FASEB J.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Closs, E. I.
Right arrow Articles by Förstermann, U.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Closs, E. I.
Right arrow Articles by Förstermann, U.
(The FASEB Journal. 1998;12:1643-1649.)
© 1998 FASEB

RESEARCH COMMUNICATION

Coexpression of inducible NO synthase and soluble guanylyl cyclase in colonic enterocytes: a pathophysiologic signaling pathway for the initiation of diarrhea by gram-negative bacteria?

Ellen I. Clossa, Frank Enseleita, Doris Koeslingb, Josef M. Pfeilschifterc, Petra M. Schwarza and Ulrich Förstermanna,1

a Department of Pharmacology, Johannes Gutenberg University, 55101 Mainz, Germany
b Department of Pharmacology, Free University of Berlin, 14195 Berlin, Germany
c Department of Pharmacology, Johann Wolfgang Goethe University, 60509 Frankfurt, Germany


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Infectious diarrhea is often caused by the exotoxins of gram-negative bacteria such as Escherichia coli. However, these organisms also contain lipopolysaccharide (LPS) endotoxin. LPS induces nitric oxide synthase II (NOS II, inducible NOS) in various types of cells. We now demonstrate by RNase protection analysis, Western blot, and immunohistochemistry that the expression of NOS II mRNA and protein is markedly induced in colonic enterocytes of mice that ingest LPS with their drinking water. Using the same techniques, significant levels of soluble guanylyl cyclase (GC-S), the effector enzyme of NO, were found constitutively expressed in the mucosa. This creates a pathophysiologic autocrine pathway producing increased levels of cyclic GMP and leading to hypersecretion and diarrhea. In fact, the LPS-induced diarrhea developed in parallel with the NOS II induction. Diarrhea could be controlled with orally administered dexamethasone, which prevented the LPS-stimulated induction of NOS II (RNase protection analysis and Western blot). Diarrhea was also blocked by oral aminoguanidine, an inhibitor of NOS II activity. These data suggest that in addition to the known heat-labile and heat-stable exotoxins, gram-negative bacteria may induce diarrhea through the release of endotoxins that induce a NOS II-GC-S autocrine pathway in mucosal epithelium.—Closs, E. I., Enseleit, F., Koesling, D., Pfeilschifter, J. M., Schwarz, P. M., Förstermann, U. Coexpression of inducible NO synthase and soluble guanylyl cyclase in colonic enterocytes: a pathophysiologic signaling pathway for the initiation of diarrhea by gram-negative bacteria? FASEB J. 12, 1643–1649 (1998)


Key Words: NO synthase mRNA • ribonuclease protection analysis • anti-NO synthase antibodies • dexamethasone • aminoguanidine • lipopolysaccharide


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
THE CAUSES OF DIARRHEA are legion, but the overall alterations of intestinal functions are usually similar. The intestine ceases to be an organ of net absorption of water and electrolytes, the fluid secreted exceeds the absorptive capacity of the remaining intestine, and water passes into the stool. Excessive fecal loss of fluid and electrolytes is an important aspect of many infectious and noninfectious gastrointestinal diseases. Acute-onset diarrhea is most often of infectious origin. Enterotoxigenic Escherichia coli (ETEC)2 represent one of the most common causes of diarrhea (1). When bound to enterocytes, these bacteria can produce several exotoxins (2). The heat-labile toxin produced by some ETEC strains resembles structurally and functionally the toxin produced by Vibrio cholerae. These exotoxins produce intestinal hypersecretion by stimulating the epithelial adenylyl cyclase and increasing cyclic AMP (2). Other ETEC strains produce heat-stable exotoxins (ST). The A-subunit of these toxins (STA) is the pathophysiologic agonist of the particulate guanylyl cyclase C (GC-C), thereby increasing cyclic GMP and stimulating intestinal hypersecretion (3–5).

In addition to exotoxins, E. coli and other gram-negative bacteria also contain endotoxins, which are lipopolysaccharides (LPS) (6, 7). LPS induces a variety of immune reactions, including the stimulation of cytokine production in white cells and the induction of inflammatory enzymes such as the inducible nitric oxide (NO) synthase (NOS II) or the inducible cyclooxygenase (8). If NOS II and the soluble guanylyl cyclase (GC-S) were to coexist in the same or adjacent enterocytes, this would represent an additional pathway by which cyclic GMP could be increased (5, 9) and intestinal hypersecretion stimulated.

We now demonstrate that NOS II is coexpressed with GC-S in the colonic mucosa of mice exposed to LPS in their drinking water. LPS intake leads to a transient outbreak of diarrhea that can be prevented with the inhibitor of NOS II induction, dexamethasone, and the inhibitor of NOS II activity, aminoguanidine.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Reagents
LPS (from E. coli, serotype 055:B5), water-soluble (cyclodextrin-encapsulated) dexamethasone, aminoguanidine, goat anti-rabbit antibody conjugated to alkaline phosphatase, 3,3'-diaminobenzidine peroxidase substrate tablets, nitro blue tetrazolium chloride, and 5-bromo-4-chloro-3-indolyl-phosphate were obtained from Sigma Chemical Co. (Deisenhofen, Germany). Biotinylated goat ant-rabbit IgG, normal goat serum, and Vectastain Elite ABC Kit were from Vector Laboratories (Burlingame, Calif.). Restriction enzymes, random hexamer primers, SureClone Ligation Kit, Taq DNA polymerase, Taq polymerase reaction buffer, T7Sequencing Kit, and oligo (dT)12–18 primers were from Pharmacia Biotech (Freiburg, Germany). DNase I, RNase A, RNase T1, proteinase K, and T3 and T7 RNA polymerases were from Boehringer Mannheim (Mannheim, Germany). Vector pCR-Script SK+ was from Stratagene (Heidelberg, Germany). The SuperScript reverse transcriptase (RT) Kit was from Life Technologies (Eggenstein, Germany). [{alpha}-32P]UTP was from ICN (Eschwege, Germany).

Animals
Specific pathogen-free (SPF) male Balb mice were obtained from Charles River (Sulzfeld, Germany). They were kept in our SPF animal facilities on regular chow and water until the day of the experiment. Experiments were performed in a soundproof, isolated SPF laboratory in order to avoid effects of environmental stress on defecation. For the same reason, all pharmacological agents were added to the drinking water (autoclaved tap water). Drinking water was removed for 12 h prior to the experiments, so that the mice ingested significant amounts of water right at the beginning of the actual experiment. Concentrations of compounds in the drinking water were adjusted such that, based on the ingested volume during the experiment, the desired dose was reached or slightly exceeded. The doses were 10 mg/kg body weight LPS, 30 mg/kg body weight water-soluble dexamethasone, and 60 mg/kg body weight aminoguanidine. Experiments were performed with groups of five mice per cage. The cage bottoms were covered with filter paper, which allowed exact analysis of their droppings. The animals were killed 8 h after the beginning of the drug treatment by cervical dislocation, and the colon (along with some other organs) was removed for the preparation of RNA and/or protein.

Evaluation of the stool of mice
At the end of the 8 h observation period, the filter papers covering the bottoms of the cages were evaluated by an inves~tigator who was unaware of the drug treatment of the individual animals. The droppings were classified as hard (normal) pellets, soft pellets, and watery pellets (partly absorbed by the filter paper). Each treatment group consisted of five animals. The number of pellets produced by these five animals was computed. Statistical differences in the number of hard, soft, and watery pellets dropped by the different groups of mice were evaluated by factorial analysis of variance, followed by Fisher's protected least significant difference test. Columns shown in Fig. 4represent means ±SEM of the number of experiments indicated.



View larger version (26K):
[in this window]
[in a new window]
  		Figure 4. Evaluation of the stool of untreated Balb mice and mice treated with LPS alone or LPS and inhibitors. Columns demonstrate the number of hard, soft, and watery pellets dropped by five mice during the 8 h observation period. Data represent means ±SEM of three experiments with groups of five mice. Mice were either left untreated or treated with LPS alone (10 mg/kg body weight, p.o.), LPS and dexamethasone (DEX, 30 mg/kg body weight, p.o.), or LPS and aminoguanidine (AG, 60 mg/kg body weight, p.o.). ***(P<0.001) indicates a significant decrease in the number of hard pellets dropped by LPS-treated mice compared with untreated animals. {dagger}{dagger} (P<0.01) and ooo (P<0.001) indicate significant increases in soft and watery pellets, respectively, dropped by LPS-treated mice compared with untreated mice. {dagger}{dagger}{dagger} (P<0.001) indicates a significant increase in hard pellets dropped by mice treated with LPS and DEX compared with mice receiving LPS alone. § (P<0.05) and ## (P<0.01) indicate significant decreases in soft and watery pellets, respectively, dropped by mice treated with LPS and DEX compared with mice receiving LPS alone. xxx (P<0.001) indicates a significant increase in hard pellets dropped by mice treated with LPS and AG compared with mice receiving LPS alone. {lozenge} (P<0.05) and {ddagger}{ddagger} (P<0.05) indicate significant decreases in soft and watery pellets, respectively, dropped by mice treated with LPS and AG compared with mice receiving LPS alone.

