|
|
||||||||
RESEARCH COMMUNICATION |
a Department of Anatomy and Cell Biology III, University of Heidelberg, 69120 Heidelberg, Germany
b Institute of Pharmaceutical Chemistry, University of Heidelberg, 69120 Heidelberg, Germany
c Department of Urology, University of Heidelberg, 69120 Heidelberg, Germany
d Department of Cardiothoracic and Vascular Surgery, 55101 Mainz, Germany
e Department of Preclinical Research Boehringer-Mannheim, 68298 Mannheim, Germany
| ABSTRACT |
|---|
|
|
|---|
), a significant feature in atherogenesis. We found that induction of apoptosis in M
by oxLDL, C2-ceramide, tumor necrosis factor
(TNF-
), and hydrogen peroxide (H2O2) was associated with enhanced expression of manganese superoxide dismutase (MnSOD) and p53. Treatment of cells with p53 or MnSOD antisense oligonucleotides prior to stimulation with oxLDL, C2-ceramide, TNF-
, or H2O2 caused an inhibition of the expression of the respective protein together with a marked reduction of apoptosis. Exposure to N-acetylcysteine before treatment with oxLDL, C2-ceramide, TNF-
, or H2O2 reversed a decrease in cellular glutathione concentrations as well as the enhanced production of p53 and MnSOD mRNA and protein. In apoptotic macrophages of human atherosclerotic plaques, colocalization of MnSOD and p53 immunoreactivity was found. These results indicate that in oxLDL-induced apoptosis, a concomitant induction of p53 and MnSOD is critical, and suggest that it is at least in part due to an enhancement of the sphingomyelin/ceramide pathway.Kinscherf, R., Claus, R., Wagner, M., Gehrke, C., Kamencic, H., Hou, D., Nauen, O., Schmiedt, W., Kovacs, G., Pill, J., Metz, J., Deigner, H.-P. Apoptosis caused by oxidized LDL is manganese superoxide dismutase and p53 dependent. FASEB J. 12, 461467 (1998)
Key Words: atherosclerosis macrophages glutathione TNF-
antibodies immunohistochemistry
| INTRODUCTION |
|---|
|
|
|---|
) exposed to oxLDL subsequently form foam cells, one of the first stages of atherogenesis (3).
Oxidized LDL is capable of inducing signal transduction leading to activation of protein kinase C (4) or modulation of transcription factor activities (5, 6). One feature with potential implications for atherogenesis (7) is the ability of inducing apoptosis (810). We have recently shown that incubation of human M
with oxLDL results in an increase in the concentration of ceramide (11), a lipid mediator involved in stress-induced signaling (12, 13). Ceramide is considered to be an endogenous regulator of apoptosis (13, 14) and is also generated in response to the occupation of the tumor necrosis factor
(TNF-
) receptor (14). TNF-
, however, is a cytokine released by M
upon exposure to oxLDL (15) and is capable of inducing oxidative stress by the generation of reactive oxygen species (ROS) from mitochondria (16, 17). Hence, direct or mediated signaling stimulated by oxLDL may involve oxidative stress (18, 19). Genotoxic stress in general, however, implicates activation of the oncosuppressor gene p53 (20), and p53 levels have been shown to determine the extent of the apoptotic response of, for example, tumor cells (21). Although there is some data about p53 in restenotic lesions (22), no information is available about its role in oxLDL-induced apoptosis.
The aim of this work was to gain insight into stress-related mechanisms that cause apoptosis in M
exposed to oxLDL. For this purpose, we quantified the extent of apoptosis upon treatment with oxLDL, C2-ceramide, TNF-
, or H2O2 and determined the level of p53 and H2O2-generating mitochondrial manganese superoxide dismutase (MnSOD, E.C.1.15.1.1). To study the contribution of p53 and MnSOD to oxLDL-induced apoptosis, experiments were performed using cells pretreated with stable p53 or MnSOD antisense oligonucleotides (AS-ODN). In addition, the presence of p53 and MnSOD immunoreactivity (IR) was examined in lesional apoptotic M
.
