or recombinant human TNF-
(Escherichia coli, endotoxin content <1.25 EU/mg protein, purity >99%, specific activity 5x107 U/mg protein, Bender, Wien, Austria) in the same medium. Apoptotic cells, identified by propidium iodide staining (10 µg/ml), were counted under an Olympus BH2 microscope fitted with a mercury light source and epiflourescence assembly, using a computer-assisted morphometry system developed in our group (VIBAM 0.0-VFG1).
Reverse transcription-polymerase chain reaction (RT-PCR) analysis
RNA was extracted from 1 x 106 cells by using Trizol LS reagent (Life Technologies, Eggenstein, Germany) according to the manufacturer's specifications. Reverse transcription of RNA was performed with poly dT24 primer and 400 units of SUPERSCRIPT II (Life Technologies) in a 40 µl reaction volume for 2 h at 45°C. The enzyme was then inactivated by 10 min incubation at 80°C. cDNA (1 µl) was used for PCR analysis in a 20 µl reaction volume containing 10 mM Tris/HCl (pH 8.3), 50 mM KCl, 2 mM MgCl2, 0.2 mM each dNTP, 1U Taq DNA polymerase (Boehringer-Mannheim, Mannheim, Germany), and 10 pmol each of forward and reverse primer. Primers for amplification of MnSOD: 5'-GGTAGCACCAGCACTAGCAG-3' (forward), 5'-CTGCAGTACTCTATACCACTACA-3' (reverse), generating a 568-base pair (bp) fragment; p53: 5'-AACCTACCAG-GGCAGCTACG-3' (forward), 5'-TTCCTCTGTGCG-CCGGTCTC-3' (reverse), generating a 559-bp fragment; bcl-2: 5'-CGACGACTTCT-CCCGCCGCTACCGC-3' (forward), 5'-CCGCATGCTGGGGCCGTACAGTTCC-3' (reverse). Amplification of part of the ß-microglobulin gene was used as a positive control; primers: 5'-CTCG-CGCTACTCTCTCTTTCT-3' (forward) and 5'-TGTCGGATTGATGAAACCCAG-3' (reverse). A PCR reaction profile with initial denaturation for 2 min at 94°C, followed by 35 (MnSOD) or 44 cycles (p53) of 1 min at 94°C, 56°C (MnSOD) [58°C, p53], and 72°C, and a final extension step for 10 min at 72°C was performed on Genius thermal cycler (Techne Inc., Cambridge, U.K.); amplification products were separated on a 1.5% agarose gel and stained with ethidium bromide.
AS-ODN treatment
Synthetic phosphorothioate AS-ODN specific for the p53 antisense sequence [5'-GTTGGCAAAACATCTTGTTGAGGGCA-3', codon 129136 of the human p53 gene (25), and 5'-CCCTGCTCCCCCCTGGCTCC-3' (26)] with documented efficiency on p53 expression were used (all MWG-BIOTECH, Ebersberg, Germany) as well as MnSOD AS-ODN corresponding to the initiation site of MnSOD translation [22-mer: CACGCCGCCCGACACAACATTG (27)] and the respective control ODNs cited there; M
(3x106 cells) were treated with the respective AS-ODN for 8 h (all 100 nM), using DOTAP (Boehringer-Mannheim) for lipofection according to the manufacturer's recommendations. Treatment efficiency was checked by MnSOD/p53 Western blotting and RT-PCR.