Cloning of cDNA fragments of murine GC-S (ß1 subunit)
For the cloning of a cDNA fragment of murine GC-Sß1, total RNA was isolated from mouse lung by acid guanidinium isothiocyanate-phenol-chloroform extraction (10). Single-stranded cDNA was obtained by reverse transcription of 2 µg total RNA using the SuperScript RT kit and 0.5 µg oligo (dT)12–18 primers in a 20 µl reaction. The RT-generated cDNA served as the template in a polymerase chain reaction (PCR). Oligonucleotide primers for GC-Sß1 were GAGATAGACATGAAGGTTATTC (sense; nt 522 to 543 of the rat GC-Sß1 cDNA (11) and CACTTCCCAGGCTGGAGC (antisense, nt 784 to 767). PCR was performed in 100 µl Taq polymerase buffer containing 0.2 mM dNTPs, 1.5 mM MgCl2, 2 U Taq polymerase, 50 pmol oligonucleotide primers, and 2 µl cDNA. Thirty cycles of PCR were performed as follows: 1 min at 95°C, 2 min at 55°C, and 3 min at 72°C. The amplified cDNA fragment (263 nt) was cloned into the Eco RV site of pCR-Script SK+ using the SureClone Ligation Kit, generating the plasmid pm_GCß1. The DNA sequence of the cloned PCR product was determined from plasmid templates using the dideoxy chain termination method with the T7Sequencing Kit. Plasmids containing cDNA fragments of murine NOS II (pCR_NOS II_mouse, 559 nt) and murine ß-actin (pCR_ß-actin_mouse, 540 nt) have previously been generated (12). The pCR_ß-actin_mouse was restricted with Bst EII and Hind III, blunted, and relegated, resulting in pCR_ß-actin_mouse_{Delta}Bst EII_Hind III, which contains only 108 nt of the mouse ß-actin cDNA.

Preparation of antisense RNA probes and RNase protection analyses of GC-Sß1, NOS II and ß-actin mRNAs
To generate radiolabeled antisense RNA probes for RNase protection assays, pm_GCß1 was linearized with Eco RI, pCR_NOS II_mouse with Nco I, pCR_ß-actin_mouse with Bst EII, and pCR_ß-actin_mouse_{Delta}Bst EII_Hind III with Asp 718. In vitro transcription was performed as previously described, resulting in [{alpha}-32P]UTP-labeled riboprobes of 319 nt for GC-Sß1, 271 nt for NOS II, and 185 nt for ß-actin (from pCR_ß-actin_mouse) or 222 nt for ß-actin (from pCR_ß-actin_mouse_{Delta}Bst EII_Hind III).

RNA was prepared from mouse colon and lung using acid guanidinium isothiocyanate-phenol-chloroform extraction (10). Ribonuclease protection analyses were performed as previously described (12, 13).

Immunohistochemistry of GC-S and NOS II
To detect GC-S ({alpha}1- and ß1-subunits) and NOS II, serial sections of 10 µm were produced from mouse colon with a cryostat microtome (Leica, Nussloch, Germany). The sections were fixed for 5 min in 4% (w/v) paraformaldehyde at 4°C (for GC-S detection) or for 5 s in ice-cold acetone (for NOS II detection). Immunohistochemistry was performed as described previously (14). Briefly, after blocking of endoge~nous peroxidase and biotin, sections were washed for 10 min in antibody incubation medium (4%, w/v, nonfat dry milk and 0.3%, v/v, Triton X-100 in phosphate-buffered saline; PBS). They were then incubated for 30 min in a 1:10 dilution of goat normal serum. Sections were incubated overnight at 4°C with one of the following primary antibodies: a rabbit polyclonal antibody to the {alpha}1-subunit of GC-S (GCpep8; 1:1000) (15), a rabbit polyclonal antibody to the ß1-subunit of GC-S (GCpep3; 1:1000) (15), or a rabbit polyclonal antibody to NOS II (1:300) (16). Sections were washed in incubation medium and then incubated for 60 min with the secondary biotinylated antibody (a goat anti-rabbit IgG; 1:100). After several washes in PBS, cells were exposed for 20 min to a avidin DH-biotinylated horseradish peroxidase H complex (Vectastain Elite ABC Kit; 1:100 in PBS). The chromogen reaction was performed with 3,3'-diaminobenzidine/H2O2 solution. Cells were washed in distilled water, mounted in glycerol gelatin, and coverslipped. In control experiments, the primary antibodies were replaced with a rabbit preimmune serum to GC-S or with rabbit nonimmune serum.

Western blotting
For Western blotting, the mouse colon was homogenized on ice as previously described (17). After centrifugation for 90 min at 100,000 x g, the pellet was washed twice with 2 M KCl and solubilized with 20 mM 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate (CHAPS). Soluble and CHAPS-solubilized particulate protein fractions (100 µg each) were separated on 7.5% sodium dodecyl sulfate-polyacrylamide gels (for NOS II) or on 10% sodium dodecyl sulfate-polyacrylamide gels (for GC-S) and electroblotted to nitrocellulose membranes (Schleicher & Schuell, Dassel, Germany) (18). Blots were blocked for 60 min at room temperature in Tris-buffered saline (TBS; 10 mM Tris-HCl pH 7.4, 154 mM NaCl) containing 5% (w/v) nonfat dry milk, 0.05% (w/v) Tween 20, and 10% (v/v) goat serum. They were then incubated overnight at 4°C with a rabbit polyclonal antibody to the {alpha}1-subunit of GC-S (GCpep8; 1:1000) (15), a rabbit polyclonal antibody to the ß1-subunit of GC-S (GCpep3; 1:1000) (15), or a rabbit polyclonal antibody to NOS II (1:3000) in PBS containing 1% (w/v) bovine serum albumin and 0.1% (w/v) Tween 20. After three washes with TBS containing 5% (w/v) nonfat dry milk and 0.05% (w/v) Tween 20, the blots were incubated for 60 min at room temperature with a goat anti-rabbit alkaline phosphatase-conjugated secondary antibody. After three washes with TBS containing 0.05% (v/v) Tween 20, bands were visualized with nitro blue tetrazolium chloride/5-bromo-4-chloro-3-indolyl-phosphate.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
Soluble guanylyl cyclase is expressed in mouse colonic enterocytes
As demonstrated in Fig. 1A, GC-S (subunit ß1) mRNA is expressed in the colon of untreated (control) Balb mice. Ingestion by the mice of LPS (10 mg/kg body weight) did not change this expression in any significant way (109%±7% of control, mean ±SEM, n=4). Also, treatment with dexamethasone (30 mg/kg body weight) or a combination of LPS and dexamethasone had no significant effect on GC-S mRNA expression in mouse colon (92%±6% of control for dexamethasone and 102%±4% of control for the combination) ( Fig. 1A). Immunohistochemistry with antibodies to the {alpha}1-subunit of GC-S ( Fig. 2B) and the ß1-subunit of GC-S ( Fig. 2D) demonstrated the localization of the enzyme in colonic enterocytes. LPS treatment of the mice produced no significant change in the localization or intensity of the GC-S immunoreactivity ({alpha}1- or ß1-subunit; Figs. 2C, E). Western blot analyses using an antibody to the ß1-subunit of GC-S detected a ~70 kDa band in the soluble fraction of mouse colon ( Fig. 3). No immunoreactivity was found in the particulate fraction.



View larger version (58K):
[in this window]
[in a new window]
  		Figure 1. Ribonuclease protection analyses of the mRNAs of the ß1 subunit of GC-S (A) and NOS II (B). ß-Actin mRNA was also analyzed for standardization. Total mRNA was prepared from the colon of specific pathogen-free Balb mice receiving either no treatment or treatment for 6 h with lipopolysaccharide (LPS, 10 mg/kg body weight, p.o.), dexamethasone (DEX, 30 mg/kg body weight, p.o.) or a combination of both. The RNAs were hybridized with cRNA probes specific for either the ß1 subunit of mouse GC-S and ß-actin or NOS II and ß-actin. After RNase treatment, the protected RNA fragments (GC-Sß1: 263 nt, NOS II: 184 nt and ß-actin: 108 nt) were separated on 6% denaturing polyacrylamide gels. T: t-RNA used as a negative control; P1: undigested probe for ß-actin; P2: undigested probe for the ß1 subunit of GC-S; P3: undigested probes for NOS II (upper band) and ß-actin (lower band); M: molecular size markers. Both gels are representative of four gels with similar results.



View larger version (113K):
[in this window]
[in a new window]
  		Figure 2. Immunohistochemical staining of colonic sections from Balb mice using polyclonal antibodies to the {alpha}1-subunit of GC-S (B, C), the ß1-subunit of GC-S (D, E) and NOS II (F, G). Panels A, B, D, F (left column) represent sections from untreated animals. C, E, G (right column): sections from animals treated with LPS (10 mg/kg body weight, p.o.). The chromogen reaction was performed with 3,3'-diaminobenzidine/H2O2. No staining was observed with preimmune serum to GC-S (A) or with nonimmune serum (not shown). The magnification is 1000-fold in all panels. Similar immunohistochemistry was performed with colons of five or six animals, yielding the same results.