| METHODS |
|---|
|
|
|---|
were cultured with lipoprotein-deficient serum (prepared by ultracentrifugation of fetal calf serum, P>1.21) (23) for 24 h prior to experimentation, then exposed to oxLDL, C2-ceramide, H2O2, or recombinant human TNF-
(Escherichia coli, endotoxin content <1.25 EU/mg protein, purity >99%, specific activity 5x107 U/mg protein, Bender, Wien, Austria) in the same medium. Apoptotic cells, identified by propidium iodide staining (10 µg/ml), were counted under an Olympus BH2 microscope fitted with a mercury light source and epiflourescence assembly, using a computer-assisted morphometry system developed in our group (VIBAM 0.0-VFG1).
Reverse transcription-polymerase chain reaction (RT-PCR) analysis
RNA was extracted from 1 x 106 cells by using Trizol LS reagent (Life Technologies, Eggenstein, Germany) according to the manufacturer's specifications. Reverse transcription of RNA was performed with poly dT24 primer and 400 units of SUPERSCRIPT II (Life Technologies) in a 40 µl reaction volume for 2 h at 45°C. The enzyme was then inactivated by 10 min incubation at 80°C. cDNA (1 µl) was used for PCR analysis in a 20 µl reaction volume containing 10 mM Tris/HCl (pH 8.3), 50 mM KCl, 2 mM MgCl2, 0.2 mM each dNTP, 1U Taq DNA polymerase (Boehringer-Mannheim, Mannheim, Germany), and 10 pmol each of forward and reverse primer. Primers for amplification of MnSOD: 5'-GGTAGCACCAGCACTAGCAG-3' (forward), 5'-CTGCAGTACTCTATACCACTACA-3' (reverse), generating a 568-base pair (bp) fragment; p53: 5'-AACCTACCAG-GGCAGCTACG-3' (forward), 5'-TTCCTCTGTGCG-CCGGTCTC-3' (reverse), generating a 559-bp fragment; bcl-2: 5'-CGACGACTTCT-CCCGCCGCTACCGC-3' (forward), 5'-CCGCATGCTGGGGCCGTACAGTTCC-3' (reverse). Amplification of part of the ß-microglobulin gene was used as a positive control; primers: 5'-CTCG-CGCTACTCTCTCTTTCT-3' (forward) and 5'-TGTCGGATTGATGAAACCCAG-3' (reverse). A PCR reaction profile with initial denaturation for 2 min at 94°C, followed by 35 (MnSOD) or 44 cycles (p53) of 1 min at 94°C, 56°C (MnSOD) [58°C, p53], and 72°C, and a final extension step for 10 min at 72°C was performed on Genius thermal cycler (Techne Inc., Cambridge, U.K.); amplification products were separated on a 1.5% agarose gel and stained with ethidium bromide.
AS-ODN treatment
Synthetic phosphorothioate AS-ODN specific for the p53 antisense sequence [5'-GTTGGCAAAACATCTTGTTGAGGGCA-3', codon 129136 of the human p53 gene (25), and 5'-CCCTGCTCCCCCCTGGCTCC-3' (26)] with documented efficiency on p53 expression were used (all MWG-BIOTECH, Ebersberg, Germany) as well as MnSOD AS-ODN corresponding to the initiation site of MnSOD translation [22-mer: CACGCCGCCCGACACAACATTG (27)] and the respective control ODNs cited there; M
(3x106 cells) were treated with the respective AS-ODN for 8 h (all 100 nM), using DOTAP (Boehringer-Mannheim) for lipofection according to the manufacturer's recommendations. Treatment efficiency was checked by MnSOD/p53 Western blotting and RT-PCR.
Immunohistochemistry
Biopsies of human arteriosclerotic carotid artery obtained at surgery were snap-frozen in liquid nitrogen-cooled isopentane. Heritable hyperlipidemic rabbits (Froxfield Farm Ltd., Froxfield, U.K.) housed individually under the same conditions (food and water ad libitum throughout the experiment, 12 h dark-light) were killed by an intravenous overdose of sodium pentobarbital. The animal studies were approved by the Referat Veterinärwesen at the Regierungspräsidium Karlsruhe, Germany. Fragments of the thoracic aortas were snap-frozen in liquid nitrogen-cooled isopentane; 6 µm cross sections were cut on a Microm Microtome, placed on silan precoated microscope slides, and exposed to acetone (10 min; -20°C), followed by air-drying (10 min). Nonspecific sites were blocked with 2% swine serum (Life Technologies) in phosphate-buffered saline (10 min). Endogenous peroxidase activity was suppressed with 0.3% H2O2 in phosphate-buffered saline (10 min). For immunostaining of the cryo-cross sections, anti-MnSOD (IgG1, 400 ng/ml) and anti-p53 (IgG2b) antibodies (Ab's) were used; control sections were set up with irrelevant isotype-matched mAb's. Apoptotic cells were detected by 1) the TUNEL technique, using a commercially available in situ cell death detection kit (Boehringer-Mannheim) and 2) polyclonal rabbit anti human c-jun/AP-1 antibodies (Calbiochem, San Diego, Calif.) recognizing a 45 kDa cytoplasmic protein present only in apoptotic cells (28); then the immunoenzymatic streptavidin biotinylated horseradish peroxidase complex procedure was used. Staining reaction was performed by adding DAB solution (Pierce, Rockford, Ill.). Nuclei were then counterstained with hematoxylin.
Other procedures
MnSOD activity was determined according to the procedures of Joseph et al. (29). H2O2 concentration in the medium was determined photometrically by scopoletin oxidation in the presence of horseradish peroxidase (30). Glutathione (GSH) concentrations were determined as described (31). Western blotting was performed according to Burnette (32); MnSOD (Bender) and p53 (Boehringer-Mannheim) mAb's were used. All statistical procedures were performed using a personal computer version of the SIMSTAT program (Provalis Research); results are presented as means ± SEM, statistical significance was determined by the Mann Whitney U-Wilcoxon rank sum W test or the impaired Student's t test; a P value of 0.05 or less was chosen for statistical significance.
| RESULTS |
|---|
|
|
|---|

were exposed to oxLDL, C2-ceramide, TNF-
, or hydrogen peroxide (H2O2) and apoptosis was measured after 2 and 4 h of incubation. The number of apoptotic cells after oxLDL treatment increased by twofold after 2 h (data not shown) and by about fivefold after 4 h (
|
p53 and MnSOD induction
To assess oxLDL-induced alterations of pro- and antiapoptotic factors in M
on a molecular level, p53 and bcl2 mRNA and protein expression were examined upon treatment with C2-ceramide, TNF-
, oxLDL, and H2O2. Because mitochondria play a central role in the induction of apoptosis by an increased production of superoxide anions (33), an investigation of manganese superoxide dismutase (MnSOD) expression was included in our study. We found that MnSOD protein expression and mRNA production were markedly enhanced after 4 h exposure to oxLDL, C2-ceramide, H2O2, or TNF-
(
Fig. 1
A, B). Similar results were obtained when p53 protein and mRNA levels of stimulated cells were analyzed (
Fig. 2
A, B), but under our experimental conditions bcl2 protein and mRNA levels apparently remained unaffected (not shown). The production of H2O2-induced MnSOD mRNA was minor relative to that obtained after TNF-
or C2-ceramide treatment. The expression of the two gene products MnSOD and p53 roughly reflected differences observed at the stage of the respective mRNA levels.
|
|
Inhibition of p53 or MnSOD expression and apoptosis
The contribution of p53 and MnSOD induction to oxLDL-induced apoptosis was assessed by the use of specific AS-ODN. After pretreatment with two different p53 AS-ODN, the respective mRNA in M
exposed to oxLDL was apparently absent (
Fig. 3B).