Immunohistochemistry
Biopsies of human arteriosclerotic carotid artery obtained at surgery were snap-frozen in liquid nitrogen-cooled isopentane. Heritable hyperlipidemic rabbits (Froxfield Farm Ltd., Froxfield, U.K.) housed individually under the same conditions (food and water ad libitum throughout the experiment, 12 h dark-light) were killed by an intravenous overdose of sodium pentobarbital. The animal studies were approved by the Referat Veterinärwesen at the Regierungspräsidium Karlsruhe, Germany. Fragments of the thoracic aortas were snap-frozen in liquid nitrogen-cooled isopentane; 6 µm cross sections were cut on a Microm Microtome, placed on silan precoated microscope slides, and exposed to acetone (10 min; -20°C), followed by air-drying (10 min). Nonspecific sites were blocked with 2% swine serum (Life Technologies) in phosphate-buffered saline (10 min). Endogenous peroxidase activity was suppressed with 0.3% H2O2 in phosphate-buffered saline (10 min). For immunostaining of the cryo-cross sections, anti-MnSOD (IgG1, 400 ng/ml) and anti-p53 (IgG2b) antibodies (Ab's) were used; control sections were set up with irrelevant isotype-matched mAb's. Apoptotic cells were detected by 1) the TUNEL technique, using a commercially available in situ cell death detection kit (Boehringer-Mannheim) and 2) polyclonal rabbit anti human c-jun/AP-1 antibodies (Calbiochem, San Diego, Calif.) recognizing a 45 kDa cytoplasmic protein present only in apoptotic cells (28); then the immunoenzymatic streptavidin biotinylated horseradish peroxidase complex procedure was used. Staining reaction was performed by adding DAB solution (Pierce, Rockford, Ill.). Nuclei were then counterstained with hematoxylin.
Other procedures
MnSOD activity was determined according to the procedures of Joseph et al. (29). H2O2 concentration in the medium was determined photometrically by scopoletin oxidation in the presence of horseradish peroxidase (30). Glutathione (GSH) concentrations were determined as described (31). Western blotting was performed according to Burnette (32); MnSOD (Bender) and p53 (Boehringer-Mannheim) mAb's were used. All statistical procedures were performed using a personal computer version of the SIMSTAT program (Provalis Research); results are presented as means ± SEM, statistical significance was determined by the Mann Whitney U-Wilcoxon rank sum W test or the impaired Student's t test; a P value of 0.05 or less was chosen for statistical significance.
 |
RESULTS
|
|---|
Apoptosis in M
To analyze factors of apoptosis induced by oxLDL, human M
were exposed to oxLDL, C2-ceramide, TNF-
, or hydrogen peroxide (H2O2) and apoptosis was measured after 2 and 4 h of incubation. The number of apoptotic cells after oxLDL treatment increased by twofold after 2 h (data not shown) and by about fivefold after 4 h (
Table 1).
Addition of C2-ceramide to the medium was accompanied by a marginal increase of the number of apoptotic cells after 2 h (not shown) and a significant enhancement after 4 h (ca. fivefold of the respective control,
Table 1). Similar results were obtained when H2O2 was used (three- and approximately fivefold, respectively).
p53 and MnSOD induction
To assess oxLDL-induced alterations of pro- and antiapoptotic factors in M
on a molecular level, p53 and bcl2 mRNA and protein expression were examined upon treatment with C2-ceramide, TNF-
, oxLDL, and H2O2. Because mitochondria play a central role in the induction of apoptosis by an increased production of superoxide anions (33), an investigation of manganese superoxide dismutase (MnSOD) expression was included in our study. We found that MnSOD protein expression and mRNA production were markedly enhanced after 4 h exposure to oxLDL, C2-ceramide, H2O2, or TNF-
(
Fig. 1
A, B). Similar results were obtained when p53 protein and mRNA levels of stimulated cells were analyzed (
Fig. 2
A, B), but under our experimental conditions bcl2 protein and mRNA levels apparently remained unaffected (not shown). The production of H2O2-induced MnSOD mRNA was minor relative to that obtained after TNF-
or C2-ceramide treatment. The expression of the two gene products MnSOD and p53 roughly reflected differences observed at the stage of the respective mRNA levels.
Inhibition of p53 or MnSOD expression and apoptosis
The contribution of p53 and MnSOD induction to oxLDL-induced apoptosis was assessed by the use of specific AS-ODN. After pretreatment with two different p53 AS-ODN, the respective mRNA in M
exposed to oxLDL was apparently absent (
Fig. 3B).
An analog result was obtained for MnSOD-mRNA when the MnSOD-specific AS-ODN was used (
Fig. 3A), and the findings were confirmed by a substantial reduction of the respective protein bands as determined by Western blotting (
Fig. 3C). Accordingly, in this experimental setting, apoptosis in response to oxLDL, C2-ceramide, TNF-
, and H2O2 in M
pretreated with the respective AS-ODN involved either MnSOD or p53-independent signaling. Pretreatment with p53 AS-ODN was followed by about a 20% reduction in apoptotic cells (
Table 1); the effect of MnSOD AS-ODN treatment on apoptosis was even more pronounced. When MnSOD expression was inhibited, apoptosis of M
was significantly reduced by about 25%.

View larger version (21K):
[in this window]
[in a new window]
|
Figure 3. MnSOD (A) and p53 mRNA (B) after pretreatment with specific AS-ODN and subsequent stimulation with ox-LDL (54 µg/ml; 4 h); C) Western blots of the corresponding AS-ODN-pretreated samples stimulated with oxLDL.
|
|
In further support of the hypothesis that oxLDL-mediated effects are attributable to oxidative stress, we observed a 2.3-fold increase of MnSOD activity in the cell lysates and a 5-fold increase of H2O2 concentration in the media of oxLDL-treated cells (average values of two experiments performed in duplicate). M
exposed to oxLDL, C2-ceramide, TNF-
, or H2O2 revealed a significant decrease of GSH (
Table 2);
pretreatment with N-acetylcysteine (NAC), however, prevented the oxLDL, C2-ceramide, TNF-
, and H2O2-mediated decrease of intracellular GSH as well as the induction of apoptosis (
Table 2). Concomitantly, the presence of NAC abolished the induction of p53 and MnSOD by oxLDL and C2-ceramide as determined by RT-PCR (not shown).
MnSOD and p53 in lesional M
To investigate the pathophysiological relevance of our in vitro findings in the context of atherosclerosis in vivo, we explored human atherosclerotic carotid arteries and thoracic aortas of heritable hyperlipidemic (HHL) rabbits. We found a colocalization of MnSOD- and p53-IR in subendothelially localized M
in atherosclerotic lesions of thoracic aortas of HHL rabbits; these M
also showed DNA strand breaks as detected by the TUNEL technique (data not shown). Results obtained with aortas from HHL rabbits could be confirmed with human material: in human atherosclerotic carotid arteries, identical cells exhibited MnSOD- and p53-IR (
Fig. 4A, C).
The same cells were apoptotic, as found by staining with antibodies recognizing a 45 kDa cytoplasmic protein (
Fig. 4B), which is detected only in apoptotic cells (28) (
Fig. 4AC).

View larger version (89K):
[in this window]
[in a new window]
|
Figure 4. MnSOD, c-jun/AP1, and p53 immunoreactivity (IR) in a human atherosclerotic plaque. Immunohistochemical analysis of serial cryostat cross sections of a carotid artery. (A) MnSOD-IR. B) Apoptotic cells designated by c-jun/AP1-IR. C) p53-IR; detection was performed by the biotinylated streptavidinhorseradish peroxide complex. Nuclei are counterstained with hematoxylin.
|
|
 |
DISCUSSION
|
|---|
Oxidized LDL has previously been shown to induce DNA fragmentation and apoptosis in M
(810). Since the oncosuppressor gene p53 is known to affect apoptosis (34) and p53-IR has been demonstrated in smooth muscle cells of restenotic lesions (35), we reasoned that one factor that can influence cell susceptibility to oxLDL-mediated apoptosis could be the expression of p53 (36). If DNA is damaged, p53 accumulates and switches off replication to allow extra time for repair; if the repair fails, p53 may trigger cell suicide by apoptosis (34). In fact, our data show that p53 production is induced by oxLDL. In our study, oxLDL significantly increased the level and activity of mitochondrial MnSOD, an effect that has been shown to occur as a consequence of TNF treatment (37). An inhibition of either p53 or MnSOD expression resulted in a concomitant reduction of oxLDL-mediated apoptosis, indicating that both proteins play a role in the initiation of this process and suggesting that expression of both proteins is induced by common mechanisms. One explanation that is in line with a reported redox regulation of MnSOD (38) and with the corresponding effects of exogenous H2O2, C2-ceramide (12) or TNF (39) is an oxLDL-mediated induction of oxidative stress. A correlation of MnSOD and p53 expression has most recently been shown in cancer cells after radiation therapy (40); oxidative stress and DNA damage are known to trigger cell susceptibility to wild-type p53-dependent and p53-independent induction of apoptosis (41). Enhanced MnSOD expression may, in turn, further stimulate H2O2 production and MnSOD expression. Given an insufficient inactivation of H2O2 by consecutive antioxidative systems such as catalase or glutathione, MnSOD could play a pro-oxidative role in producing excess H2O2, an agent capable of crossing cell and organelle membranes (42). In support of this interpretation, other groups (43, 44) have demonstrated that a balance of superoxide dismutase and peroxide-removing enzymes is of prime importance in the antioxidant defense.
Oxidative stress in cells is reflected by the intracellular concentration of oxidants such as H2O2 or antioxidants such as GSH (45). Consistent with our results and the interpretation above, an induction of ROS by modified lipoproteins has been demonstrated; stimulation of the scavenger receptor on M
evokes release of arachidonic acid metabolites and reduced oxygen species (46). Moreover, a decrease in GSH, a change regarded as an index of oxidative stress (47), was commonly observed in M
exposed to oxLDL, C2-ceramide, TNF-
, or H2O2, a finding that indicates changes in the intracellular redox status of the cells. Support for a significant role of H2O2 in oxLDL, C2-ceramide, or TNF-
-induced apoptosis is provided by the notion that NAC, a cysteine prodrug that maintains intracellular GSH-levels during oxidative stress (48) and is capable of reacting with H2O2 but not with O2·- (49), prevented apoptosis and significantly inhibited a reduction of GSH levels. The observation that a single dose of exogenous H2O2 is sufficient to induce apoptosis whereas a significant reduction of apoptosis is achieved by inhibiting a consequence of the exposure to this agent (i.e., enhanced expression of MnSOD) can be explained by assuming that, under our experimental conditions, further and continous H2O2 production (due to an increased MnSOD expression) is critical to the induction of apoptosis. This implies the assumption of an autocatalytical amplification of MnSOD expression by its own product, H2O2, as soon as a critical concentration level (which may be suppressed by a NAC pretreatment) is achieved.
Besides MnSOD expression (37), TNF-mediated signaling causes sphingomyelin hydrolysis to ceramide (14), an effect similar to that of oxLDL (11). Ceramide is a lipid mediator that may function as a biostat (13) and is required in stress-induced apoptosis (12). Hence, apoptosis caused by exposure to oxLDL, H2O2, or TNF (50) is likely to involve ceramide-mediated signaling, a hypothesis in accord with the similar effects of these stimuli on p53 and MnSOD.
Jovinge and colleagues (15) have shown that TNF is released in response to oxLDL an effect that may contribute to the observed induction of MnSOD and p53, and thus to apoptosis. However, this sequence of events is likely to operate with prolonged exposure to oxLDL, because we found that treatment with modified lipoprotein markedly enhanced cellular ceramide concentration after 15 min and MnSOD mRNA within 30 min (C. Gehrke and R. Kinscherf, unpublished observations), whereas TNF is liberated mainly within 6 h (15).
As previously demonstrated, MnSOD-IR was found to be localized exclusively in M
, and not in endothelial cells or smooth muscle cells of hypercholesterolemic rabbits (51). In the present study, we found a colocalization of MnSOD- and p53-IR in subendothelially localized apoptotic lesional M
in atherosclerotic lesions of thoracic aortas of HHL rabbits, a location where oxidation of LDL is likely to occur (52). Evidence for a pathophysiological significance of these findings in humans is provided by the fact that p53 and MnSOD-IR are colocalized in apoptotic M
of human atherosclerotic carotid arteries. Together, our data show for the first time that oxLDL induces p53 as well as MnSOD expression in M
, and indicate a link between these observations and oxLDL-induced apoptosis. In line with Rosenfeld's (18) suggestion proposing a common intracellular signal transduction pathway in atherogenesis that is responsive to oxidative mechanisms, the results are rationalized by assuming that oxidative stress implicating MnSOD and p53 induction as well as ceramide-dependent signaling is a common cause of oxLDL, H2O2, or TNF-induced apoptosis in M
.
 |
ACKNOWLEDGMENTS
|
|---|
This study was supported by the Deutsche Forschungsgemeinschaft (DE 375/22).
 |
FOOTNOTES
|
|---|
1 Correspondence: Institute of Pharmaceutical Chemistry, University of Heidelberg, Im Neuenheimer Feld 364, 69120 Heidelberg, Germany. 
2 Abbreviations: Ab's, antibodies; AS-ODN, antisense oligonucleotides; GSH, glutathione; HHL, heritable hyperlipidemic; IR, immunoreactivity; M
, macrophage(s); MnSOD, manganese superoxide dismutase; NAC, N-acetylcysteine; oxLDL, oxidized low density lipoprotein; ROS, reactive oxygen species; TNF, tumor necrosis factor. 
Received for publication September 22, 1997.
Accepted for publication December 2, 1997.
 |
REFERENCES
|
|---|
-
Ross, R. (1993) The pathogenesis of atherosclerosis: a perspective for the 1990s. Nature (London) 362, 801809[Medline]
-
Ylä-Herttuala, S., Palinski, W., Rosenfeld, M. E., Parthasarathy, S., Carew, T. E., Butler, S., Witztum, J. L., and Steinberg, D. (1989) Evidence for the presence of oxidatively modified low-density lipoprotein in atherosclerotic lesions of rabbit and man. J. Clin. Invest. 84, 10861095
-
Steinberg, D., Parthasarathy, S., Carew, T. E., Khoo, J. C., and Witztum, J. L. (1989) Beyond cholesterolmodifications of low-density lipoprotein that increase its atherogenicity. New Engl. J. Med. 320, 915924[Medline]
-
Claus, R., Fyrnys, B., Deigner, H. P., and Wolf, G. (1996) Oxidized low-density lipoprotein stimulates protein kinase C (PKC) and induces expression of PKC-isotypes via prostaglandin-H-synthetase in P388D1 macrophage-like cells, Biochemistry 35, 49114922[Medline]
-
Shackelford, R. E., Misra, U. K., Florine-Casteel, K., Thai, S.-H., Pizzo, S. V., and Adams, D. O. (1995) Oxidized low density lipoprotein suppresses activation of NF-
B in macrophages via a pertussis toxin-sensitive signaling mechanism. J. Biol. Chem. 270, 34753478[Abstract/Free Full Text]
-
Ares, M. P., Kallin, B., Eriksson, P., and Nilsson, J. (1995) Oxidized LDL induces transcription factor activator protein-1 but inhibits activation of nuclear factor-kappa B in human vascular smooth muscle cells. Arterioscler. Thromb. Vasc. Biol. 15, 15841590[Abstract/Free Full Text]
-
Björkerud, S., and Björkerud, B. (1996) Apoptosis is abundant in human atherosclerotic lesions, especially in inflammatory cells (macrophages and T cells), and may contribute to the accumulation of gruel and plaque instability. Am. J. Pathol. 149, 367380[Abstract]
-
Reid, V. C., Mitchinson, M. J., and Skepper, J. N. (1993) Cytotoxicity of oxidized low-density lipoprotein to mouse peritoneal macrophages: an ultrastructural study. J. Pathol. 171, 321328[Medline]
-
Reid, V. C., Hardwick, S. J., and Mitchinson, M. J. (1993) Fragmentation of DNA in P388D1 macrophages exposed to oxidised low-density lipoprotein. FEBS Lett. 332, 218220[Medline]
-
Hardwick, S. J., Hegyi, L., Clare, K., Law, N. S., Carpenter, K. L. H., Mitchinson, M. J., and Skepper, J. N. (1996) Apoptosis in human monocyte-macrophage exposed to oxidized low density lipoprotein. J. Pathol. 179, 294302[Medline]
-
Kinscherf, R., Claus, R., Deigner, H. P., Nauen, O., Gehrke, C., Hermetter, A., Russwurm, S., Daniel, V., Hack, V., and Metz, J. (1997) Modified low density lipoprotein delivers substrate for ceramide formation and stimulates the sphingomyelin-ceramide pathway in human macrophages. FEBS Lett. 405, 5559[Medline]
-
Verheij, M., Bose, R., Lin, X. H., Yao, B., Jarvis, W. D., Grant, S., Birrer, M. J., Szabo, E., Zon, L. I., Kyriakis, J. M., Haimovitz-Friedman, A., Fuks, Z., and Kolesnick, R. N. (1996) Requirement for ceramide-initiated SAPK/JNK signaling in stress-induced apoptosis. Nature (London) 380, 7579[Medline]
-
Hannun, Y. A. (1996) Functions of ceramide in coordinating cellular response to stress. Science 274, 18551859[Abstract/Free Full Text]
-
Hannun, Y. A., and Obeid, L. M. (1995) Ceramide: an intracellular signal for apoptosis. Trends Biochem. Sci. 20, 7377[Medline]
-
Jovinge, S., Ares, M. P., Kallin, B., and Nilsson, J. (1996) Human monocytes/macrophages release TNF-alpha in response to Ox-LDL. Arterioscler. Thromb. Vasc. Biol. 16, 15731579[Abstract/Free Full Text]
-
Schulze-Osthoff, K., Beyaert, R., Vandevoorde, V., Haegeman, G., and Fiers, W. (1993) Deplementation of the mitochondrial electron transport abrogates the cytotoxic and gene-inductive effects of TNF. EMBO J. 12, 30953104[Medline]
-
Keane, J., Balcewicz-Sablinska, M. K., Remold, H. G., Chupp, G. L., Meek, B. B., Fenton, M. J., and Kornfeld, H. (1997) Infection by mycobacterium tuberculosis promotes human alveolar macrophage apoptosis. Infect. Immun. 65, 298304[Abstract]
-
Rosenfeld, M. E. (1996) Cellular mechanisms in the development of atherosclerosis. Diabetes Res. Clin. Pract. 30, 111
-
Gotoh, N., Graham, A., Nikl, E., and Darley-Usmar, V. M. (1993) Inhibition of glutathione synthesis inceases the toxicity of oxidized low-density lipoprotein to human monocytes and macrophages. Biochem. J. 296, 151154
-
Liu, Z.-G., Baskaran, R., Lea-Chou, E. T., Wood, L. D., Chen, Y., Karin, M., and Wang, J. Y. J. (1996) Three distinct signalling responses by murine fibroblasts to genotoxic stress. Nature (London) 384, 273276[Medline]
-
Chen, X., Ko, L. J., Jayaraman, L., and Prives, C. (1996) p53 levels, functional domains, and DNA damage determine the extent of the apoptotic response of tumor cells. Genes & Dev. 10, 24382451[Abstract/Free Full Text]
-
Speir, E., Huang, E. S., Modali, R., Leon, M. B., Shawl, F., Finkel, T., and Epstein, S. E. (1995) Interaction of human cytomegalovirus with p53: possible role in coronary restenosis. Scand. J. Infect. Dis. Suppl. 99, 7881[Medline]
-
Havel, R. H., Eder, H. A., and Bragdon, J. H. (1955) The distribution and chemical composition of ultracentrifugally separated lipoproteins in human serum. J. Clin. Invest. 34, 13451353
-
Auge, N., Andrieu, N., Negre-Salvayre, A., Thiers, J. C., Levade, T., and Salvayre, R. (1996) The sphingomyelin-ceramide pathway is involved in oxidized low density lipoprotein-induced cell proliferation. J. Biol. Chem. 271, 1925119255[Abstract/Free Full Text]
-
Iotsova, V., and Stehelin, D. (1995) Antisence p53 provokes changes in HeLa cell growth and morphology. Eur. J. Cell Biol. 68, 122132[Medline]
-
Bishop, M. R., Iversen, P. L., Bayever, E., Sharp, J. G., Greiner, T. C., Copple, B. L., Ruddon, R., Zon, G., Spinolo, J., Arneson, M., Armitage, J. O., and Kessinger, A. (1996) Phase I trial of an antisense oligonucleotide OL(1)p53 in hematologic malignancies. J. Clin. Oncol. 14, 13201326[Abstract/Free Full Text]
-
Yamashita, N., Nishida, M., Hoshida, S., Igarashi, J., Hori, M., Kuzuya, T., and Tada, M. (1996) Alpha 1-adrenergic stimulation induces cardiac tolerance to hypoxia via induction and activation of Mn-SOD. Am. J. Physiol. 271, H1356H1362[Abstract/Free Full Text]
-
Grand, R. J. A., Milner, A. E., Mustoe, T., Johnson, G. D., Owen, D., Grant, M. L., and Gregory, C. D. (1995) A novel protein expressed in mammalian cells undergoing apoptosis. Exp. Cell Res. 218, 439451[Medline]
-
Joseph, B. Z., Routes, J. M., and Borish, L. (1993) Activities of superoxide dismutases and NADPH oxidase in neutrophils obtained from asthmatic and normal donors. Inflammation 17, 361370[Medline]
-
Corbett, J. T. (1989) The scopoletin assay for hydrogen peroxide. A review and a better method. J. Biochem. Biophys. Methods 18, 297307[Medline]
-
Tietze, F. (1969) Enzymatic method for quantitative determination of nanogram amounts of total and oxidized glutathione: applications to mammalian blood and other tissues. Anal. Biochem. 27, 502522[Medline]
-
Burnette, W. N. (1981) `Western blotting': electrophoretic transfer of proteins from sodium dodecyl sulfatepolyacylamide gels to unmodified nitrocellulose and radiographic detection with antibody and radioiodinated protein A. Anal. Biochem. 112, 195203[Medline]
-
Zamzami, N., Mignotte, B., and Kroemer, G. (1995) Sequential reduction of mitochondrial transmembrane potential and generation of reactive oxygen species in early programmed cell death. J. Exp. Med 182, 367377[Abstract/Free Full Text]
-
Lane, D. P. (1992) Cancer. p53, guardian of the genome. Nature (London) 358, 1516[Medline]
-
Isner, J. M., Kearney, M., Bortman, S., and Passeri, J. (1995) Apoptosis in human atherosclerosis and restenosis. Circulation 91, 27032711[Abstract/Free Full Text]
-
Clarke, A. R., Purdie, C. A., Harrison D. J., Morris, R. G., Bird, C. C., Hooper, M. L., and Wyllie, A. H. (1993) Thymocyte apoptosis induced by p53-dependent and independent pathway. Nature (London) 362, 849852[Medline]
-
Wong, G. H., and Goeddel, D. B. (1988) Induction of manganese superoxide dismutase by tumor necrosis factor: possible protective mechanism. Science 242, 941944[Abstract/Free Full Text]
-
Warner, B. B.Stuart, L., Gebb, S., and Wispe, J. R. (1996) Redox regulation of manganese superoxide dismutase. Am. J. Physiol. 271, L150L158[Abstract/Free Full Text]
-
Satriano, J. A., Shuldiner, M, Hora, K., Xing, Y., Shan, Z., and Schlondorff, D. (1993) Oxygen radicals as second messengers for expression of the monocyte chemoattractant protein, JE/MCP-1, and the monocyte colony-stimulating factor, CSF-1, in response to tumor necrosis factor-alpha and immunoglobulin G. Evidence for involvement of reduced nicotinamide adenine dinucleotide phosphate (NADPH)-dependent oxidase. J. Clin. Invest. 92, 15641571
-
Nakano, T., Oka, K., and Taniguchi, N. (1996) Manganese superoxide dismutase expression correlates with p53 status and local recurrence of cervical carcinoma treated with radiation therapy. Cancer Res. 56, 27712775[Abstract/Free Full Text]
-
Lotem, J., Peled-Kamar, M., Groner, Y., and Sachs, L. (1996) Cellular oxidative stress and the control of apoptosis by wild-type p53, cytotoxic compounds, and cytokines. Proc. Natl. Acad. Sci. USA 93, 91669171[Abstract/Free Full Text]
-
Halliwell, B., and Gutteridge, J. M. C. (1989) Free Radicals in Biology and Medicine, 2nd Ed, Clarendon Press, Oxford
-
Amstad, P., Peskin, A., Shah, G., Mirault, M. E., Moret, R., Zbinden, I., and Cerutti, P. (1991) The balance between Cu,Zn-superoxide dismutase and catalase affects the sensitive of mouse epidermal cells to oxidative stress. Biochemistry 30, 93059315[Medline]
-
Zhong, W., Oberley, L. W., Oberley, T. D., Yan, T., Doman, F. E., and St.-Clair, D. K. (1996) Inhibition of cell growth and sensitization to oxidative damage by overexpression of manganese superoxide dismutase in rat glioma cells. Cell Growth Differ. 7, 11751186[Abstract]
-
Sies, H. (1986) Biochemistry of oxidative stress. Angew. Chem. 25, 10581071
-
Hartung, H. P., Kladetzki, R. G., Melnik, B., and Hennerici, M. (1986) Stimulation of the scavanger receptor on monocytes-macrophages evokes release of arachidonic acid metabolites and reduced oxygen species. Lab. Invest. 55, 209216[Medline]
-
Meister, A., and Anderson, M. E. (1983) Glutathione. Annu. Rev. Biochem. 52, 711760 (438 refs)[Medline]
-
Simon, G., Moog, C., and Obert, G. (1994) Effects of glutathione precursors on human immunodeficiency virus replication. Chem. Biol. Interact. 91, 217224[Medline]
-
Aruoma, O. I. Halliwell, B., Hoey, B. M., and Butler, J. (1989) The antioxidant action of N-acetylcysteine: its reaction with hydrogen peroxide, hydroxyl radical, superoxide, and hydrochlorous acid. Free Rad. Biol. Med. 6, 593597[Medline]
-
Gamard, C. J., Dbaibo, G. S., Liu, B., Obeid, L. M., and Hannun, Y. A. (1997) Selective involvement of ceramide in cytokine-induced apoptosis J. Biol. Chem. 272, 1647416481[Abstract/Free Full Text]
-
Kinscherf, R., Köhler, C., Kreuter, C., Pill, J., and Metz, J. (1995) Hypercholesterolemia increases manganese superoxide dismutase immunoreactive macrophages in myocardium. Histochem. Cell. Biol. 104, 295300[Medline]
-
Rosenfeld, M. E., Palinski, W., Ylä-Herttuala, S., Butler, S., and Witztum, J. L. (1990) Distribution of oxidative specific lipid-protein adducts and apolipoprotein B in atherosclerotic lessions of varying severity from WHHL rabbits. Arteriosclerosis 10, 336349[Abstract/Free Full Text]