View larger version (29K):
[in this window]
[in a new window]
  		Figure 3. Western blot analyses of soluble (Sol) and CHAPS-solubilized particulate (Part) fractions from the colon of Balb mice. A) Protein samples from untreated animals were separated on a 10% polyacrylamide gel and electroblotted to a nitrocellulose membrane. A polyclonal antibody to the ß1-subunit of GC-S was used for detection. B) Protein samples from untreated and LPS-treated (10 mg/kg body weight, p.o.) animals were separated on a 7.5% polyacrylamide gel and electroblotted to a nitrocellulose membrane. A polyclonal antibody to NOS II was used for detection. Both gels are representative of three experiments with similar results.

NO synthase II is induced in mouse colonic enterocytes after LPS ingestion
When RNA from the colon of untreated (control) mice was analyzed for the presence of NOS II mRNA, a small signal was usually found ( Fig. 1B). The NOS II mRNA concentration markedly increased (11.5-fold on average) when mice ingested LPS (10 mg/kg body weight). Dexamethasone (30 mg/kg body weight) suppressed both basal NOS II mRNA expression (to 16%±10% of untreated control) and LPS-stimulated NOS II mRNA expression (to 19%±9% of LPS alone) ( Fig. 1B). Immunohistochemistry using a polyclonal anti NOS II antibody showed a moderate expression of NOS II protein in the periphery of colonic enterocytes of untreated animals ( Fig. 2F). In contrast, mice that ingested LPS (10 mg/kg body weight) showed a much more intense staining for NOS II throughout the colonic enterocytes ( Fig. 2G). Similarly, in Western blots of colonic protein, a faint 130 kDa NOS II immunoreactive band was found in the colon of untreated mice. The intensity of this band markedly increased when the mice had ingested LPS ( Fig. 3B). NOS II immunoreactivity was found almost exclusively in the particulate fraction of colonic protein extracts ( Fig. 3B).

LPS ingestion leads to transient diarrhea that can be blocked by inhibitors of NOS II induction and activity
During the 8 h observation period, stool of untreated mice consisted almost exclusively of regular hard pellets ( Fig. 4, first set of columns). Ingestion of LPS (10 mg/kg body weight) with the drinking water softened the stool of the mice, leading to significant numbers of soft and watery pellets ( Fig. 4, second set of columns). Addition of dexamethasone (30 mg/kg body weight) to the LPS-containing drinking water, which prevents the induction of NOS II ( Fig. 1B; 19–21), largely normalized the stool of LPS-treated mice ( Fig. 4, third set of columns). Coadministration of LPS and aminoguanidine (a preferential inhibitor of NOS isoform II; 22, 23) prevented the colonic hypersecretion ( Fig. 4, fourth set of columns).


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
Our data demonstrate that GC-S is constitutively expressed in enterocytes of the murine colon. This has been demonstrated at the mRNA and protein levels (Figs. 1–3). GC-S exists as a heterodimeric protein (4), and antibodies to both the {alpha}1- and ß1-subunits detected immunoreactivity in colonic enterocytes ( Fig. 2). Besides GC-S, the particulate isoform GC-C is expressed in colonic enterocytes and is considered mainly responsible for cyclic GMP increases in these cells and the subsequent hypersecretion and diarrhea (3–5). The A-subunit (STA) of the heat-stable enterotoxin of E. coli is the pathophysiologic agonist of this particulate GC-C.

The current experiments suggest, however, that gram-negative bacteria can also cause diarrhea by stimulating the soluble isoform GC-S. Similar to many other cells, colonic enterocytes are inducible by the endotoxin (LPS) of gram-negative bacteria (6, 7) to express NOS II, which then generates the NO required for the stimulation of GC-S activity (4, 24). Both the suppression of NOS II expression (with dexamethasone) and inhibition of the activity of the enzyme (with aminoguanidine) prevented the outbreak of diarrhea. The human NOS II cDNA has been cloned from the colorectal DLD-1 adenocarcinoma cell line stimulated with inflammatory mediators (25). This indicates that colonic enterocytes are also able to express NOS II in humans.

The modest expression of NOS II found in the colon of untreated mice may either represent a constitutive expression of the enzyme, as has been shown previously for skeletal muscle (26), or it may be caused by the constant exposure of colonic enterocytes to bacterial products and/or other NOS II-inducing compounds in the lumen of the colon. Previous work by Hoffman et al. (27) has demonstrated the `constitutive' presence of NOS II in ileal epithelium, but not in the jejunum or colon of normal mice. LPS also induced NOS II in jejunum and colon. Glucocorticoids have been shown to prevent induction of NOS II by LPS or cytokines (19, 20). The suppression by dexamethasone of even the basal NOS II expression ( Fig. 1B) argues in favor of the induction hypothesis. It seems conceivable that the low level of NOS II expression found in normal animals contributes to normal colonic secretion.

In the murine colon, NOS II protein was found almost exclusively (>95%) in the particulate (membrane) fraction. This is at variance with the subcellular localization of the enzyme in macrophages, where about 60% of the enzyme are soluble and only 40% are found in the particulate fraction (28), but consistent with the localization of the enzyme in skeletal muscle (29). The biochemical basis and functional significance of the membrane association of NOS II is not clear at this time.

It would have been desirable to also demonstrate a cessation of diarrhea with an inhibitor of soluble guanylyl cyclase. However, guanylyl cyclase inhibitors that can be administered in vivo (such as methylene blue or LY 83583) clearly lack specificity and also inhibit NOS or inactivate NO (30, 31). The more specific guanylyl cyclase inhibitor H-1-[1,2,4]oxadiazolo[4,3-a]quinoxalin-1-one (32) cannot be administered in vivo because it binds to hemoglobin.

In addition to infections with gram-negative bacteria, diarrhea associated with some noninfectious gastrointestinal diseases may also be based on the pathomechanism described above. For example, NOS II has been shown to be induced in the colonic mucosa of patients suffering from ulcerative colitis, Crohn's disease or necrotizing enterocolitis (33, 34). In addition to contributing to the inflammatory pro~cess, this NOS II induction may also activate mucosal GC-S, thereby contributing to hypersecretion.

In conclusion, our current data suggest the induction of NOS II by bacterial endotoxin in colonic enterocytes and the autocrine stimulation of GC-S in the same cells may represent a pathophysiologic signaling pathway by which cyclic GMP can be elevated and hypersecretion and diarrhea can be induced.


   ACKNOWLEDGMENTS
 
This study was supported by the Collaborative Research Center SFB 553, Projects A1 (U.F.), A4 (J.M.P.), and B4 (E.I.C.), from the Deutsche Forschungsgemeinschaft, Bonn, Germany. The paper contains data from the thesis work of F.E.


   FOOTNOTES
 
1 Correspondence: Department of Pharmacology, Johannes Gutenberg University, Obere Zahlbacher Str. 67, 55101 Mainz, Germany. E-mail: Ulrich.Forstermann{at}Uni-Mainz.de

2 Abbreviations: CHAPS, 3-[(3-cholamidopropyl)dimethyl-ammonio]-1-propanesulfonate; ETEC, enterotoxigenic Escherichia coli; GC-C, C-type particulate guanylyl cyclase; GC-S, soluble guanylyl cyclase; GC-Sß1, ß1 subunit of soluble guanylyl cyclase; LPS, bacterial lipopolysaccharide; NO, nitric oxide; NOS, nitric oxide synthase; NOS II, inducible NOS; PBS, phosphate-buffered saline; PCR, polymerase chain reaction; RT, reverse transcriptase; SPF, specific pathogen-free; TBS, Tris-buffered saline

Received for publication May 20, 1998. Revision received July 29, 1998.
   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Levine, M. M. (1987) Escherichia coli that cause diarrhea: enterotoxigenic, enteropathogenic, enteroinvasive, enterohemorrhagic, and enteroadherent. J. Infect. Dis. 155, 377–389[Medline]
  2. Blanco, J., Blanco, M., Garabal, J. I., and Gonzalez, E. A. (1991) Enterotoxins, colonization factors and serotypes of enterotoxigenic Escherichia coli from humans and animals. Microbiologia 7, 57–73[Medline]
  3. Wedel, B. J., and Garbers, D. L. (1997) New insights on the functions of the guanylyl cyclase receptors. FEBS Lett. 410, 29–33[Medline]
  4. Koesling, D., Böhme, E., and Schultz, G. (1991) Guanylyl cyclases, a growing family of signal-transducing enzymes. FASEB J. 5, 2785–2791[Abstract]
  5. Garbers, D. L., Koesling, D., and Schultz, G. (1994) Guanylyl cyclase receptors. Mol. Biol. Cell 5, 1–5[Medline]
  6. Jann, K., and Jann, B. (1987) Polysaccharide antigens of Escherichia coli. Rev. Infect. Dis. 9 (Suppl. 5), S517–S526
  7. Rietschel, E. T., Kirikae, T., Schade, F. U., Mamat, U., Schmidt, G., Loppnow, H., Ulmer, A. J., Zahringer, U., Seydel, U., Di Padova, F., et al. (1994) Bacterial endotoxin: molecular relationships of structure to activity and function. FASEB J. 8, 217–225[Abstract]
  8. Raetz, C. R., Ulevitch, R. J., Wright, S. D., Sibley, C. H., Ding, A., and Nathan, C. F. (1991) Gram-negative endotoxin: an extraordinary lipid with profound effects on eukaryotic signal transduction. FASEB J. 5, 2652–2660[Abstract]
  9. Schmidt, H. H. H. W., Lohmann, S. M., and Walter, U. (1993) The nitric oxide and cGMP signal transduction system: regulation and mechanism of action. Biochim. Biophys. Acta 1178, 153–175[Medline]
  10. Chomczynski, P., and Sacchi, N. (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162, 156–159[Medline]
  11. Nakane, M., Saheki, S., Kuno, T., Ishii, K., and Murad, F. (1988) Molecular cloning of a cDNA coding for 70 kDa subunit of soluble guanylate cyclase from rat lung. Biochem. Biophys. Res. Commun. 157, 1139–1147[Medline]
  12. Kleinert, H., Euchenhofer, C., Ihrig-Biedert, I., and Förstermann, U. (1996) In murine 3T3 fibroblasts, different second messenger pathways resulting in the induction of NO synthase II (iNOS) converge in the activation of transcription factor NF-{kappa}B. J. Biol. Chem. 271, 6039–6044[Abstract/Free Full Text]
  13. Schwarz, P. M., Gierten, B., Boissel, J.-P., and Förstermann, U. (1998) Expressional down-regulation of neuronal-type nitric oxide synthase I by glucocorticoids in N1E-115 neuroblastoma cells. Mol. Pharmacol. 54, in press
  14. Schwarz, P. M., Rodriguez-Pascual, F., Koesling, D., Torres, M., and Förstermann, U. (1998) Functional coupling of nitric oxide synthase and soluble guanylyl cyclase in controlling catecholamine secretion from bovine chromaffin cells. Neuroscience 82, 255–265[Medline]
  15. Guthmann, F., Mayer, B., Koesling, D., Kukovetz, W. R., and Böhme, E. (1992) Characterization of soluble platelet guanylyl cyclase with peptide antibodies. Naunyn. Schmiedebergs Arch. Pharmacol. 346, 537–541[Medline]
  16. Nitsch, D. D., Ghilardi, N., Mühl, H., Nitsch, C., Brüne, B., and Pfeilschifter, J. (1997) Apoptosis and expression of inducible nitric oxide synthase are mutually exclusive in renal mesangial cells. Am. J. Pathol. 150, 889–900[Abstract]
  17. Schmidt, H. H. H. W., Pollock, J. S., Nakane, M., Gorsky, L. D., Förstermann, U., and Murad, F. (1991) Purification of a soluble isoform of guanylyl cyclase-activating-factor synthase. Proc. Natl. Acad. Sci. USA 88, 365–369[Abstract/Free Full Text]
  18. Laemmli, U. K. (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature (London) 227, 680–685[Medline]
  19. Radomski, M. W., Palmer, R. M., and Moncada, S. (1990) Glucocorticoids inhibit the expression of an inducible, but not the constitutive, nitric oxide synthase in vascular endothelial cells. Proc. Natl. Acad. Sci. USA 87, 10043–10047[Abstract/Free Full Text]
  20. DiRosa, M., Radomski, M., Carnuccio, R., and Moncada, S. (1990) Glucocorticoids inhibit the induction of nitric oxide synthase in macrophages. Biochem. Biophys. Res. Commun. 172, 1246–1252[Medline]
  21. Kleinert, H., Euchenhofer, C., Ihrig-Biedert, I., and Förstermann, U. (1996) Glucocorticoids inhibit the induction of nitric oxide synthase II by down-regulating cytokine-induced activity of transcription factor nuclear factor-{kappa}B. Mol. Pharmacol. 49, 15–21[Abstract]
  22. Misko, T. P., Moore, W. M., Kasten, T. P., Nickols, G. A., Corbett, J. A., Tilton, R. G., McDaniel, M. L., Williamson, J. R., and Currie, M. G. (1993) Selective inhibition of the inducible nitric oxide synthase by aminoguanidine. Eur. J. Pharmacol. 233, 119–125[Medline]
  23. Griffiths, M. J. D., Messent, M., Macallister, R. J., and Evans, T. W. (1993) Aminoguanidine selectively inhibits inducible nitric oxide synthase. Br. J. Pharmacol. 110, 963–968[Medline]
  24. Förstermann, U., and Kleinert, H. (1995) Nitric oxide synthase: expression and expressional control of the three isoforms. Naunyn. Schmiedeberg's Arch. Pharmacol. 352, 351–364[Medline]
  25. Sherman, P. A., Laubach, V. E., Reep, B. R., and Wood, E. R. (1993) Purification and cDNA sequence of an inducible nitric oxide synthase from a human tumor cell line. Biochemistry 32, 11600–11605[Medline]
  26. Gath, I., Closs, E. I., Gödtel-Armbrust, U., Schmitt, S., Nakane, M., Wessler, I., and Förstermann, U. (1996) Inducible NO synthase II and neuronal NO synthase I are constitutively expressed in different structures of guinea pig skeletal muscle: implications for contractile function. FASEB J. 10, 1614–1620[Abstract]
  27. Hoffman, R. A., Zhang, G. S., Nüssler, N. C., Gleixner, S. L., Ford, H. R., Simmons, R. L., and Watkins, S. C. (1997) Constitutive expression of inducible nitric oxide synthase in the mouse ileal mucosa. Am. J. Physiol. 272, G383–G392[Abstract/Free Full Text]
  28. Förstermann, U., Schmidt, H. H. H. W., Kohlhaas, K. L., and Murad, F. (1992) Induced RAW 264.7 macrophages express soluble and particulate nitric oxide synthase: inhibition by transforming growth factor-beta. Eur. J. Pharmacol. Mol. Pharmacol. 225, 161–165[Medline]
  29. Gath, I., Gödtel-Armbrust, U., and Förstermann, U. (1997) Expressional downregulation of neuronal-type NO synthase I in guinea pig skeletal muscle in response to bacterial lipopolysaccharide. FEBS Lett. 410, 319–323[Medline]
  30. Mülsch, A., Busse, R., Liebau, S., and Förstermann, U. (1988) LY 83583 interferes with the release of endothelium-derived relaxing factor and inhibits soluble guanylate cyclase. J. Pharmacol. Exp. Ther. 247, 283–288[Abstract/Free Full Text]
  31. Mayer, B., Brunner, F., and Schmidt, K. (1993) Inhibition of nitric oxide synthesis by methylene blue. Biochem. Pharmacol. 45, 367–374[Medline]
  32. Garthwaite, J., Southam, E., Boulton, C. L., Nielsen, E. B., Schmidt, K., and Mayer, B. (1995) Potent and selective inhibition of nitric oxide-sensitive guanylyl cyclase by 1H-[1,2,4]oxadiazolo[4,3-a]quinoxalin- 1-one. Mol. Pharmacol. 48, 184–188[Abstract]
  33. Rachmilewitz, D., Stamler, J. S., Bachwich, D., Karmeli, F., Ackerman, Z., and Podolsky, D. K. (1995) Enhanced colonic nitric oxide generation and nitric oxide synthase activity in ulcerative colitis and Crohn's disease. Gut 36, 718–723[Abstract/Free Full Text]
  34. Ford, H., Watkins, S., Reblock, K., and Rowe, M. (1997) The role of inflammatory cytokines and nitric oxide in the pathogenesis of necrotizing enterocolitis. J. Pediatr. Surg. 32, 275–282[Medline]



This article has been cited by other articles:


Home page
 Am. J. Physiol. Gastrointest. Liver Physiol.Home page
S. P. Rao, Z. Sellers, D. L. Crombie, D. L. Hogan, E. A. Mann, D. Childs, S. Keely, M. Sheil-Puopolo, R. A. Giannella, K. E. Barrett, et al.
A role for guanylate cyclase C in acid-stimulated duodenal mucosal bicarbonate secretion
Am J Physiol Gastrointest Liver Physiol, January 1, 2004; 286(1): G95 - G101.
[Abstract] [Full Text] [PDF]

Home page
 J. Nutr.Home page
L. Cui, R. K. Blanchard, and R. J. Cousins
The Permissive Effect of Zinc Deficiency on Uroguanylin and Inducible Nitric Oxide Synthase Gene Upregulation in Rat Intestine Induced by Interleukin 1{alpha} Is Rapidly Reversed by Zinc Repletion
J. Nutr., January 1, 2003; 133(1): 51 - 56.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Gastrointest. Liver Physiol.Home page
I. A. Murray, I. Daniels, K. Coupland, J. A. Smith, and R. G. Long
Increased activity and expression of iNOS in human duodenal enterocytes from patients with celiac disease
Am J Physiol Gastrointest Liver Physiol, August 1, 2002; 283(2): G319 - G326.
[Abstract] [Full Text] [PDF]

Home page
 GutHome page
A Fasano
Toxins and the gut: role in human disease
Gut, May 1, 2002; 50(90003): iii9 - 14.
[Abstract] [Full Text] [PDF]

Home page
 J Med MicrobiolHome page
M. SAARINEN, P. EKMAN, Q. HE, M. IKEDA, M. VIRTALA, D. T. Y. YU, H. ARVILOMMI, and K. GRANFORS
Elimination of Salmonella enterica serotype Enteritidis in intestinal epithelial cells by mechanisms other than nitric oxide
J. Med. Microbiol., January 1, 2002; 51(1): 13 - 19.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Closs, E. I.
Right arrow Articles by Förstermann, U.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Closs, E. I.
Right arrow Articles by Förstermann, U.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS