| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
RESEARCH COMMUNICATION |
a Section of Pulmonary and Critical Care Medicine, Yale University School of Medicine, New Haven, Connecticut 06250, USA
b Connecticut VA HealthCare System, West Haven, Connecticut, 06516, USA
c Division of Pulmonary and Critical Care Medicine, The Johns Hopkins University School of Medicine, Baltimore, Maryland 21205USA
d Department of Molecular Genetics, Alton Ochsner Medical Foundation and Department of Biochemistry and Molecular Biology, Louisiana State University Medical Center, New Orleans, Louisiana 70121, USA
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Key Words: antioxidants • gene transcription • activator protein 1 • gene expression
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
We previously demonstrated that nitric oxide (NO) increased steady-state levels of HO-1 mRNA independent of the soluble guanylate cyclase-cGMP pathway (11). Indeed NO is one of the most potent inducers of HO-1 gene expression identified to date. Since NO itself is a free radical and can interact with other free radicals such as superoxide anion, we hypothesized that the addition of antioxidants might inhibit NO-induced HO-1 gene expression. Pretreatment of cells with the antioxidant N-acetyl-L-cysteine (NAC) ablated nitric oxide-induced HO-1 gene expression; however, pyrrolidine dithiocarbamate (PDTC), a strong antioxidant and iron chelator, surprisingly stimulated HO-1 gene expression commensurate to that of NO itself. In addition to their metal chelating properties, dithiocarbamates represent a class of antioxidants known to be potent inhibitors of nuclear factor-
B (NF-B). In this respect, PDTC is thought to be one of the most effective NF-B inhibitors because of its ability to traverse the cell membrane and its prolonged stability in solution at physiologic pH (12). Dithiocarbamates are currently being advocated as a treatment to retard the onset of acquired immune deficiency syndrome (AIDS) in human immunodeficiency virus (HIV) infected people, and more recently have been advocated for limiting neutrophil-mediated oxidant injury (12, 13). To date, the protective effects of dithiocarbamates have been attributed directly to either their antioxidant properties or their ability to inhibit NF-B, but it is becoming increasingly appreciated that at least PDTC has the potential to activate endogenous antioxidant genes expression as well as modulate the redox state of cells, independent of any effects on NF-B (14). In this paper we demonstrate that PDTC alone is a potent inducer of the stress-inducible gene HO-1 in aortic vascular smooth muscle (aVSM) cells. Furthermore, we show that the transcription factor activator protein 1 (AP-1) plays an important role in mediating PDTC-induced HO-1 gene transcription.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Chemicals
PDTC, actinomycin D (0.5 µg/ml) , and cycloheximide (5 µg/ml) were obtained from Sigma (St. Louis, Mo.). All experiments using PDTC were performed at dose of 2 mM unless indicated otherwise.
RNA extraction and Northern blot analyses
Total RNA was isolated by the STAT-60 RNAzol method with direct lysis of cells in RNAzol lysis buffer, followed by chloroform extraction (Tel-Test `B' Inc., Friendswood, Tex.). Northern blot analyses were performed as previously described (4). Ten micrograms of total RNA was electrophoresed in a 1% agarose gel, transferred to Gene Screen Plus nylon membrane (Dupont; Boston, Mass.) by capillary action, and cross-linked with a UV Stratalinker (Stratagene; La Jolla, Calif.). The nylon membranes were prehybridized in hybridization buffer (1% BSA, 7% sodium dodecyl sulfate (SDS), 0.5 M phosphate buffer, pH 7.0, 1.0 mM EDTA) at 65°C for 2 h, followed by incubation in hybridization buffer containing 32P-labeled rat HO-1 cDNA at 65°C for 24 h. Nylon membranes were then washed twice in buffer A (0.5% BSA, 5% SDS, 40 mM phosphate buffer, pH 7.0, 1 mM EDTA) for 15 min at 55°C, followed by four washes in buffer B (1% SDS, 40 mM phosphate buffer, pH 7.0, 1.0 mM EDTA) for 15 min at 55°C. Ethidium bromide staining of the gel was used to confirm RNA integrity. To further control for variation in either the amount of RNA in different samples or loading errors, blots were hybridized with an oligonucleotide probe complementary to 18s rRNA after stripping of the HO-1 probe. Autoradiographic signals were quantified by densitometric scanning (Molecular Dynamics; Sunnyvale, Calif.). All densitometric values obtained for the HO-1 mRNA transcript (1.8 kb) were normalized to values for 18s rRNA obtained on the same blot. The HO-1 mRNA level in treated cells was expressed in densitometric absorbance units, normalized to control untreated samples, and expressed as fold induction compared to controls.
cDNA and oligonucleotide probes
A full-length rat HO-1 cDNA, generously provided by Dr. S. Shibahara of Tohoku University, Japan (15), was subcloned into pBluescript vector and HindIII/EcoRI digestion was performed to isolate a 0.9 kb HO-1 cDNA subfragment. A 24 base pair oligonucleotide (5'-ACGGTATCT GATCGTCTTCGAACC-3') complementary to 18s rRNA was synthesized using a DNA synthesizer (Applied Biosystems; Foster City, Calif.). HO-1 cDNA was labeled with [
-32P]CTP using a random primer kit (Boehringer-Mannheim; Mannheim, Germany). The 18s rRNA oligonucleotide was labeled with [-32P]ATP at the 3' end with terminal deoxynucleotidyl transferase (Bethesda Research Laboratories; Gaithersburg, Md.).
Western blot analyses
For HO-1 immunoblots, cells were homogenized in lysis buffer (1% NP-40, 20 mM Tris pH 8.0, 137.5 mM NaCl, 1 mM Na3VO4, 1 mM PMSF, 10 µg/ml aprotinin). Protein concentrations of the lysates were determined by Coomassie blue dye binding assay (Bio-Rad Laboratories, Hercules, Calif.). An equal volume of 2x SDS/sample buffer (0.125 M Tris-HCl, pH 7.4, 4% SDS, and 20% glycerol) was added, and the samples were boiled for 5 min. Samples (100 µg) were subjected to electrophoresis in a 12% SDS-polyacrylamide gel (Novex; San Diego, Calif.) for 2 h at 20 mA. The proteins were then transferred electrophoretically (Bio-Rad Laboratories) onto a polyvinylidene fluoride membrane (Immobilon; Bedford, Mass.) and incubated for 2 h in TTBS buffer (Tris-buffered saline and 1% polyoxyethylene sorbitan monolaurate) containing 5% nonfat powdered milk. The membranes were then incubated for 2 h with rabbit polyclonal antibody against rat HO-1 (1:1,000 dilution). Rat HO-1 antibody was purchased from Stress Gen (Vancouver, Canada). After three washes in TTBS for 5 min each, the membranes were incubated with goat anti-rabbit IgG antibody (Amersham; Arlington Heights, Ill.) for 2 h. The membranes were then washed three times in TTBS for 5 min each, followed by detection of signal by using an ECL detection kit (Amersham).
Cellular nuclear protein extraction
Cells were scraped in cold phosphate-buffered saline and centrifuged at 14,000 x g at 4°C for 10 min. After the supernatant was discarded, the cell pellet was lysed in lysis buffer containing 10 mM HEPES pH 7.9, 1 mM EDTA, 60 mM KCl, 1 mM DTT, 0.5% NP-40, and 1 mM PMSF. The lysate was chilled in ice for 5 min then centrifuged at 1500 x g to obtain nuclei. The nuclei were washed in lysis buffer without NP-40 and centrifuged again at 1500 x g for 5 min. The supernatant was removed and the pellet was resuspended in nuclear resuspension buffer containing 25 mM Tris pH 7.8, 60 mM KCl, 1 mM DTT, and 1 mM PMSF. The nuclei were then frozen and thawed three times to obtain nuclear protein. The protein was kept in nuclear resuspension buffer and stored at -80°C.
Electrophoretic mobility shift assay
Mobility shift assays were performed as previously described (4). DNA binding activity was determined after incubation of nuclear protein extract (5 µg) with 10 fmol (20,000–50,000 cpm) of a 322P-labeled 22-mer oligonucleotide encompassing the AP-1 site (5'CTAGTGATGAGTCAGCCGGATC 3') (Stratagene; La Jolla, Calif.) in reaction buffer containing 10 mM Hepes (pH 7.9), 1 mM DTT, 1 mM EDTA, 80 mM potassium chloride, 1 mg poly [dIdC], and 4% Ficoll. After a 20 min incubation, the reaction mixture was electrophoresed on a 6% polyacrylamide gel. The gel was transferred to DE81 ion exchange chromatography paper (Whatman; Maidstone, England) and dried down prior to exposure to autoradiographic film.
Plasmid constructs and mutations
The construction and characterization of the plasmid pMHO1CAT, the mouse extended HO-1 promoter (1.3 kb) linked to the reporter gene chloramphenicol acetyl transferase (CAT), has been described previously (16). The construction of pMHO1CAT-33+SX2, which contains the 5' distal enhancer fragment of the HO-1 gene (SX2) linked to the minimal promoter and reporter gene CAT, has also been described (16). The construction of pMHO11CAT, which contains a large portion of the 5' flanking region of the HO-1 gene linked to the reporter gene CAT, was done by cloning the 11.5 kb (-3.5 to -15 kb) Bam HI/ Bam HI fragment of lMHO2–1 (17) into the Bam HI site upstream of the HO-1 promoter in plasmid pMHO1CAT. The construction of pMHO1CAT+RH2, the 5' flanking region of the HO-1 gene containing the second distal enhancer AB1 site linked to the reporter gene CAT, has been described previously (18).
Plasmids (10 µg) containing the various constructs were stably cotransfected into RAW 264.7 cells with pcDNA3-Neo (1 µg), a plasmid containing neomycin selection marker, using Lipofectin reagent (Gibco BRL) as previously described (4). In brief, cells were transfected for 24 h and then incubated in Dulbecco's modified Eagle's medium containing 10% fetal bovine serum, 50 µg/ml gentamicin, supplemented by increasing amounts of Geneticin (Gibco BRL) every 3 days until reaching a maximum dose of 800 µg/ml.
Site-directed mutagenesis
Oligonucleotide-directed mutagenesis to generate mutant plasmids pMHO1CAT
-33+AB1M16 (one AP-1 binding site mutated), pMHO1CAT-33+AB1M31 (two AP-1 binding sites mutated), and pMHO1CAT-33+AB1M45 (three AP-1 binding sites mutated) has been described previously (18). The construction of the wild-type plasmid pMHO1CAT-33+AB1 (containing the second distal enhancer AB1 linked to the minimal promoter of the HO-1 gene) has also been described (18)
Chloramphenicol acetyltransferase assay
Cellular protein extracts were prepared within 24 h after termination of PDTC treatment. Cells from 10 cm plates were washed with ice-cold phosphate-buffered saline, resuspended in 1.0 ml of 0.25 M Tris-HCl (pH 7.5), and lysed by three cycles of freezing and thawing. Cell debris was then removed by centrifugation for 10 min at 14,000 rpm in a microcentrifuge. Protein concentrations of the supernatant fluids were determined by Coomassie blue dye binding assay. Reaction mixtures containing, in a final volume of 150 µl, 20 mM acetyl-CoA, 0.3 µCi [14C] chloramphenicol (50 µCi/µmol; Amersham), and 100 µg of protein were incubated for 4 hr at 37°C. The amount of acetylation was then determined by densitometric analyses of the acetylated and nonacetylated forms of chloramphenicol, which were separated by ascending thin-layer chromatography. Induction is expressed as the ratio of relative CAT activities of inducer-treated cells to control cells, corrected for protein concentrations.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Fig. 1A).
HO-1 mRNA levels were induced in a time-dependent manner. A low basal level of HO-1 transcript was detected by densitometer to allow determination of fold induction. Increased HO-1 mRNA levels were observed at 2 h, with peak induction at 4–8 h and reduced, but still significantly increased HO-1 mRNA levels, at 24 h of PDTC treatment. Induction of HO-1 mRNA is also dose dependent as evidenced by increases in mRNA expression by doses of PDTC ranging from 2 µM to 2 mM ( Fig. 1B). Minimal induction of HO-1 mRNA was evident at 0.002 mM PDTC, with marked increases in HO-1 mRNA present at 0.02 mM PDTC, 0.2 mM PDTC, and 2.0 mM PDTC. All subsequent experiments involving PDTC were performed using a concentration of 2 mM. Cells did not exhibit cytotoxicity at this dose as assessed by trypan blue viability assays. Western blot analyses were performed to determine if enhanced HO-1 gene expression after PDTC treatment correlated with increased HO-1 protein levels. An increase of HO-1 protein levels was evident at 2 h, peaking at 8 h and remaining elevated at 24 h after PDTC treatment of aVSM cells ( Fig. 2).
|
|
Induction of HO-1 mRNA expression by PDTC is dependent on both transcriptional and posttranscriptional mechanisms
To examine the mechanism(s) for increased expression of HO-1 in response to PDTC, we first examined whether HO-1 mRNA induction was dependent on gene transcription. Induction of HO-1 mRNA was completely abolished in the presence of actinomycin D (0.5 µg/ml), a potent inhibitor of RNA synthesis ( Fig. 3).
In addition to increased HO-1 gene transcription, PDTC could also increase HO-1 gene expression by enhancing the stability of mRNA transcripts. We tested this possibility by determining whether PDTC affected the stability of HO-1 mRNA transcript. Cells were pretreated with PDTC for 4 h, washed, and subsequently exposed to actinomycin D either in the presence or absence of PDTC for 1, 2, 4, and 8 h. The decay of HO-1 transcripts in actinomycin D-treated cells was delayed in the presence of PDTC ( Fig. 4),
as demonstrated by higher levels of HO-1 mRNA in cells exposed to actinomycin D in the presence of PDTC (4 and 8 h time points) when compared with cells exposed to actinomycin D alone. These data suggest that PDTC increased HO-1 gene expression by enhancing both gene transcription and mRNA stability. To further determine regulation of HO-1 expression by PDTC, cells were pretreated with the protein synthesis inhibitor cycloheximide (5 µg/ml ) prior to treatment with PDTC and then analyzed for HO-1 mRNA expression. Cycloheximide significantly attenuated the up-regulation of HO-1 mRNA steady-state levels in response to PDTC treatment, suggesting that new protein synthesis was also required for PDTC-induced HO-1 mRNA expression ( Fig. 3).
|
|
The 5' distal enhancer mediates PDTC-induced HO-1 gene transcription
To determine whether increased transcription of the HO-1 gene was mediated by its 5'-upstream region, various fragments of the 11 kbp upstream region, including the promoter and distal enhancers, were linked to a CAT reporter gene and stably transfected in RAW 264.7 cells and assayed for CAT activity in response to PDTC. We used a cell line (RAW 264.7) for these studies involving transfections of HO-1 gene promoter and enhancers since primary cultures such as aVSM cells are difficult to transfect with high efficiency and reproducibility. Our laboratory has also extensively characterized the various stable transfectants (RAW 264.7 cells) used for these experiments (4, 20, 23). By deletional analyses, we observed that the transcriptional activation of the HO-1 gene by PDTC is mediated not by the proximal promoter, but rather by the distal enhancer, AB1, located 10 kbp upstream of the transcription site ( Fig. 5).
This distal enhancer regions contain putative DNA binding sites for transcriptional factor AP-1. By mutational analysis, we demonstrated that the AP-1 DNA binding elements were critical for PDTC-induced HO-1 gene transcription ( Fig. 6).
|
|
The transcription factor AP-1 is activated after exposure to PDTC
Electrophoretic mobility shift assay were performed using a synthetic, double-stranded DNA probe specific for AP-1 to assess whether PDTC can increase AP-1 DNA binding activity in aVSM cells. Figure 7
shows activation of AP-1 DNA binding activity in nuclear lysates from PDTC-treated cells. Increased AP-1 binding activity was observed as early as 1 h and remained elevated at 4 h. The specificity of AP-1 binding activity was demonstrated by the ability of an unlabeled AP-1 oligonucleotide to compete with the radiolabeled AP-1 sequence for binding of nuclear factors ( Fig. 7B). An unlabeled Sp1 oligonucleotide containing an unrelated consensus sequence also did not compete with the radiolabeled AP-1 probe ( Fig. 7B).
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
It is becoming increasingly clear that the redox state of cells is important in modulating gene expression, and it has been suggested that reactive oxygen species may in part mediate the induction of HO-1 in response to various stimuli including hyperoxia, ultraviolet irradiation, and glutathione depletors (8, 19, 20, 23). Therefore, when we recently demonstrated that NO-induced HO-1 expression occurred in a cGMP-independent manner (11), we hypothesized that reactive oxygen or nitrogen species may play a role in NO modulation of HO-1 gene expression. Surprisingly, the addition of PDTC, a powerful antioxidant and metal-chelating compound, did not attenuate the increase of HO-1 expression in response to NO, but up-regulated HO-1 gene expression in the absence of NO.
This paper demonstrates that PDTC is a very potent inducer of HO-1 gene expression in cultured cells including aVSM and RAW 264.7 cells. Pretreatment of cells with the RNA synthesis inhibitor actinomycin D inhibited HO-1 gene expression, confirming that HO-1 induction by PDTC is regulated at the level of gene transcription. This observation supports previous data (20) suggesting that modulation of gene transcription is the principal mechanism by which HO-1 is regulated. Our data further suggest that PDTC up-regulates HO-1 gene expression through activation of the transcription factor AP-1. AP-1 has been shown to behave as a redox-sensitive transcription factor that can be activated by either oxidant or antioxidant stimuli (24). Our data support previous studies demonstrating that induction of AP-1 by antioxidant treatments requires de novo protein synthesis (25), suggesting that PDTC is functioning as an antioxidant. However, it is also well established that the expression and /or DNA binding activity of c-Fos and c-Jun can be potently stimulated in many cell types by various pro-oxidants including heavy metals, hydrogen peroxide, and UV irradiation (26). Note that even though PDTC is commonly regarded as an antioxidant, it can also bind and transport external copper ions into cells, raising the intracellular level of redox-active copper (27, 28). Therefore, we cannot discount that an augmentation in the oxidant burden of the cell might be responsible for the acti~vation of AP-1, culminating in increased HO-1 gene expression. Future experiments will be necessary to elucidate the underlying mechanism of AP-1 activation by PDTC.
In addition to activating AP-1, PDTC has also been shown to inhibit the transcription factor NF-B (29, 30), although the mechanism through which this occurs remains unclear. Some reports attribute this inhibition to the antioxidant properties of PDTC, and other investigators contend that inhibition does not involve redox modifications (31). We do not believe, however, that NF-B plays an important role in PDTC-induced HO-1 gene transcription since there are no binding sites for NF-B in the mouse HO-1 gene promoter or enhancers (16–18, 20). However, our studies do not eliminate the possibility that transcription factors such as maf and Nrf families of proteins, transcription factor proteins that can bind to the consensus AP-1 binding sites (32), are also involved in the activation of the HO-1 gene in response to PDTC.
We report here that PDTC is a potent inducer of HO-1 in aVSM cells through the activation of AP-1, albeit this is not the first report of PDTC inducing an endogenous antioxidant. Borello and Demple (14) reported the induction of MnSOD in HeLa cells as well as in HT29 cells by PDTC. The study also confirmed the inhibition of NF-B and was consistent with the induction of AP-1 by PDTC. The fold induc~tion of HO-1 gene expression was markedly higher than that seen for MnSOD induction. We speculate that this variation might be multifactorial and incorporate the characteristics inherent to different cell types, as well as deviations in PDTC concentrations used. However, this is not the first stimulus to induce HO-1 to a greater extent than MnSOD (A. M. K. Choi, unpublished observations), suggesting that HO-1 as a stress response gene might play a fundamentally different role beyond its ability to function as an antioxidant. PDTC is currently being advocated for use in the treatment of AIDS and neurodegenerative diseases due to its inhibition of NF-B (29); however, we would like to speculate that the increase in HO-1 gene expression may in part be participating in the antiinflammatory responses associated with the use of PDTC in these and other settings.
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
2 Abbreviations: AIDS, acquired immune deficiency syndrome; AP-1, activator protein 1; aVSM, aortic vascular smooth muscle; CAT, chloramphenicol acetyl transferase; HIV, human immunodeficiency virus; HO, heme oxygenase; NAC, N-acetyl-L-cysteine; NF-B, nuclear factor B; NO, nitric oxide; PDTC, pyrrolidine dithiocarbamate; SDS, sodium dodecyl sulfate.
Received for publication May 15, 1998.
Revision received July 14, 1998.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
B independent transcriptional induction of the human manganous superoxide dismutase gene. Arch. Biochem. Biophy. 348, 289–294[Medline]
B and AP-1 in lymphocytes. Biochem. Pharmacol. 50, 735–741[Medline]
B activation in intact cells. J. Exp. Med. 175:1181–1194B and AP-1 in intact cells: AP-1 as secondary anti-oxidant responsive factor. EMBO J. 12, 2005–2015[Medline]
This article has been cited by other articles:
|
|
 |
|
  S. W. Ryter, J. Alam, and A. M. K. Choi Heme Oxygenase-1/Carbon Monoxide: From Basic Science to Therapeutic Applications Physiol Rev, April 1, 2006; 86(2): 583 - 650. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Wijayanti, T. Kietzmann, and S. Immenschuh Heme Oxygenase-1 Gene Activation by the NAD(P)H Oxidase Inhibitor 4-(2-Aminoethyl) Benzenesulfonyl Fluoride via a Protein Kinase B, p38-dependent Signaling Pathway in Monocytes J. Biol. Chem., June 10, 2005; 280(23): 21820 - 21829. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K.-y. Yeh, M. Yeh, and J. Glass Hepcidin regulation of ferroportin 1 expression in the liver and intestine of the rat Am J Physiol Gastrointest Liver Physiol, March 1, 2004; 286(3): G385 - G394. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Choi, S. Rolle, M. Wellner, M. C. Cardoso, C. Scheidereit, F. C. Luft, and R. Kettritz Inhibition of NF-{kappa}B by a TAT-NEMO-binding domain peptide accelerates constitutive apoptosis and abrogates LPS-delayed neutrophil apoptosis Blood, September 15, 2003; 102(6): 2259 - 2267. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Rydkina, A. Sahni, D. J. Silverman, and S. K. Sahni Rickettsia rickettsii Infection of Cultured Human Endothelial Cells Induces Heme Oxygenase 1 Expression Infect. Immun., August 1, 2002; 70(8): 4045 - 4052. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Hellmuth, C. Wetzler, M. Nold, J.-H. Chang, S. Frank, J. Pfeilschifter, and H. Muhl Expression of interleukin-8, heme oxygenase-1 and vascular endothelial growth factor in DLD-1 colon carcinoma cells exposed to pyrrolidine dithiocarbamate Carcinogenesis, August 1, 2002; 23(8): 1273 - 1279. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. P. Carter, C. L. Hartsfield, M. Miyazono, M. Jakkula, K. G. Morris Jr., and I. F. McMurtry Regulation of heme oxygenase-1 by nitric oxide during hepatopulmonary syndrome Am J Physiol Lung Cell Mol Physiol, August 1, 2002; 283(2): L346 - L353. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Hill-Kapturczak, V. Thamilselvan, F. Liu, H. S. Nick, and A. Agarwal Mechanism of heme oxygenase-1 gene induction by curcumin in human renal proximal tubule cells Am J Physiol Renal Physiol, November 1, 2001; 281(5): F851 - F859. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. A. Sammut, J. Jayakumar, N. Latif, S. Rothery, N. J. Severs, R. T. Smolenski, T. E. Bates, and M. H. Yacoub Heat Stress Contributes to the Enhancement of Cardiac Mitochondrial Complex Activity Am. J. Pathol., May 1, 2001; 158(5): 1821 - 1831. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. H. Wagner, R. Krzesz, D. Gao, C. Schroeder, M. Cattaruzza, and M. Hecker Decoy Oligodeoxynucleotide Characterization of Transcription Factors Controlling Endothelin-B Receptor Expression in Vascular Smooth Muscle Cells Mol. Pharmacol., April 13, 2001; 58(6): 1333 - 1340. [Abstract] [Full Text]
|
|
|
|
 |
|
 K. K. Griendling, D. Sorescu, B. Lassegue, and M. Ushio-Fukai Modulation of Protein Kinase Activity and Gene Expression by Reactive Oxygen Species and Their Role in Vascular Physiology and Pathophysiology Arterioscler. Thromb. Vasc. Biol., October 1, 2000; 20(10): 2175 - 2183. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. V. Panchenko, H. W. Farber, and J. H. Korn Induction of heme oxygenase-1 by hypoxia and free radicals in human dermal fibroblasts Am J Physiol Cell Physiol, January 1, 2000; 278(1): C92 - C101. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Galbraith Heme Oxygenase: Who Needs It? Experimental Biology and Medicine, December 1, 1999; 222(3): 299 - 305. [Abstract] [Full Text]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
