(The FASEB Journal. 1998;12:1725-1730.)
© 1998 FASEB
Increased expression of prohormone convertase-2 in the irradiated rat brain
Florence Noela,
Glenice J. Gumina,
Uma Rajua and
Philip J. Tofilona,b,1
a Departments of Experimental Radiation Oncology, The University of Texas M. D. Anderson Cancer Center, Houston, Texas 77030, USA
b Department of Neurosurgery, The University of Texas M. D. Anderson Cancer Center, Houston, Texas 77030, USA
 |
ABSTRACT
|
|---|
Changes in gene expression have been suggested to play a role in radiotherapy-induced central nervous system (CNS) injury. To begin to identify radiation-inducible genes in the CNS, we have applied the differential display of reverse transcription-polymerase chain reaction products to RNA extracted from the brain of adult rats. RNA was isolated from a rat brain 6 h after whole-body exposure to 10 Gy and compared with RNA from unirradiated brain. A cDNA band was consistently observed at about 600 bp in samples from the irradiated rat but not from unirradiated (control) rat. Amplification and sequencing of the cDNA revealed that it corresponded to the prohormone convertase-2 (PC2) gene, which is involved in the processing of inert prohormones and neuropeptides to their bioactive forms. Enhanced PC2 expression was detected after irradiation of neuronal cultures but not in cultures of astrocytes, suggesting that the cell type in the CNS responsible for the PC2 induction after in vivo irradiation is the neuron. These results indicate that radiation induces the expression of a neuronal enzyme that is critical to the activation of a number of prohormones and neuropeptides, which may influence the radioresponse of the CNS.Noel, F., Gumin, G. J., Raju, U., Tofilon, P. J. Increased expression of prohormone convertase-2 in the irradiated rat brain. FASEB J. 12, 17251730 (1998)
Key Words: radiation CNS neuron PC2 differential display
 |
INTRODUCTION
|
|---|
THE POTENTIAL FOR central nervous system (CNS)2 injury is a major limitation to the use of radiation as a brain tumor treatment modality. Although CNS damage occurring after irradiation has been well described in terms of histological and functional criteria (1, 2), the actual pathological processes mediating this form of normal-tissue injury remain poorly defined. Noting that the histological characteristics of radiation-induced CNS lesions are not unique and are actually similar to those occurring after other types of injury, Schulteiss and Stephens (1) have suggested that the radioresponse of the CNS and its reaction to other types of insults may have similar components. After other types of CNS injury, such as that occurring after trauma or ischemia, modifications in the expression of genes coding for a variety of cytokines and bioactive molecules can be detected (35). These changes in gene expression are generally considered to play a role in the CNS response to and recovery from these forms of injury (6).
The consequences of exposure to ionizing radiation can, in addition to cell death, also include the induction of certain genes in surviving cells. The ability of radiation to modulate gene expression has been suggested to be of particular relevance to the normal-tissue injury that can result from radiotherapy. After irradiation of normal cells and tissues, genes reported to be induced include those coding for tumor necrosis factor
(TNF
), interleukin 1
(IL-1ß), IL-6, tumor growth factor ß (TGF-ß), and basic fibroblast growth factor (711). These cytokines have a wide variety of cell type-dependent biological activities, and increases in their production can be expected to influence cells located both inside and outside the radiation field. Although specific effects have yet to be defined, it appears reasonable to speculate that radiation-induced gene expression may play a critical role in determining the response of normal tissue to radiotherapy.
With respect to the CNS, radiation has been shown to affect the expression of a number of genes and transcription factors in vitro when using cultures of normal rat astrocytes (1214). Hong and colleagues (15), however, have shown that gene induction also occurs in vivo by demonstrating the increased expression of TNF
, IL-1ß, and intracellular adhesion molecule in the mouse brain after irradiation. Given the already established association between gene induction and the CNS response to other types of injury, we have begun to more systematically define the changes in gene expression that occur after brain irradiation. To this end, we have applied the technique of differential display of reverse transcription-polymerase chain reaction (RT-PCR) products to the adult rat brain. As described here, these studies have led to the identification of a novel radiation-inducible gene (prohormone convertase-2, PC2) in brain (in vivo) and in cortical neurons (in vitro).
 |
METHODS
|
|---|
Rat irradiation
Sprague Dawley rats were anesthetized with an intramuscular injection of a solution of ketamine (6.36 mg/ml), xylazine (3.6 mg/ml), and atropine (0.67 mg/ml) at 0.15 ml per 100 g of body weight) and exposed to specified doses of whole-body irradiation using 137Cs (3.8 Gy/min) as the source. At different times postirradiation, animals were decapitated and the whole brain was removed, frozen in liquid nitrogen, and stored at -80°C until used in an experiment.
RNA extraction
Poly(A)RNA was extracted from the whole brain using poly(A)Pure kit (Ambion, Inc., Austin, Tex.) according to manufacturer's instructions. Total RNA from whole brain and cultured neurons was extracted using RNAZol B (Cinna/Biotecx Laboratories, Friendswood, Tex.) according to the instructions of the manufacturer.
Differential display
Differential display analysis was performed using the Hieroglyph mRNA profile system (Genomyx, San Francisco, Calif.). Briefly, experimental and control whole brain total RNA was treated with RNase-free DNase I. Experimental and control total RNA (0.2 µg) was reverse transcribed in the presence of T7(dT12)-anchored primer (ACGACTCACTATAGGGC-TTTTTTTTTTTTGA), followed by PCR amplification using the T7(dT12)-anchored primer and a M13r arbitrary primer (ACAATTTCACACAGGACGACTCCAAG) in the presence of [33P]dATP. Amplifications were performed in duplicate as a measure of reproducibility. The PCR-amplified products were separated on a denaturing 4.5% polyacrylamide gel using a high-resolution, differential display, gel electrophoresis system (genomyxLR DNA sequencer; Genomyx). Differentially expressed mRNA was extracted from the gel, PCR amplified using M13 reverse and T7 promoter primers, and cloned into the pCR 2.1 vector using a TA cloning kit (Invitrogen, Carlsbad, Calif.).
Northern blot analysis
Northern blot analysis was performed as previously described (16). A cDNA probe that encodes for 1E1 was prepared from a 1E1 containing clone. A cDNA probe coding for PC1 was kindly provided by Dr. T. P. Davis (Department of Pharmacology, College of Medicine, University of Arizona, Tucson, Ariz.). An elongation factor (EF1-
) cDNA probe, kindly provided by Dr. M. Frazier (The University of Texas M. D. Anderson Cancer Center, Houston, Tex.) was used as a control for even loading. The results were analyzed using a PhosphorImager (Molecular Dynamics, Sunnyvale, Calif.).
DNA sequencing and sequence analysis
DNA sequencing was performed with M13 reverse and T7 promoter primers using a Perkin Elmer Cetus 377 automatic sequencer (Perkin Elmer Cetus, Norwalk, Conn.). These sequences were compared with known sequences in DataBank of Japan (DDBJ), the European Molecular Biology Laboratory, and GenBank at the National Center for Biotechnology Information.
Primary cultures of cortical neurons and astrocytes
Embryonic cortical neuron cultures were prepared as previously described (17). Briefly, embryos (E18) were collected by cesarean section from anesthetized timed pregnant Sprague Dawley rats. Cells from cerebral cortexes were dissociated and plated in poly-D-lysine-coated 6-well plates (2x10 cells per well) and cultured in Neurobasal medium supplemented with 0.5 mM glutamine, 25 µM glutamate, and B27 supplement (Life Technologies, Inc., Grand Island, N.Y.). On day 6, in vitro cultures were irradiated. Type 1 astrocyte cultures were prepared from the cerebral cortex of prenatal (E20) Sprague-Dawley rats, as previously described (12).
 |
RESULTS
|
|---|
Total RNA was extracted from the brain of an adult rat 6 h after whole-body irradiation with 10 Gy and from a control animal (anesthetized but not irradiated), and analyzed using differential display RT-PCR. A portion of the differential display pattern of mRNA from irradiated (E) and nonirradiated (C) brain is shown in
Fig. 1A.
At about 600 bp, a cDNA band was present in the samples from the irradiated animal for which there was no corresponding counterpart in the control samples. This band (referred to as 1E1) was eluded from the gel, and the cDNA product was amplified by PCR and cloned into the pCR II vector. To confirm the differential expression of this mRNA species, Northern blot analysis was performed using the 1E1 cDNA as a probe. Poly(A)RNA was isolated from the brain of control and irradiated rats 6 h after 10 Gy irradiation. As shown in
Fig. 1B, 1E1 hybridization resulted in the detection of two bands at approximately 5 and 3 kb on the Northern blot. However, in the sample isolated from the irradiated rat, the expression of both the top and lower bands was increased. This experiment was performed twice with similar results obtained. These data indicate that 1E1 corresponds to a radiation-inducible gene.

View larger version (61K):
[in this window]
[in a new window]
|
Figure 1. Differential display and Northern blot analysis of 1E1 from rat brain 6 h after whole-body exposure to 10 Gy (E) and from nonirradiated control brain (C). A) Products of RT- PCR amplification from E and C total RNA. Arrow indicates the amplified product of interest (1E1) differentially expressed after irradiation. B) Northern analysis of 1E1 expression. 3 µg of whole-brain poly(A) RNA was loaded on each lane and the reamplified 1E1 used as a probe. EF1- was used as a control for gel loading. This experiment was performed twice and a representative blot is shown.
|
|
To determine whether the 1E1 cDNA is a known gene, the cloned cDNA fragment was sequenced and compared with nucleic acid databases using the BLAST Server network service. The 1E1 cDNA was found to have 97% sequence homology over a 507 bp region to the rat prohormone convertase-2 (PC2) sequence (18). The 1E1 sequence overlaps with the 3' end of the coding sequence of PC2 and a portion of its noncoding sequence. As for 1E1 (
Fig. 1B), Northern blot analysis for PC2 has been reported to result in the detection of two mRNA species corresponding to 5 and 2.8 kb, respectively (19). Thus, the radiation-inducible brain mRNA identified in the differential display analysis shown in
Fig. 1A and referred to as 1E1 corresponds to PC2.
To further define the effects of radiation on PC2 expression in the CNS, total RNA was isolated from the brain at different times after 10 Gy and subjected to Northern blot analysis using the original 1E1 cDNA as a probe. As shown in
Fig. 2,
PC2 mRNA levels increased by 6 h after irradiation and remained elevated above unirradiated levels for at least 16 h. This experiment was performed twice with similar results obtained. The dose dependency of PC2 induction in the brain was determined 6 h after whole-body exposure to graded doses of radiation (
Fig. 3).
PC2 expression was induced at a dose of only 2 Gy, with no obvious additional induction at 10 Gy. These data indicate that PC2 expression in the rat brain is induced in a time-dependent manner using clinically relevant doses of radiation. Note that the radiation inducibility of PC2 does not apply to all convertases in the brain in that the expression of PC1 in the rat brain is not affected by radiation (data not shown).

View larger version (70K):
[in this window]
[in a new window]
|
Figure 2. PC2 expression in rat brain as a function of time after whole-body radiation exposure. Total RNA was extracted from the brain at the indicated times after 10 Gy; 15 µg of whole-brain total RNA was loaded on each lane. EF1- was used as a control for gel loading. Each time point represents an individual rat. This experiment was performed twice and a representative blot is shown.
|
|

View larger version (56K):
[in this window]
[in a new window]
|
Figure 3. PC2 expression in rat brain as a function of radiation dose. Total RNA was extracted from whole brain 6 h after whole-body irradiation at the indicated doses; 15 µg of whole-brain total RNA was loaded on each lane. EF1- was used as a control for gel loading. Each time point represents an individual rat. This experiment was performed twice and a representative blot is shown.
|
|
Evaluation of gene expression in the CNS using Northern blot analysis provides no information as to which of the neural phenotypes are involved in PC2 expression. To gain insight into the expression and induction of this gene in specific cell types, primary cultures of astrocytes and of cortical neurons were evaluated for PC2 expression at various times after irradiation (10 Gy). For astrocytes, PC2 expression was not detectable in control or irradiated cultures (data not shown). In contrast, a low level of PC2 expression was detectable in neuron cultures (
Fig. 4),
which was clearly inducible, reaching a maximum increase 2 h after irradiation. These results suggest that neurons and not astrocytes are responsible for the PC2 expression induced in the CNS after in vivo irradiation. This role of neurons as a target cell population is consistent with previous reports indicating that in the brain, PC2 expression is primarily limited to neurons (20, 21).

View larger version (99K):
[in this window]
[in a new window]
|
Figure 4. Influence of radiation on PC2 mRNA expression in cortical neuron cultures. On day 6 in vitro primary cultures of cortical neurons were exposed to 10 Gy and total RNA was extracted at the indicated times; 15 µg of total RNA was loaded on each lane. EF1- was used as a control for gel loading.
|
|
PC2 in the CNS has been most often studied in neuroendocrine cells of the pituitary gland. In the experiments described above, the tissue preparations used to evaluate PC2 expression were generated from brain only and did not include the pituitary gland. To evaluate the effects of radiation on PC2 expression in the pituitary gland, rats were exposed to 10 Gy radiation and the pituitary gland was extracted 6 h later and subjected to Northern blot analysis. As shown in
Fig. 5,
PC2 is expressed at relatively high levels in the rat pituitary gland, which is consistent with previous reports (19), and irradiation had no effect on the expression level. These results suggest that, in contrast to neurons of the CNS, the neuroendocrine cells of the pituitary, although expressing relatively large levels of PC2, are not susceptible to radiation-mediated enhancement of PC2 expression.

View larger version (48K):
[in this window]
[in a new window]
|
Figure 5. PC2 expression in the pituitary gland. Total RNA was extracted from the pituitary gland either 6 h after whole-body irradiation (10 Gy) (E) or from nonirradiated control rats (C); 15 µg of pituitary gland total RNA was loaded on each lane. EF1- was used as a control for gel loading. This experiment was performed twice and a representative blot is shown.
|
|
 |
DISCUSSION
|
|---|
The data presented here describe the identification of PC2 as a radiation-inducible gene in the adult rat brain. Although its biological significance remains to be determined, PC2 represents a novel class of radiation-inducible genes in that it is not a cytokine or growth factor but rather an enzyme essential to the processing of a wide variety of bioactive molecules. PC2 is a member of the family of mammalian subtilisin/kexin-like endoproteases referred to as prohormone convertases (PCs). These enzymes cleave at specific single or paired basic amino acids (22, 23) and are critical in the posttranslational processing of large, inert proproteins into biologically active peptides. PCs have been shown to be involved in the processing of a number of neuropeptides, hormones, and growth factors including ß-endorphin, enkephalins, dynorphin, somatostatin, insulin, glucagon, brain-derived neurotrophic factor, and nerve growth factor (reviewed in ref 23). To date, seven members of the PC family have been identified. Each PC has a fairly unique expression pattern in vivo (19, 23, 24), suggesting a tissue-specific function with respect to proprotein processing.
PC2 is the most abundant of the PCs found in brain (19) and is preferentially expressed in neurons and the neuroendocrine cells of the pituitary gland. In addition to the processing of prohormones such as proinsulin, proglucagon, and the prolutenizing hormone-releasing hormone (proLHRH), PC2 also has been shown to be involved in generation of opioid peptides from the protein precursors proopiomelanocortin, proenkephalin, and prodynorphin (2527). Unlike the constitutively expressed PCs furin and PACE4, PC2 expression is subject to pharmacological and presumably physiological modulation. The dopamine antagonist haloperidol was reported to increase PC2 expression, whereas the dopamine agonist bromocriptine reduced PC2 expression in the neurointermediate pituitary (28, 29). PC2 was also responsive to dexamethasone in AtT-20 cell lines (29). Indeed, recent investigations have suggested that changes in PC2 activity may serve as a mechanism for regulating the production of neuropeptides and, specifically, opioid peptides (27, 28). The data presented here indicate that PC2 expression in the brain can be increased by ionizing radiation.
In contrast to the brain, PC2 expression in the pituitary gland after irradiation was not affected. This may be due to the already high level of PC2 expression in the neuroendocrine cells of the unirradiated pituitary gland as compared with the brain. Regardless, the different levels of PC2 mRNA in the brain and pituitary as well as the differential effects of radiation are consistent with the tissue/cell-specific regulation of PC expression (19).
The critical role of PC2 in the processing of a number of prohormones and neuropeptides suggests that changes in PC2 activity after irradiation could have a variety of physiological and/or pathological consequences. These changes may include increases in LHRH and somatostatin as well as levels of opioids via the enhanced processing of prodynorphin, proenkephalin, and proopiomelanocortin (2527). Such changes may not only be expected to influence the CNS, but may also exert systemic effects. Furthermore, it could be speculated that the increased generation of these bioactive peptides may be involved in the cognitive deficits and behavioral modifications associated with cranial irradiation (3034). In addition to the direct effects of elevated PC2 levels on proprotein processing, previous studies have shown that the expression of PC2 can be coregulated with its substrates (29). Thus, changes in PC2 expression after irradiation also may be indicative of changes in the expression of its prohormone and neuropeptide substrates in the brain. With respect to normal-tissue injury in general, the radiation-induced expression of a variety of cytokines, growth factors, and other secreted molecules has received considerable attention regarding pathogenesis of the injury and potential recovery processes. However, the finding of induced PC2 expression in the rat brain suggests another level of regulation by which radiation can influence the production of critical bioactive peptides
Radiation-induced CNS injury has been traditionally attributed to glial and/or vascular cell damage. Neurons, in contrast, have been considered radioresistant because of their terminally differentiated, nonproliferative state, and consequently, have received little attention with respect to the radioresponse of the CNS. Recently, however, it has been demonstrated in vitro that clinically relevant radiation exposure levels lead to neuronal cell death (17, 35, 36). The data presented here indicate that neurons, at least in vitro, are susceptible to radiation-induced changes in gene expression, and suggest that neurons and not astrocytes are the source of the induced PC2 expression in vivo. Thus, combined with the previous studies regarding radiation-induced neuronal death, these results indicate that neurons are not inert to radiation and suggest that their response needs to be taken into account in attempts to understand the radioresponse of the CNS.
 |
ACKNOWLEDGMENTS
|
|---|
This study was supported by NIH grants CA72156, CA50207, and CA16672.
 |
FOOTNOTES
|
|---|
1 Correspondence: Department of Experimental Radiation Oncology, Box 66, The University of Texas M. D. Anderson Cancer Center, 1515 Holcombe Blvd., Houston, TX 77030, USA. E-mail: ptofilon{at}notes.mdacc.tmc.edu 
2 Abbreviations: CNS, central nervous system; LHRH, lutenizing hormone-releasing hormone; TNF, tumor necrosis factor; IL, interleukin; TGF, tumor growth factor; RT-PCR, reverse transcription-polymerase chain reaction; PC2, prohormone convertase-2; PCs, prohormone convertases. 
Received for publication May 27, 1998.
Revision received July 24, 1998.
 |
REFERENCES
|
|---|
-
Schultheiss, T. E., and Stephens, L. C. (1992) Permanent radiation myelopathy. Br. J. Radiol. 65, 737753[Abstract/Free Full Text]
-
Schultheiss, T. E., Kun, L. E., Ang, K. K., and Stephens, L. C. (1995) Radiation response of the central nervous system. Int. J. Radiat. Oncol. Biol. Phys. 31, 10931112[Medline]
-
Logan, A., and Berry, M. (1993) Transforming growth factor ß1 and basic fibroblast growth factor in the injured CNS. Trends Pharmacol. Sci. 14, 337343[Medline]
-
Lotan, M., and Schwartz, M. (1992) Postinjury changes in platelet-derived growth factor-like activity in fish and rat optic nerve. J. Neurochem. 58, 16371642[Medline]
-
Yan, H. Q., Barnes, M. A., Herregodts, P., Hooghe, R., and Hooghe-Peters, E. (1992) Expression of IL-1b, IL6 and their respective receptors in normal rat brain and after injury. Eur. J. Immunol. 22, 29632971[Medline]
-
Eddleston, M., and Mucke, L. (1993) Commentary: Molecular profile of reactive astrocytes, implications for their role in neurologic disease. Neuroscience 54, 1536[Medline]
-
Witte, L., Fuks, Z., Haimovitz-Friedman, A., Vlodavsky, I., Goodman, D. S., and Edlor, A. (1989) Effects of irradiation on the release of growth factor from cultured bovine, porcine and human endothelial cells. Cancer Res. 49, 50665072[Abstract/Free Full Text]
-
Barcellos-Hoff, M. H. (1993) Radiation-induced transforming growth factor and subsequent extracellular matrix reorganization in murine mammary gland. Cancer Res. 53, 38803886[Abstract/Free Full Text]
-
Martin, M., Lefaix, J.-L., Pinton, P., Crechet, F., and Daburon, F. (1993) Temporal modulation of TGF-ß1 and ß-actin gene expression in pig skin and muscular fibrosis after ionizing radiation. Radiat. Res. 134, 6370[Medline]
-
Rubin, P., Finkelstein, J., and Shapiro, D. (1992) Molecular mechanism in the radiation induction of pulmonary injury syndromes: interrelationship between the alveolar macrophage and the septal fibroblast. Int. J. Radiat. Oncol. Biol. Phys. 24, 93101[Medline]
-
Ishihara, H., Tsuneoka, K., Dimchev, A. B., and Shikita, M. (1993) Induction of the expression of the interleukin-1ß gene in mouse spleen by ionizing radiation. Radiat. Res. 133, 321326[Medline]
-
Noel, F., Ijichi, A., Chen, J. J., Gumin, G. J., and Tofilon, P. J. (1997) X-ray-mediated reduction in basic fibroblast growth factor expression in primary rat astrocyte cultures. Radiat. Res. 147, 484489[Medline]
-
Sakuma, S., Saya, H., Ijichi, A., and Tofilon, P. J. (1995) Radiation induction of the receptor tyrosine kinase gene Ptk-3 in normal rat astrocytes. Radiat. Res. 143, 17[Medline]
-
Vrdoljak, E., Borchardt, P. E., Bill, C. A., Stephens, L. C., and Tofilon, P. J. (1994) Influence of X-rays on early response gene expression in rat astrocytes and brain tumor cell lines. Int. J. Radiat. Biol. 66, 739746[Medline]
-
Hong, J.-H., Chiang, C.-S., Campbell, I. L., Sun, J.-R., Withers, H. R., and McBride, W. H. (1995) Induction of acute phase gene expression by brain irradiation. Int. J. Radiat. Oncol. Biol. Phys. 33, 619626[Medline]
-
Ijichi, A., Sakuma, S., and Tofilon, P. J. (1995) Hypoxia-induced vascular endothelial growth factor expression in normal rat astrocyte cultures. Glia 14, 8793[Medline]
-
Noel, F., and Tofilon, P. J. (1998) Astrocytes protect against X-ray-induced neuronal toxicity in vitro. NeuroReport 9, 11331137[Medline]
-
Bloomquist, B. T., Eipper, B. A., and Mains, R. E. (1991) Prohormone converting enzymes: regulation and evaluation of function using antisense RNA. Mol. Endocrinol. 5, 20142024[Abstract/Free Full Text]
-
Seidah, N. G., Chrétien, M., and Day, R. (1994) The family of subtisilin/kexin like pro-protein and pro-hormone convertase: divergent or shared functions. Biochimie 76, 197209[Medline]
-
Schäfer, M. K.-H., Day, R., Cullinan, W. E., Chrétien, M., Seidah, N. G., and Watson, S. J. (1993) Gene expression of prohormone and proprotein convertases in the rat CNS: a comparative in situ hybridization analysis. J. Neurosci. 13, 12581279[Abstract]
-
Seidah, N. G., Gaspar, L., Mion, P., Marcinkiewicz, M., Mbikay, M., and Chrétien, M. (1990) cDNA sequence of two distinct pituitary proteins homologous to Kex2 and Furin gene products: tissue-specific mRNAs encoding candidates for pro-hormone processing proteinases. DNA Cell. Biol. 6, 415424
-
Lazure, C., Seidah, N. G., Pélaprat, D., and Chrétien, M. (1983) Proteases and post-translational processing of prohormones: a review. Can. J. Biochem. Cell Biol. 61, 501515[Medline]
-
Seidah, N. G., and Chrétien, M. (1997) Eukaryotic protein processing: endoproteolysis of precursor proteins. Curr. Opin. Biotechnol. 8, 602607[Medline]
-
Marcinkiewicz, M., Seidah, N. G., and Chrætien, M. (1996) Implications of the subtisilin/kexin-like precursor convertases in the development and function of nervous tissues. Acta Neurobiol. Exp. 56, 287298[Medline]
-
Benjannet, S., Rondeau, N., Day, R., Chrétien, M., and Seidah, N. G. (1991) PC1 and PC2 are proprotein convertases capable of cleaving POMC at distinct pairs of residues. Proc. Natl. Acad. Sci. USA 88, 35643568[Abstract/Free Full Text]
-
Breslin, M. B., Lindberg, I., Benjannet, S., Mathis, J. P., Lazure, C., and Seidah, N. G. (1993) Differential processing of proenkephalin by prohormone convertases 1(3) and 2 and furin. J. Biol. Chem. 268:2708427093[Abstract/Free Full Text]
-
Day, R., Lazure, C., Basak, A., Boudreault, A., Limperis, P., Dong, W., and Lindberg, I. (1998) Prodynorphin processing by proprotein convertase 2. J. Biol. Chem. 273, 829836[Abstract/Free Full Text]
-
Oyarce, A. M., Hand, T. A., Mains, R. E., and Eipper, B. A. (1996) Dopaminergic regulation of secretory granule-associated proteins in rat intermediate pituitary. J. Neurochem. 67, 229241[Medline]
-
Day, R., Schäfer, M. K.-H., Watson, S. J., Chrétien, M., and Seidah, N. G. (1992) Distribution and regulation of the prohormone convertase PC1 and PC2 in the rat pituitary. Mol. Endocrinol. 6, 485497[Abstract/Free Full Text]
-
Armstrong, C. C., Mollman, J., Corn, B. W., Alavi, J., and Grossman, M. (1993) Effects of radiation therapy on adult brain behavior: evidence for a rebound phenomenon in a phase 1 trial. Neurology 43, 19611965[Abstract/Free Full Text]
-
Crossen J. R, Garwood, D., Glatstein, E., and Neuwelt, E. A. (1994) Neurobehavioral sequelae of cranial irradiation in adults: a review of radiation-induced encephalopathy. J. Clin. Oncol. 12, 627642[Abstract]
-
DeAngelis, L. M., Delattre, J.-Y., and Posner, J. B. (1989) Radiation-induced dementia in patients cured of brain metastases. Neurology 39, 789796[Abstract/Free Full Text]
-
Hochberg, F. H., and Slotnick, B. (1980) Neuropsychologic impairment in astrocytoma survivors. Neurology 30, 172177[Abstract/Free Full Text]
-
Maire, J. P., Coudin, B., Guerin J., and Caudry, M. (1987) Neuropsychologic impairment in adults with brain tumors. Am. J. Clin. Oncol. 10, 156162[Medline]
-
Enokido, Y., Araki, T., Tanaka, K., Aizawa, S., and Hatanaka, H. (1996) Involvement of p53 in DNA strand break-induced apoptosis in postmitotic CNS neurons. Eur. J. Neurosci. 8, 18121821[Medline]
-
Gobbel, G. T., Bellinzoma, M., Vogt, A. R., Gupta, N., Fike, J. R., and Chan, P. H. (1998) Response of postmitotic neurons to X-irradiation: implications for the role of DNA damage in neuronal apoptosis. J. Neurosci. 18, 147155[Abstract/Free Full Text]