An analog result was obtained for MnSOD-mRNA when the MnSOD-specific AS-ODN was used (
Fig. 3A), and the findings were confirmed by a substantial reduction of the respective protein bands as determined by Western blotting (
Fig. 3C). Accordingly, in this experimental setting, apoptosis in response to oxLDL, C2-ceramide, TNF-
, and H2O2 in M
pretreated with the respective AS-ODN involved either MnSOD or p53-independent signaling. Pretreatment with p53 AS-ODN was followed by about a 20% reduction in apoptotic cells (
Table 1); the effect of MnSOD AS-ODN treatment on apoptosis was even more pronounced. When MnSOD expression was inhibited, apoptosis of M
was significantly reduced by about 25%.
|
In further support of the hypothesis that oxLDL-mediated effects are attributable to oxidative stress, we observed a 2.3-fold increase of MnSOD activity in the cell lysates and a 5-fold increase of H2O2 concentration in the media of oxLDL-treated cells (average values of two experiments performed in duplicate). M
exposed to oxLDL, C2-ceramide, TNF-
, or H2O2 revealed a significant decrease of GSH (
Table 2);
pretreatment with N-acetylcysteine (NAC), however, prevented the oxLDL, C2-ceramide, TNF-
, and H2O2-mediated decrease of intracellular GSH as well as the induction of apoptosis (
Table 2). Concomitantly, the presence of NAC abolished the induction of p53 and MnSOD by oxLDL and C2-ceramide as determined by RT-PCR (not shown).
|
MnSOD and p53 in lesional M
To investigate the pathophysiological relevance of our in vitro findings in the context of atherosclerosis in vivo, we explored human atherosclerotic carotid arteries and thoracic aortas of heritable hyperlipidemic (HHL) rabbits. We found a colocalization of MnSOD- and p53-IR in subendothelially localized M
in atherosclerotic lesions of thoracic aortas of HHL rabbits; these M
also showed DNA strand breaks as detected by the TUNEL technique (data not shown). Results obtained with aortas from HHL rabbits could be confirmed with human material: in human atherosclerotic carotid arteries, identical cells exhibited MnSOD- and p53-IR (
Fig. 4A, C).
The same cells were apoptotic, as found by staining with antibodies recognizing a 45 kDa cytoplasmic protein (
Fig. 4B), which is detected only in apoptotic cells (28) (
Fig. 4AC).
|
| DISCUSSION |
|---|
|
|
|---|
(810). Since the oncosuppressor gene p53 is known to affect apoptosis (34) and p53-IR has been demonstrated in smooth muscle cells of restenotic lesions (35), we reasoned that one factor that can influence cell susceptibility to oxLDL-mediated apoptosis could be the expression of p53 (36). If DNA is damaged, p53 accumulates and switches off replication to allow extra time for repair; if the repair fails, p53 may trigger cell suicide by apoptosis (34). In fact, our data show that p53 production is induced by oxLDL. In our study, oxLDL significantly increased the level and activity of mitochondrial MnSOD, an effect that has been shown to occur as a consequence of TNF treatment (37). An inhibition of either p53 or MnSOD expression resulted in a concomitant reduction of oxLDL-mediated apoptosis, indicating that both proteins play a role in the initiation of this process and suggesting that expression of both proteins is induced by common mechanisms. One explanation that is in line with a reported redox regulation of MnSOD (38) and with the corresponding effects of exogenous H2O2, C2-ceramide (12) or TNF (39) is an oxLDL-mediated induction of oxidative stress. A correlation of MnSOD and p53 expression has most recently been shown in cancer cells after radiation therapy (40); oxidative stress and DNA damage are known to trigger cell susceptibility to wild-type p53-dependent and p53-independent induction of apoptosis (41). Enhanced MnSOD expression may, in turn, further stimulate H2O2 production and MnSOD expression. Given an insufficient inactivation of H2O2 by consecutive antioxidative systems such as catalase or glutathione, MnSOD could play a pro-oxidative role in producing excess H2O2, an agent capable of crossing cell and organelle membranes (42). In support of this interpretation, other groups (43, 44) have demonstrated that a balance of superoxide dismutase and peroxide-removing enzymes is of prime importance in the antioxidant defense.
Oxidative stress in cells is reflected by the intracellular concentration of oxidants such as H2O2 or antioxidants such as GSH (45). Consistent with our results and the interpretation above, an induction of ROS by modified lipoproteins has been demonstrated; stimulation of the scavenger receptor on M
evokes release of arachidonic acid metabolites and reduced oxygen species (46). Moreover, a decrease in GSH, a change regarded as an index of oxidative stress (47), was commonly observed in M
exposed to oxLDL, C2-ceramide, TNF-
, or H2O2, a finding that indicates changes in the intracellular redox status of the cells. Support for a significant role of H2O2 in oxLDL, C2-ceramide, or TNF-
-induced apoptosis is provided by the notion that NAC, a cysteine prodrug that maintains intracellular GSH-levels during oxidative stress (48) and is capable of reacting with H2O2 but not with O2·- (49), prevented apoptosis and significantly inhibited a reduction of GSH levels. The observation that a single dose of exogenous H2O2 is sufficient to induce apoptosis whereas a significant reduction of apoptosis is achieved by inhibiting a consequence of the exposure to this agent (i.e., enhanced expression of MnSOD) can be explained by assuming that, under our experimental conditions, further and continous H2O2 production (due to an increased MnSOD expression) is critical to the induction of apoptosis. This implies the assumption of an autocatalytical amplification of MnSOD expression by its own product, H2O2, as soon as a critical concentration level (which may be suppressed by a NAC pretreatment) is achieved.
Besides MnSOD expression (37), TNF-mediated signaling causes sphingomyelin hydrolysis to ceramide (14), an effect similar to that of oxLDL (11). Ceramide is a lipid mediator that may function as a biostat (13) and is required in stress-induced apoptosis (12). Hence, apoptosis caused by exposure to oxLDL, H2O2, or TNF (50) is likely to involve ceramide-mediated signaling, a hypothesis in accord with the similar effects of these stimuli on p53 and MnSOD.
Jovinge and colleagues (15) have shown that TNF is released in response to oxLDL an effect that may contribute to the observed induction of MnSOD and p53, and thus to apoptosis. However, this sequence of events is likely to operate with prolonged exposure to oxLDL, because we found that treatment with modified lipoprotein markedly enhanced cellular ceramide concentration after 15 min and MnSOD mRNA within 30 min (C. Gehrke and R. Kinscherf, unpublished observations), whereas TNF is liberated mainly within 6 h (15).
As previously demonstrated, MnSOD-IR was found to be localized exclusively in M
, and not in endothelial cells or smooth muscle cells of hypercholesterolemic rabbits (51). In the present study, we found a colocalization of MnSOD- and p53-IR in subendothelially localized apoptotic lesional M
in atherosclerotic lesions of thoracic aortas of HHL rabbits, a location where oxidation of LDL is likely to occur (52). Evidence for a pathophysiological significance of these findings in humans is provided by the fact that p53 and MnSOD-IR are colocalized in apoptotic M
of human atherosclerotic carotid arteries. Together, our data show for the first time that oxLDL induces p53 as well as MnSOD expression in M
, and indicate a link between these observations and oxLDL-induced apoptosis. In line with Rosenfeld's (18) suggestion proposing a common intracellular signal transduction pathway in atherogenesis that is responsive to oxidative mechanisms, the results are rationalized by assuming that oxidative stress implicating MnSOD and p53 induction as well as ceramide-dependent signaling is a common cause of oxLDL, H2O2, or TNF-induced apoptosis in M
.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
2 Abbreviations: Ab's, antibodies; AS-ODN, antisense oligonucleotides; GSH, glutathione; HHL, heritable hyperlipidemic; IR, immunoreactivity; M
, macrophage(s); MnSOD, manganese superoxide dismutase; NAC, N-acetylcysteine; oxLDL, oxidized low density lipoprotein; ROS, reactive oxygen species; TNF, tumor necrosis factor. ![]()
Received for publication September 22, 1997. Accepted for publication December 2, 1997.
| REFERENCES |
|---|
|
|
|---|
B in macrophages via a pertussis toxin-sensitive signaling mechanism. J. Biol. Chem. 270, 34753478This article has been cited by other articles:
![]() |
P. Meier, F. Spertini, E. Blanc, and M. Burnier Oxidized Low-Density Lipoproteins Activate CD4+ T Cell Apoptosis in Patients with End-Stage Renal Disease through Fas Engagement J. Am. Soc. Nephrol., January 1, 2007; 18(1): 331 - 342. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Rivollier, L. Perrin-Cocon, S. Luche, H. Diemer, J.-M. Strub, D. Hanau, A. van Dorsselaer, V. Lotteau, C. Rabourdin-Combe, T. Rabilloud, et al. High Expression of Antioxidant Proteins in Dendritic Cells: Possible Implications in Atherosclerosis Mol. Cell. Proteomics, April 1, 2006; 5(4): 726 - 736. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Ryan, Y. C. O'Callaghan, and N. M. O'Brien Involvement of Calcium in 7{beta}-Hydroxycholesterol and Cholesterol-5{beta},6{beta}-Epoxide-Induced Apoptosis International Journal of Toxicology, January 1, 2006; 25(1): 35 - 39. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Mercer, N. Figg, V. Stoneman, D. Braganza, and M. R. Bennett Endogenous p53 Protects Vascular Smooth Muscle Cells From Apoptosis and Reduces Atherosclerosis in ApoE Knockout Mice Circ. Res., April 1, 2005; 96(6): 667 - 674. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Kashiwakura, M. Watanabe, N. Kusumi, K. Sumiyoshi, Y. Nasu, H. Yamada, T. Sawamura, H. Kumon, K. Takei, and H. Daida Dynamin-2 Regulates Oxidized Low-Density Lipoprotein-Induced Apoptosis of Vascular Smooth Muscle Cell Circulation, November 23, 2004; 110(21): 3329 - 3334. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. M. Tamimi, S. E. Hankinson, D. Spiegelman, G. A. Colditz, and D. J. Hunter Manganese Superoxide Dismutase Polymorphism, Plasma Antioxidants, Cigarette Smoking, and Risk of Breast Cancer Cancer Epidemiol. Biomarkers Prev., June 1, 2004; 13(6): 989 - 996. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. P. Hussain, P. Amstad, P. He, A. Robles, S. Lupold, I. Kaneko, M. Ichimiya, S. Sengupta, L. Mechanic, S. Okamura, et al. p53-Induced Up-Regulation of MnSOD and GPx but not Catalase Increases Oxidative Stress and Apoptosis Cancer Res., April 1, 2004; 64(7): 2350 - 2356. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. S. Hundal, A. Gomez-Munoz, J. Y. Kong, B. S. Salh, A. Marotta, V. Duronio, and U. P. Steinbrecher Oxidized Low Density Lipoprotein Inhibits Macrophage Apoptosis by Blocking Ceramide Generation, Thereby Maintaining Protein Kinase B Activation and Bcl-XL Levels J. Biol. Chem., June 27, 2003; 278(27): 24399 - 24408. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Loidl, R. Claus, H. P. Deigner, and A. Hermetter High-precision fluorescence assay for sphingomyelinase activity of isolated enzymes and cell lysates J. Lipid Res., May 1, 2002; 43(5): 815 - 823. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Droge Free Radicals in the Physiological Control of Cell Function Physiol Rev, January 1, 2002; 82(1): 47 - 95. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Levade, N. Auge, R. J. Veldman, O. Cuvillier, A. Negre-Salvayre, and R. Salvayre Sphingolipid Mediators in Cardiovascular Cell Biology and Pathology Circ. Res., November 23, 2001; 89(11): 957 - 968. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-P. DEIGNER, R. CLAUS, G. A. BONATERRA, C. GEHRKE, N. BIBAK, M. BLAESS, M. CANTZ, J. METZ, and R. KINSCHERF Ceramide induces aSMase expression: implications for oxLDL-induced apoptosis FASEB J, March 1, 2001; 15(3): 807 - 814. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Bernard, B. Quatannens, A. Begue, B. Vandenbunder, and C. Abbadie Antiproliferative and Antiapoptotic Effects of cRel May Occur within the Same Cells via the Up-Regulation of Manganese Superoxide Dismutase Cancer Res., March 1, 2001; 61(6): 2656 - 2664. [Abstract] [Full Text] |
||||
![]() |
T.-S. Lee and L.-Y. Chau Fas/Fas ligand-mediated death pathway is involved in oxLDL-induced apoptosis in vascular smooth muscle cells Am J Physiol Cell Physiol, March 1, 2001; 280(3): C709 - C718. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. NAPOLI, O. QUEHENBERGER, F. DE NIGRIS, P. ABETE, C. K. GLASS, and W. PALINSKI Mildly oxidized low density lipoprotein activates multiple apoptotic signaling pathways in human coronary cells FASEB J, October 1, 2000; 14(13): 1996 - 2007. [Abstract] [Full Text] |
||||
![]() |
H.-S. Liao, T. Kodama, and Y.-J. Geng Expression of Class A Scavenger Receptor Inhibits Apoptosis of Macrophages Triggered by Oxidized Low Density Lipoprotein and Oxysterol Arterioscler Thromb Vasc Biol, August 1, 2000; 20(8): 1968 - 1975. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. J. Kudchodkar, J. Wilson, A. Lacko, and L. Dory Hyperbaric Oxygen Reduces the Progression and Accelerates the Regression of Atherosclerosis in Rabbits Arterioscler Thromb Vasc Biol, June 1, 2000; 20(6): 1637 - 1643. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Metzler, Y. Hu, H. Dietrich, and Q. Xu Increased Expression and Activation of Stress-Activated Protein Kinases/c-Jun NH2-Terminal Protein Kinases in Atherosclerotic Lesions Coincide with p53 Am. J. Pathol., June 1, 2000; 156(6): 1875 - 1886. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Lehtolainen, M. Takeya, and S. Yla-Herttuala Retrovirus-Mediated, Stable Scavenger-Receptor Gene Transfer Leads to Functional Endocytotic Receptor Expression, Foam Cell Formation, and Increased Susceptibility to Apoptosis in Rabbit Aortic Smooth Muscle Cells Arterioscler Thromb Vasc Biol, January 1, 2000; 20(1): 52 - 60. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Kikuchi, Y. Furukawa, N. Kubo, A. Tokura, N. Hayashi, M. Nakamura, M. Matsuda, and I. Sakurabayashi Induction of Ubiquitin-Conjugating Enzyme by Aggregated Low Density Lipoprotein in Human Macrophages and Its Implications for Atherosclerosis Arterioscler Thromb Vasc Biol, January 1, 2000; 20(1): 128 - 134. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. MEILHAC, I. ESCARGUEIL-BLANC, J.-C. THIERS, R. SALVAYRE, and A. NEGRE-SALVAYRE Bcl-2 alters the balance between apoptosis and necrosis, but does not prevent cell death induced by oxidized low density lipoproteins FASEB J, March 1, 1999; 13(3): 485 - 494. [Abstract] [Full Text] |
||||
![]() |
C. B. Ambrosone, J. L. Freudenheim, P. A. Thompson, E. Bowman, J. E. Vena, J. R. Marshall, S. Graham, R. Laughlin, T. Nemoto, and P. G. Shields Manganese Superoxide Dismutase (MnSOD) Genetic Polymorphisms, Dietary Antioxidants, and Risk of Breast Cancer Cancer Res., February 1, 1999; 59(3): 602 - 606. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. D. Bello, A. Paolicchi, M. Comporti, A. Pompella, and E. Maellaro Hydrogen peroxide produced during {gamma}-glutamyl transpeptidase activity is involved in prevention of apoptosis and maintainance of proliferation in U937 cells FASEB J, January 1, 1999; 13(1): 69 - 79. [Abstract] [Full Text] |
||||
![]() |
Y. Yanagitani, H. Rakugi, A. Okamura, K. Moriguchi, S. Takiuchi, M. Ohishi, K. Suzuki, J. Higaki, and T. Ogihara Angiotensin II Type 1 Receptor–Mediated Peroxide Production in Human Macrophages Hypertension, January 1, 1999; 33(1): 335 - 339. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-R. Nofer, B. Levkau, I. Wolinska, R. Junker, M. Fobker, A. von Eckardstein, U. Seedorf, and G. Assmann Suppression of Endothelial Cell Apoptosis by High Density Lipoproteins (HDL) and HDL-associated Lysosphingolipids J. Biol. Chem., September 7, 2001; 276(37): 34480 - 34485. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |