HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Free Alert me when this article is cited Alert me if a correction is posted Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Spinozzi, F. Articles by Bertotto, A. Search for Related Content PubMed PubMed Citation Articles by Spinozzi, F. Articles by Bertotto, A.

Role of T-helper type 2 cytokines in down-modulation of Fas mRNA and receptor on the surface of activated CD4⁺ T cells: molecular basis for the persistence of the allergic immune response

^a Laboratory of Allergology and Clinical Immunology, Department of Clinical and Experimental Medicine, Perugia, Italy
^b Laboratory of Molecular Biology, Department of Clinical and Experimental Medicine, Perugia, Italy
^c Laboratory of Gastroenterology, Department of Clinical and Experimental Medicine, Perugia, Italy
^d Department of Pediatrics, University of Perugia Medical School, I-06122 Perugia, Italy

	ABSTRACT

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS AND DISCUSSION REFERENCES

 
The mechanisms responsible for persistence of T lymphocytes at the sites of allergic inflammation are not completely understood. Activated T cells, usually expressing Fas on their surface, undergo activation-induced apoptotic death, thus limiting the dangerous consequences of a persistent immune reaction. We have previously shown that pulmonary T lymphocytes from untreated asthmatic subjects do not express surface Fas receptors nor do they contain Fas mRNA, yet they display normal levels of Fas ligand. This is not an inherited defect and is confined to mucosal T cells. To gain insights into the mechanism responsible for these findings, we performed a set of experiments with both purified Dermatophagoides pteronyssinus allergen and recombinant human cytokines: interleukin 2 (IL-2), IL-4, IL-5, transforming growth factor ß₁, interferon , and granulocyte-macrophage colony-stimulating factor (GM-CSF). In vitro exposure of purified CD4⁺ lymphocytes to allergen yielded only transient up-regulation of surface Fas but did not influence susceptibility to Fas-mediated cell death. T-helper type 2 cytokines (IL-4, IL-5, and GM-CSF) had a dose-dependent and specific inhibitory effect on Fas mRNA, suggesting a new fundamental biological role in the survival of inflammatory cells during allergen exposure.—Spinozzi, F., Agea, E., Fizzotti, M., Bassotti, G., Russano, A., Droetto, S., Bistoni, O., Grignani, F., Bertotto, A. Role of T-helper type 2 cytokines in down-modulation of Fas mRNA and receptor on the surface of activated CD4⁺ T cells: molecular basis for the persistence of the allergic immune response. FASEB J. 12, 1747–1753 (1998)

Key Words: apoptosis • PBMC • interferon • interleukin • transforming growth factor

	INTRODUCTION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS AND DISCUSSION REFERENCES

 
IN RECENT YEARS it has become evident that T cells orchestrate the allergic mucosal immune response by secreting the so-called T-helper (Th)² type 2 cytokines [i.e., interleukin 4, (IL-4), IL-5, and granulocyte-macrophage colony-stimulating factor (GM-CSF)], thus determining the local recruitment and accumulation of other inflammatory cells such as neutrophils, eosinophils, and mast cells (1). However, while the attention of immunologists was focused for long time in explaining the inductive phase of the allergic response, it has not yet been searched why this response cannot be turned off in allergic individuals. The immune system has evolved multiple nonoverlapping mechanisms for controlling potentially harmful reactions. Induction of programmed cell death (apoptosis) through an interaction of Fas (CD95) with its ligand (FasL) is now recognized as the major factor regulating a normal immune response (2–4). In fact, in some situations specific immune responses have little or no protective value and harmful consequences become dominant (5–11). The allergic pulmonary immune response in susceptible individuals, for instance, displays the characteristics of a harmful response to otherwise inoffensive airborne particulate antigens. The recognition of aerodispersed allergens and the initiation of allergic inflammation take place immediately after in vivo airway exposure in susceptible individuals. This implies a rapid and simple recognition mechanism that may be mediated by local resident cells, such as T lymphocytes and/or CD1⁺ dendritic cells (12). The former recognize allergens directly or in association with CD1, and subsequently expand at the surface of inflamed airways (13–15). Thus, allergen-specific T lymphocytes (with both and ß T cell receptors) are the main effector cells that prime the local ongoing allergic immune response (16, 17). However, the respiratory (as well as the gastrointestinal) tract each day eliminates an enormous quantity of foreign substances without experiencing any inflammatory activity. Therefore, a physiological mechanism should exist that enables phagocytic resident cells to block any possible T cell reactivity. In an experimental mouse model, it was recently shown that the Fas/FasL pathway is involved in the elimination of inhaled particulate antigens from the respiratory tract (18). Similarly, normal human intraepithelial gut T lymphocytes express Fas at their surface and could be eliminated via FasL⁺ antigen-presenting-cell interaction (19).

We have investigated a possible down-modulation of this pathway on the respiratory tract of asthmatic subjects. Unlike that seen in normal subjects, T lymphocytes with both ß and T cell receptors in asthmatics never express the Fas molecule at their surface. They also have a persistently down-modulated Fas mRNA (20). The aim of the present study was to try to determine how such an effect could be ascribed to Th2-type cytokines, so that the allergic immune response can take place and persist in target organs through the combined effect of IL-4, IL-5, and GM-CSF on the recruitment and survival of resident immunocompetent cells.

	MATERIALS AND METHODS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS AND DISCUSSION REFERENCES

 
Patients and controls
Fifteen untreated asthmatic subjects (8 adults and 7 children, age range: 8–45 years, all diagnosed as being allergic to Dermatophagoides pteronyssinus) and 10 age- and sex-matched controls were recruited for the study. At the time of enrollment, all asthmatic subjects had stable pulmonary function with a forced expiratory volume in 1 s (FEV₁) ranging from 72 to 98% of that predicted for their age and height. The methacholine test was performed starting with 0.095 mg/ml concentrations. Concentration-response curves were plotted for each challenge test as percentage fall in FEV₁ against the methacholine concentration and were characterized by their threshold value (PC₂₀). None were smokers or had had upper respiratory tract infections 8 wk prior to investigations. Informed consent was obtained from the children's parents or directly from adult patients, and the research was conducted in accordance with local ethical committee guidelines. Peripheral blood mononuclear cells (PBMC) were isolated from patients and controls over a Ficoll-Hypaque density gradient and stained for Fas receptor expression on CD3⁺ T cells using a double color cytofluorometric assay, as described in full below.

Cell surface marker analysis
For cytofluorometric analysis, PBMC suspensions were stained with the following monoclonal antibodies (mAb's): phycoerythrin-conjugated anti-CD3 (OKT3, Ortho, Raritan, N.J.), fluorescein (FITC) -conjugated anti-Fas (Serotec, Oxford, U.K.). For staining, 5,000 to 10,000 cells were resuspended in 50 µl of saline, incubated at 4°C for 30 min, washed, and analyzed by flow cytometry (FACScan, Becton-Dickinson). For the analysis of two-color cytofluorometric data, an electronic gate was set on the lymphocyte population based on the forward-angle vs. right-angle light scatter histogram. Quadrant markers in fluorescence histograms were set using matched isotype controls. The Lysis II program (Becton-Dickinson) was used to optimize gating of lymphocytes, providing an objective means of excluding debris (noncellular events due to particulate matter) and other cells from the lymphocyte gate.

Source of purified CD4 T cells
CD4⁺ peripheral blood T cells from normal donors and asthmatic subjects were enriched by negative immunomagnetic bead selection using a mixture of the following mAb's coated with magnetic beads (Immunotech, Marseille, France): anti-CD8, anti-CD16, anti-CD19. Positively coated cells were removed by magnetic sorting and enriched CD4⁺ cells were recovered by negative selection.

All samples were >95% CD4⁺ cells, as revealed by immunofluorescent staining with FITC anti-CD4 mAb (Immunotech). Plastic-coated anti-CD3 mAb (ATCC, Rockville, Md.) was used as an activator for all cultured samples. Purified recombinant human cytokines were added at fixed times (basal, 24, 48, and 72 h) to culture wells. Harvested cells were used for subsequent RNA extraction and reverse transcription-polymerase chain reaction (RT-PCR).

Evaluation of activation-induced programmed cell death
PBMC were resuspended in RPMI-1640 (Gibco, Grand Island, N.Y.) supplemented with 10% fetal calf serum, 2 mM/l of L-glutamine, 10 mM/l of HEPES, 50 U/l of penicillin, and 50 µg/l of streptomycin at 10⁶ cells/ml. All samples were incubated for 24 h with either medium alone, purified allergen (DP1, 10 µg/ml; ALK-Neo-Abellò, Madrid, Spain), or anti-CD3 (ATCC) plus recombinant human IL-2 (Serotec; 20 IU/ml), then washed and exposed to an immunoglobulin M (IgM) anti-Fas mAb (clone CH11, Immunotech; 100 ng/ml). After an additional 18 h, samples were washed, centrifuged at 200 x g for 10 min, and dissolved in hypotonic lysing buffer (100 mM/l NaCl, 10 mM/l tris, 1 mM/l EDTA, 1% sodium dodecyl sulfate, 200 µg/ml of proteinase K, pH 7.5). Quantitative analysis of spontaneous and anti-Fas-induced activation death was done by cytofluorometry with a fluorochrome solution containing propidium iodide.

Fas and FasL mRNA analysis
RT-PCR analysis was carried out on RNA extracted by the guanidine isothiocyanate-acid phenol method using 1 x 10⁶ enriched CD4⁺ T cells from all patients and controls. First strand cDNA synthesis was performed using total RNA, random hexadeoxynucleotide primers and Moloney murine leukemia virus reverse transcriptase (Gibco-BRL) according to the manufacturer's protocol. Primers for Fas, FasL, and ß-actin PCR amplification as follows: Fas 5' sense primer, GTGGGATCCCACTTCGGAGGATT GCTCAACAACC; Fas 3' antisense primer, GTGCTGC AGTATGTTGGCTCTTCAGCG CTAATA; FasL 5' sense primer CAAGTCCAACTCA AGGTCCATGCC; FasL 3' antisense primer, CAGAGAGAGCTCAGATACGTTGAC; ß-actin 5' sense primer TGACGGGGTCA CCCACACTGTGCCCATCTA; ß-actin 3' antisense primer, CTAGAA GCATTGCGGTG GACGATGGAGGG. The size of amplified fragments were: Fas 1167 base pair (bp); FasL 350 bp; ß-actin 661 bp. After amplification, one-tenth of PCR product was run on 2% agarose gel and stained with ethidium bromide.

	RESULTS AND DISCUSSION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS AND DISCUSSION REFERENCES

 
Clinical and physiological characteristics of the patient population are summarized in Table 1. Because the majority of subjects were newly diagnosed as asthmatics, none had been treated with drugs (corticosteroids, theophylline, anti-histaminics, sodium-nedocromil) presumably interfering with the immune system.

Table 2 shows that Fas receptor is present on the surface of CD3⁺ T lymphocytes from PBMC of asthmatic patients and controls, both basally and after activation. These data rule out the possibility of an inherited defect of Fas expression, but raise the question of whether this previously described mucosal defect (20) could be due to environmental factors, such as the nature of the stimulating agent (notably allergen) and/or the cytokine milieu in which the allergic inflammation occurs. Recent genetic studies and the clinical course of many allergic diseases suggest a multifactorial genetic pattern of inheritance involving bronchial hyperreactivity, elevated IgE levels, and IL-4 production, all mapped on chromosome 5q31-q33 (21–23). We therefore find it unlikely that an additional perturbation in chromosome 10, where the human Fas gene is located (24), would be necessary for clinical development of an allergic disease. On the other hand, one might assume that the nature of a stimulating allergen per se in association with other well-described genetic abnormalities may be crucial. To address this point, we performed in vitro experiments with purified undenatured allergen DP1 (Dermatophagoides pteronyssinus antigen 1) to test its ability to stimulate surface Fas expression on T cells.

Purified allergen (10 µg/ml) was added to bulk cultures using the same procedure generally adopted for cloning peripheral blood T cells. As seen in Fig. 1, allergen stimulation for 48 and 72 h was significantly less efficient than anti-CD3 + rIL-2 treatment in inducing Fas expression on CD3⁺ T cells. However, incubation with purified allergen, after a transitory initial induction of Fas molecule, persistently reduced its expression during the culture period. Thus, it seems that a purified allergen is not a good stimulus for Fas receptor expression. In parallel, we assessed the functional status of activation-induced Fas molecule by adding, at the end of 24 h culture with both allergen and anti-CD3 + IL-2, a stimulating IgM anti-Fas mAb. After an additional 18 h incubation, harvested cells were stained with propidium iodide to assess the percentage of apoptotic cells. As expected (25), only anti-CD3-preactivated T cells showed a significant percentage of apoptotic nuclei, whereas allergen-primed cells did not differ substantially from the unstimulated controls ( Fig. 2). The same results were observed in both normal and asthmatic subjects, thus confirming the acquired nature of the previously described defect in Fas expression on the surface of pulmonary T cells and showing that allergens, though activating T cells, do not contribute to the triggering of the activation-induced cell death. On the other hand, we have previously demonstrated that pulmonary T lymphocytes from asthmatic subjects, while not expressing in vivo the Fas receptor, can acquire the molecule on their surface after in vitro culture with anti-CD3 mAb (20). In these experimental conditions, coculturing with IL-2 maintained the expression of the molecule, whereas IL-4 incubation caused a down-modulation of the receptor only in allergic patients. Therefore, a coordinate effect of Th2-type cytokines on the kinetics of the molecule may be hypothesized. In fact, IL-5 is closely related to clinical expression of asthma, whereas IL-4 is related to overproduction of IgE and is derived not only from T cells, but also from mast cells, basophils, and eosinophils (26). However, only the production of many other cytokines, particularly IL-5, GM-CSF, IL-13, and chemokines may allow for the subsequent multiple cellular and molecular interactions responsible for the induction of chronic airway inflammation (27, 28).

View larger version (17K): [in this window] [in a new window]   Figure 1. In vitro induction of Fas receptor. After in vitro activation with anti-CD3 + rIL-2 (Genzyme, Geneva, Switzerland; 20 IU/ml) or purified undenatured DP1 allergen (10 µg/ml), time course experiments were performed on bulk cultures from PBMC of atopic patients and controls to study the in vitro induction of surface Fas receptor. Two x 106/ml PBMC were seeded in plastic culture wells in the presence of anti-CD3 (ATCC, Rockville; 25 ng/ml) + rIL-2 or DP1 for 72 h. Cells were harvested at regular intervals, washed in PBS, and stained for the coexpression of CD3 and Fas antigens by double-color immunofluorescence and flow cytometry. *P < 0.01 and **P < 0.05 with respect to cultures stimulated with allergen.

View larger version (23K): [in this window] [in a new window]   Figure 2. Fas-induced programmed cell death. Functional activity of membrane Fas receptor was investigated by inducing programmed cell death in allergen- and anti-CD3-activated T cells. Bulk cultures were stimulated for 24 h with purified allergen (DP1) or anti-CD3 + IL-2, then washed and exposed to an IgM anti-Fas mAb (clone CH11, Immunotech; 100 ng/ml). After an additional 18 h, cells were stained with propidium iodide to assess the percentage of apoptotic nuclei. Lymphocytes from asthmatic patients and controls showed a significant (*P<0.05) percentage of hypodiploid DNA compared to those unstimulated or exposed to DP1 allergen.

To address this, experiments were performed with purified peripheral blood CD4⁺ T cells exposed in vitro to various cytokine mixtures. Results obtained in both asthmatic patients and controls seem to indicate that only Th2-type cytokines (IL-5, GM-CSF, and IL-4) can substantially inhibit Fas mRNA on cultured T cells ( Fig. 3). This effect is dose dependent and specific, since it was not observed after incubation with IL-2, interferon (IFN-), or transforming growth factor ß₁ (TGF-ß₁) ( Fig. 4) and did not affect other mRNAs, such as that for FasL. In addition, the cytokine concentration must be maintained during culture by adding, at regular intervals, almost half of the initial dose in order to mimic conditions presumably occurring in vivo in the inflamed tissues. Addition of Th2 cytokines only at the start of the culture determined a transitory inhibition of Fas mRNA that was promptly reversed during the next 24 h (data not shown). Similar results have been also observed in atopic nonasthmatic controls (F. Spinozzi, unpublished observations).

View larger version (30K): [in this window] [in a new window]   Figure 3. Modulation of Fas and FasL mRNA by Th2-type cytokines. CD4+ peripheral blood T lymphocytes were enriched by negative magnetic selection using a mixture of anti-CD8, anti-CD16, and anti-CD19 mAb (Immunotech), followed by incubation with anti-mouse IgG conjugated to magnetic beads (Dynal A.S., Oslo, Norway). PBMC, depleted of adherent cells by 6 h incubation on plastic petri dishes at 37°C in humidified atmosphere at 5% CO2, were incubated on ice with mAb for 45 min. After washing, cells were mixed with an optimal concentration of sheep anti-mouse IgG coated with magnetic beads (1 mg of suspension for 107 cells) and passed over a magnet (Dynal) for two consecutive cycles. Recovered cells consisted of >95% CD4+ lymphocytes and were used for experimental procedures. Plastic plates (Nunc) were coated overnight with anti-CD3 mAb (ATCC; 25 µg/ml) and used for culturing CD4+ cells with cytokines. Control wells consisted of stimulated cells plus IL-2 (50 IU/ml), and Th2-type cytokines were added at the following concentrations: 400 IU/ml IL-4 (Genzyme, Geneva, Switzerland); 5 ng/ml IL-5 (Celbio, Milano, Italy); 50 µg/ml GM-CSF (Schering-Plough, Milano, Italy). All cytokines were renewed at regular intervals (24 h) during culture (72 h) by adding one-half of the initial concentration. At the end of the culture, cells were harvested and subjected to RNA extraction and RT-PCR.

View larger version (25K): [in this window] [in a new window]   Figure 4. Modulation of Fas and FasL mRNA by Th1-type cytokines. Purified CD4+ cells (obtained as described above) were cultured on anti-CD3-coated plastic wells and incubated with IL-2 (50 IU/ml), IFN- (Genentech, San Francisco, Calif.; 10 IU/ml), and TGF-ß1 (British Biotechnology, Abington, U.K.; 10 µg/ml). All cytokines were renewed at regular intervals (24 h) during culture time (72 h) by adding one-half of the initial concentration. At the end of the culture, cells were harvested and processed for RNA extraction and RT-PCR.

Both IL-2 and IL-4 share a -chain signaling component that has been found to up-regulate Bcl-2 and Bcl-x expression, thus preventing apoptosis in T lymphocytes (29–31). The regulation of Fas receptor seems to follow a different pattern, as demonstrated in the present study. In fact, IL-2, like other Th1-type cytokines, when added to in vitro cultures persistently up-regulates Fas mRNA. In T cells, this pathway is induced by repeated activation, is potentiated by IL-2, and is not yet prevented by constitutive expression of Bcl-2 or Bcl-x_L (32). Moreover, targeted disruption of the IL-2 gene does not lead to profound immunodeficiency but to uncontrolled accumulation of activated lymphocytes and manifestations of autoimmunity (33). Mice lacking the high-affinity IL-2 receptor show the same phenotypic abnormalities (34). These results suggest that IL-2 is a necessary feedback inhibitor of lymphocyte responses, and its role as a growth factor can be replaced by other cytokines (32). The control of potentially harmful T cell and macrophage reactions by immunosuppressive cytokines is important to limit the consequences of immune responses, because mice with targeted disruptions of TGF-ß₁ develop uncontrolled leukocyte activation and tissue injury (35). On the other hand, GM-CSF and IL-5 obtained by BAL from asthmatic patients have been shown to prolong eosinophil survival in vitro, presumably by interfering with surface Fas expression, which increases in parallel with cytokine withdrawal (36, 37). Similarly, the anti-apoptotic properties of IL-4 have been described in various experimental models (38, 39). Finally, transgenic mice expressing IL-4 in the lung show an impressive increase in the percentages of pulmonary lymphocytes, eosinophils, and neutrophils (40). The extreme sensitivity of mucosal T cells from asthmatic patients to the biological effects of IL-4, which is presumably produced in large amounts during allergic inflammation, can explain the fact that normal pulmonary T cells were relatively insensitive to the inhibitory effect of IL-4 on Fas molecule expression (20).

The complex cellular and biochemical interactions that govern the lung inflammatory response in allergic asthma have been clarified in recent years by the demonstration that T lymphocytes play a fundamental role in orchestrating both the early recognition and the subsequent immune response to allergens (1, 12, 26–28). It is possible to hypothesize that this main biological function of Th2 cytokines in the inflamed airways of allergic subjects could be due to a prolonged survival of resident immunocompetent cells; the biochemical mechanism of this phenomenon could be driven by the down-regulation of Fas mRNA, as demonstrated here with in vitro cultured T lymphocytes. The subsequent failure to express Fas receptor protects these cells, and probably eosinophils, from activation-induced death and determines the self-perpetuation of mucosal inflammatory response during allergen exposure. In an experimental mouse model, the elimination of particulate inhaled antigens from the airways occurred through induction of programmed cell death via Fas/FasL interaction in pulmonary T cells (18). A similar mechanism may exist in normal subjects, as suggested by our phenotypic and functional studies (20). Allergic subjects may have defective activation-induced death; thus, the clinical remission of symptoms invariably occurs with allergen avoidance (27) or by therapeutical interventions able to induce programmed cell death of allergen-specific T cells, such as corticosteroids (41, 42). Novel therapeutic strategies to restore the Fas/FasL interactions at the mucosal level are needed for a more targeted molecular approach to the therapy of respiratory allergic diseases.

	FOOTNOTES

 
¹ Correspondence: Laboratory of Allergy and Clinical Immunology, Institute of Internal Medicine and Oncological Sciences, Policlinico Monteluce, 06122 Perugia, Italy. E-mail: spinozzi{at}unipg.it

² Abbreviations: bp, base pair; FEV₁, forced expiratory volume in 1 s; FITC, fluorescein; GM-CSF, granulocyte-macrophage colony-stimulating factor; IFN, interferon; IgM, immunoglobulin; IL, interleukin; mAb's, monoclonal antibodies; PBMC, peripheral blood mononuclear cells; RT-PCR, reverse transcription-polymerase chain reaction; TGF-ß₁, transforming growth factor; Th, T-helper.

Received for publication May 25, 1998. Revision received July 14, 1998.

	REFERENCES

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS AND DISCUSSION REFERENCES

 

1. Romagnani, S. (1994) Lymphokine production by human T cells in disease states. Annu. Rev. Immunol. 12, 227–257[Medline]
2. Abbas, A. K. (1996) Die and let live: eliminating dangerous lymphocytes. Cell 84, 655–657[Medline]
3. Nagata, S., and Golstein, P. (1995) The Fas death factor. Science 267, 1449–1455[Abstract/Free Full Text]
4. Lynch, D. H., Ramsdell, F., and Alderson, M. R. (1995) Fas and FasL in the homeostatic regulation of immune responses. Immunol. Today 16, 569–574[Medline]
5. Carson, D. A ., Ribeiro, J. R. (1993) Apoptosis and disease. Lancet 341, 1251–1254[Medline]
6. Mysler, E., Bini, P., Drappa, J., Ramos, P., Friedman, S. M., Krammer, P. H., and Elkon, K. B. (1994) The APO-1/Fas protein in human systemic lupus erythematosus. J. Clin. Invest. 93, 1029–1034
7. Drappa, J., Vaishnaw, A. K., Sullivan, K. E., Chu, J .L., Elkon, and K. B. (1996) The Canale Smith syndrome: an inherited autoimmune disorder associated with defective lymphocyte apoptosis and mutations in the Fas gene. N. Engl. J. Med. 335, 1643–1649[Abstract/Free Full Text]
8. Vaishnaw, A. K., McNally, J. D., and Elkon, K. B. (1997) Apoptosis in the rheumatic diseases. Art. Rheum. 40, 1917–1927[Medline]
9. Giordano, C., Stassi, G., de Maria, R., Todaro, M., Richiusa, P., Papoff, G., Ruberti, G., Bagnasco, M., Testi, R., and Galluzzo, A. (1997) Potential involvement of Fas and its ligand in the pathogenesis of Hashimoto's thyroiditis. Science 275, 960–963[Abstract/Free Full Text]
10. Chervonsky, A. V., Wang, Y., Wong, S. F., Visintin, I., Flavell, R. A., Janeway, C. A., and Matis, L. A. (1997) The role of Fas in autoimmune diabetes. Cell 89, 17–24[Medline]
11. Kong, L., Ogawa, N., Nakabayashi, T., Liu, G. T., D'Souza, E., McGuff, H. S., Guerrero, D., Talal, N., and Dang, H. (1997) Fas and Fas ligand expression in the salivary glands of patients with primary Sjögren's syndrome. Art. Rheum. 40, 87–97[Medline]
12. Spinozzi, F., Agea, E., Bistoni, O., Forenza, N., and Bertotto, A. (1998) T cells, allergen recognition and airway inflammation. Immunol. Today 19, 22–26[Medline]
13. Bendelac, A. (1995) CD1: presenting "unusual" antigens to "unusual" T lymphocytes. Science 269, 185–186[Free Full Text]
14. De Libero, G. (1997) Sentinel function of broadly reactive T cells. Immunol. Today 18, 22–26[Medline]
15. Spinozzi, F., Agea, E., Bistoni, O., Forenza, N., Monaco, A., Falini, B., Bassotti, G., De Benedictis, F., Grignani, F., and Bertotto, A. (1995) Local expansion of allergen-specific CD30⁺ Th2-type T cells in bronchial asthma. Mol. Med. 1, 821–826[Medline]
16. Mosmann, T. R., and Sad, S. (1996) The expanding universe of T-cell subsets: Th1, Th2 and more. Immunol. Today 17, 138–146[Medline]
17. Wen, L., Barber, D. F., Pao, W., Wong, F. S., Owen, M. J., and Hayday, A. (1998) Primary cell clones can be defined phenotypically and functionally as Th1/Th2 cells and illustrate the association of CD4 with Th2 differentiation. J. Immunol. 160, 1965–1974[Abstract/Free Full Text]
18. Milik, A. M., Buechner-Maxwell, V. A., Sonstein, J., Kim, S., Seitzman, G. D., Beals, T. F., and Curtis, J. L. (1997) Lung lymphocyte elimination by apoptosis in the murine response to intratracheal particulate antigen. J. Clin. Invest. 99, 1082–1091[Medline]
19. De Maria, R., Boirivant, M., and Cifone, M. G. M., et al. (1996) Functional expression of Fas and Fas ligand on human gut lamina propria T lymphocytes. A potential role for the acid sphingomyelinase pathway in normal immunoregulation. J. Clin. Invest. 97, 316–322[Medline]
20. Spinozzi, F., Fizzotti, M., Agea, E., Piattoni, S., Droetto, S., Russano, A., Forenza, N., Bassotti, G., Grignani, F., and Bertotto, A. (1998) Defective expression of Fas messenger RNA and Fas receptor on pulmonary T cells from patients with asthma. Ann. Int. Med. 128, 363–369[Abstract/Free Full Text]
21. Sandford, A., Weir, T., and Paré, P. (1996) The genetics of asthma. Am J. Resp. Crit. Care Med. 153, 1794–1765
22. Marsh, D. G., Neely, J. D., Breazeale, D. R., Ghosh, B., Freidhoff, L. R., Ehrlich-Kautzky, E., Schou, C., Krihnaswamy, G., and Beaty, T. H. (1994) Linkage analysis of IL-4 and other chromosome 5q31.1 markers and total serum immunoglobulin E concentrations. Science 264, 1152–1156[Abstract/Free Full Text]
23. Postma, D. S., Bleecker, E. R., Amelung, P. J., Holroyd, K. J., Xu, J., Panhuysen, C. I. M., Meyers, D. A., and Levitt, R. C. (1995) Genetic susceptibility to asthma-bronchial hyperresponsiveness coinherited with a major gene for atopy. N. Engl. J. Med. 333, 894–900[Abstract/Free Full Text]
24. Behrrmann, I., Walczak, S., and Krammer, P. H. (1994) Structure of the human APO-1 gene. Eur. J. Immunol. 24, 3057–3062[Medline]
25. Wong, B., Arron, J., and Choi, Y. (1997) T cell receptor signals enhance susceptibility to Fas-mediated apoptosis. J. Exp. Med. 186, 1939–1944[Abstract/Free Full Text]
26. Kay, A. B., Ying, S., Humbert, M., Barkans, J., Corrigan, C. J., Pfister, R., Menz, G., Larché, M., Robinson, D. S., and Durham, S. R. (1997) The molecular immunopathology of atopic and nonatopic asthma. Prog. Allergy Clin. Immunol. 4, 396–399
27. Holgate, S. T. (1997) The cellular and mediator basis of asthma in relation to natural history. Lancet 350 (Suppl. II), SII5–SII9
28. Ricci, M., Matucci, A., and Rossi, O. (1997) Pathogenetic mechanisms and genetic aspects of bronchial asthma. ACI Int. 9/5, 141–148
29. Akbar, A. N., Borthwick, N. J., Wickremaisinghe, R. G., Panayoitidis, P., Pilling, D., Bofill, M., Krajewski, S., Reed, J. C., and Salmon, M. (1996) Interleukin-2 receptor common gamma-chain signaling cytokines regulate activated T cell apoptosis in response to growth factor withdrawal: selective induction of anti-apoptotic (Bcl-2, Bcl-x_L) but no pro-apoptotic (Bax, Bcl-x_S1) gene expression. Eur. J. Immunol. 26, 294–299[Medline]
30. Vella, A., Teague, T. K., Ihle, J., Kappler, J., and Marrack, P. (1997) Interleukin 4 (IL-4) or IL-7 prevents the death of resting T cells: stat-6 is probably not required for the effect. J. Exp. Med. 186, 325–330[Abstract/Free Full Text]
31. Vella, A. T., Dow, S., Potter, T. A., Kappler, J., and Marrack, P. A. (1998) Cytokine-induced survival of activated T cells in vitro and in vivo. Proc. Natl. Acad. Sci. USA 95, 3810–3815[Abstract/Free Full Text]
32. Van Parijs, L., and Abbas, A. K. (1998) Homeostasis and self-tolerance in the immune system: turning lymphocytes off. Science 280, 243–248[Abstract/Free Full Text]
33. Sadlack, B., Merz, H., Schorle, H., Schimpl, A., Ferrel, A. C., and Horak, I. (1993) Ulcerative colitis-like disease in mice with a disrupted interleukin-2 gene. Cell 75, 253–261[Medline]
34. Suzuki, H., Kundig, T. M., Furlonger, C., Wakeham, A., Timms, E., Matsuyama, T., Schmits, R., Simard, J. J., Ohashi, P. S., and Griesser, H. (1995) Deregulated T cell activation and autoimmunity in mice lacking interleukin-2 receptor beta. Science 268, 1472–1476[Abstract/Free Full Text]
35. Shull, M. M., Ormsby, I., Kier, A. B., Pawlowski, S., Diebold, R. J., Yin, M., Allen, R., Sidman, C., Proetzel, G., and Calvin, D. (1992) Targeted disruption of the mouse transforming growth factor-beta 1 gene results in multifocal inflammatory disease. Nature (London) 359, 693–697[Medline]
36. Adachi, T., Motojima, S., Hirata, A., Fukuda, T., and Makino, S. (1995) Eosinophil viability-enhancing activity in sputum from patients with bronchial asthma, contribution of interleukin-5 and granulocyte-macrophage colony-stimulating factor. Am. J. Resp. Crit. Care Med. 151, 618–623[Abstract]
37. Druilhe, A., Cai, Z., Hailé, S., Chouaib, S., and Pretolani, M. (1996) Fas-mediated apoptosis in cultured human eosinophils. Blood 87, 2822–2830[Abstract/Free Full Text]
38. Migliorati, G., Nicoletti, I., Pagliacci, M.C., D'Adamio, L., and Riccardi, C. (1993) Interleukin-4 protects double-negative and CD4 single-positive thymocytes from dexamethasone-induced apoptosis. Blood 81, 1352–1358[Abstract/Free Full Text]
39. Spinozzi, F., Nicoletti, I., Agea, E., Belia, S., Moraca, R., Migliorati, G., Riccardi C., Grignani, F., and Bertotto, A. (1995) IL-4 is able to reverse CD2-mediated negative apoptotic signal to CD4-CD8- ß and/or T cells. Immunology 86, 379–384[Medline]
40. Rankin, J. A., Picarella, D. E., Geba, G. P., Temann, U. A., Prasad, B., DiCosmo, B., Tarallo, A., Stripp, B., Whitsett, J., and Flavell, R. A. (1996) Phenotypic and physiologic characterization of transgenic mice expressing interleukin 4 in the lung: lymphocytic and eosinophilic inflammation without airway hyperreactivity. Proc. Natl. Acad. Sci. USA 93, 7821–7825[Abstract/Free Full Text]
41. Spinozzi, F., Agea, E., Bistoni, O., Travetti, A. M., Migliorati, G., Moraca, R., Nicoletti, I., Riccardi, C., Paoletti, C., and Vaccaro, R. (1995) T lymphocytes bearing the T-cell receptor are susceptible to steroid-induced programmed cell death. Scand. J. Immunol. 41, 504–508[Medline]
42. Spinozzi, F., Agea, E., Bistoni, O., Forenza, N., Monaco, A., Bassotti, G., Nicoletti, I., Riccardi, C., Grignani, F., and Bertotto, A. (1996) Increased allergen-specific, steroid-sensitive T cells in bronchoalveolar lavage fluid from patients with asthma. Ann. Int. Med. 124, 223–227[Abstract/Free Full Text]

This article has been cited by other articles:

				K. J. Rautajoki, E. M. Marttila, T. A. Nyman, and R. Lahesmaa Interleukin-4 Inhibits Caspase-3 by Regulating Several Proteins in the Fas Pathway during Initial Stages of Human T Helper 2 Cell Differentiation Mol. Cell. Proteomics, February 1, 2007; 6(2): 238 - 251. [Abstract] [Full Text] [PDF]

				G. D'Argenio, M. Calvani, A. Casamassimi, O. Petillo, S. Margarucci, M. Rienzo, I. Peluso, R. Calvani, A. Ciccodicola, N. Caporaso, et al. Experimental colitis: decreased Octn2 and Atb0+ expression in rat colonocytes induces carnitine depletion that is reversible by carnitine-loaded liposomes FASEB J, December 1, 2006; 20(14): 2544 - 2546. [Abstract] [Full Text] [PDF]

				X. Wu, M. A. McKenna, X. Feng, T. R. Nagy, and J. M. McDonald Osteoclast Apoptosis: The Role of Fas in Vivo and in Vitro Endocrinology, December 1, 2003; 144(12): 5545 - 5555. [Abstract] [Full Text] [PDF]

				I. Hussain and J. Smith Evidence for the Transmissibility of Atopy: Hypothesis Chest, November 1, 2003; 124(5): 1968 - 1974. [Abstract] [Full Text] [PDF]

				P. Rosignoli, R. Fabiani, A. De Bartolomeo, F. Spinozzi, E. Agea, M.A. Pelli, and G. Morozzi Protective activity of butyrate on hydrogen peroxide-induced DNA damage in isolated human colonocytes and HT29 tumour cells Carcinogenesis, October 1, 2001; 22(10): 1675 - 1680. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Free Alert me when this article is cited Alert me if a correction is posted Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Spinozzi, F. Articles by Bertotto, A. Search for Related Content PubMed PubMed Citation Articles by Spinozzi, F. Articles by Bertotto, A.