| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
a Department of Molecular Pharmacology and Biological Chemistry, Northwestern University Drug Discovery Program, Northwestern University Institute for Neuroscience, Northwestern University Medical School, Chicago, Illinois 60611–3008, USA
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
Key Words: melatonin receptors • suprachiasmatic nucleus • C3H/HeN mouse • luzindole • 4P-ADOT • 4P-PDOT • mt1 • Mel1a • Mel1b
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
Melatonin activates membrane receptors and putative cytoplasmatic and nuclear sites to mediate a variety of physiological responses (4, 5). In mammals, two molecularly distinct G-protein-coupled melatonin receptor subtypes have been identified [mt1 (Mel1a), MT2 (Mel1b)] (16, 17). These melatonin receptor subtypes show 60% homology at the amino acid level (18, 19) and can be distinguished pharmacologically when using partial agonists and antagonists for melatonin receptors (4, 9). The inhibition of dopamine release from rabbit retina is mediated through activation of MT2 presynaptic heteroreceptors (9); the subtype that mediates phase shifts of circadian rhythms in the SCN, however, is not known. The mt1 melatonin receptor was initially suggested to mediate circadian functions in mammals due to the high level of expression within the mammalian SCN (18). However, while deletion of the mt1 melatonin receptor in the C57BL/6 mouse blocks the melatonin-induced inhibition of neuronal firing in SCN slices, melatonin-mediated phase shifts of circadian firing rhythms are not impaired (11). This phase-shifting effect of melatonin is pertussis toxin sensitive, suggesting the involvement of another, as yet unidentified G-protein-coupled receptor (11, 13).
This study reports for the first time the expression of both mt1 and MT2 melatonin receptor mRNA within the SCN (using in situ hybridization) and the antagonism of melatonin-mediated phase advances of circadian activity rhythms (using MT2 selective melatonin receptor antagonists) in the C3H/HeN mouse. We used the C3H/HeN mouse in these studies because it produces melatonin in the pineal gland (20); in this strain, melatonin phase shifts circadian activity rhythms with periods of sensitivity identical to those found in humans (12, 21).
|
EXPERIMENTAL PROCEDURES |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
The melatonin receptor antagonists luzindole, 4P-ADOT, and 4P-PDOT were screened on 50 binding assays to determine their affinity for G-protein-linked receptors (adenosine, 
-adrenergic, ß-adrenergic, dopamine, GABA A and B, glutamate, histamine, muscarinic, serotonin), channels (L and N calcium, chloride, NMDA, calcium-activated potassium/voltage insensitive), brain/gut peptides receptors (type 2 angiotensin II, cholecystokinin, neurokinin, neuropeptide Y, neurotensin, somatostatin, vasoactive intestinal peptide, vasopressin), growth factors/hormones receptors (atrial natriuretic peptide A, epidermal growth factor), neurotransmitter transporters (choline, dopamine, norepinephrine, serotonin), and second messengers (adenylate cyclase, inositol triphosphate, protein kinase C). None of the analogs produced significant inhibition of specific radioligand binding at a concentration of 10 µM. Screening was performed by Novascreen (Hanover, Mass.) as part of the National Institute of Mental Health Drug Discovery Program.
Cell lines
Stable cell lines expressing either the human recombinant mt1 or mt2 melatonin receptors were developed according to the method of lipofection by transfection of CHO-K1 cells (23), with the corresponding cDNAs containing the complete coding regions of the human melatonin receptors [Mel1a (mt1) cloned into pcDNAI; Mel1b (mt2) cloned into pcDNA-3]. Melatonin receptor cDNAs were provided by Dr. Steve M. Reppert, Massachusetts General Hospital and Harvard Medical School, Boston, Mass. (18, 19). Products for cell culture were obtained from Gibco BRL (Grand Island, N.Y.). The affinity constants and total number of binding sites for 2-[125I]iodomelatonin binding were KD = 44 ± 6.88 pM and Bmax = 1569 ± 503 fmol/mg protein for CHO-mt1, and KD = 149 ± 15 pM and Bmax = 839 ± 303 fmol/mg protein for CHO-mt2.
2-[125I]Iodomelatonin binding
Competition studies of various agents for 2-[125I]iodomelatonin (SA=2200 Ci/mmol Dupont/New England Nuclear, Boston, Mass.) binding to CHO cell membranes were performed as described (9). Briefly, cells grown to confluence were washed with phosphate-buffered saline (PBS), lifted in 10 mM potassium phosphate buffer (pH, 7.4) with EDTA (1 mM), pelleted by centrifugation (600 g, 5 min), and stored at -80°C until use. Cell pellets were resuspended in Tris-Mg [Tris-HCl, 50 mM; MgCl2 10 mM (pH 7.4)] and pelleted by centrifugation (40,000xg for 10 min). Cell membrane pellets were resuspended in Tris-Mg to give a final concentration of approximately 1.5–2 µg/assay.
Cell membranes were incubated with 2-[125I]iodomelatonin (80–100 pM) in the absence or presence of appropriate concentrations of drugs (0.1 pM to 10 µM dissolved in HCl 0.01 N with 0.1% bovine serum albumin) in a total reaction volume of 260 µl and incubated at 25°C for 1.5 h. Reactions were terminated upon addition of ice-cold Tris-Mg buffer and by rapid vacuum filtration through glass fiber filters (Schleicher and Schuell, No 30) soaked in 0.5% polyethylenimine solution. Each filter was washed twice with 5 ml of ice-cold Tris-Mg buffer. Radioactivity was determined in a gamma counter. Specific 2-[125I]iodomelatonin binding defined with melatonin (1 µM) was 95% of total binding. Protein content was determined as described (24).
Individual IC50 values were obtained from concentration effect curves using a commercial software (GraphPad PRISMTM, San Diego, Calif.). Ki values were calculated from IC50 values by using the Cheng and Prusoff (25) equation. Results are expressed as mean ± SEM.
Circadian activity rhythms
Male C3H/HeN mice (5–6 wk old, Harlan, Indianapolis, Ind.) were housed in groups of five and maintained in temperature (22±1°C) and humidity controlled rooms. Food and water were provided ad libitum. Animals were maintained for 2 wk on a 12/12 light/dark cycle (300 lux at the level of the cage), then transferred to constant and complete darkness in individual cages (18x30x12 cm) equipped with activity wheels. All animal care and procedures were performed in accordance with institutional guidelines.
Rhythms of wheel-running activity were measured with a magnetic microswitch, which detected revolutions of the running wheel and was on line with an Epson 286 computer, as previously described (12). Data were collected using the Dataquest III hardware and software package and analyzed with the assistance of TAU software (Mini-mitter, Sunriver, Oreg.). Mice were treated with vehicle, melatonin, and antagonists alone or in combination at circadian time 10 (CT 12: onset of activity). The exact circadian time of the pulse was determined after treatment from the onset of steady-state activity on the day of the pulse. Phase shifts were assessed by aligning the TAU guide by eye over the steady-state activity onsets of free-running activity for 7 to 10 days before the pulse and from day 4 to 14 after the pulse. Transient shifts in activity onset for up to 3 days after the pulse were excluded. Phase shifts induced by treatment were measured in hours as the difference between the steady-state pre- and postpulse activity onsets, using the TAU program ruler. Differences between vehicle/melatonin and antagonist/melatonin treated groups were assessed for each melatonin dose by analysis of variance, followed by pairwise comparisons when indicated (GraphPad Prism, San Diego, Calif).
Mice were kept under constant darkness for 3 wk to stabilize the free-running activity rhythm. Mice were treated on three consecutive days at circadian time 10; CT 10 was estimated from the tau for each day. Each mouse was treated with both 1) vehicle (30% ethanol in 0.1 ml saline) or a melatonin antagonist dissolved in vehicle and 2) saline or melatonin dissolved in saline. These two daily treatments were carried out 10 min apart. Mice were treated with melatonin (0.3, 0.9, 3, 9, or 30 µg/mouse) and or one of the following antagonists: luzindole, 300 µg/mouse; 4P-ADOT, 90 µg/mouse; 4P-PDOT, 90 µg/mouse. Each mouse received one treatment every 3 wk and a total of four treatments. All treatments were performed under a dim red light (15 watt, Kodak 1A filter) with illuminance of less than 3 lux.
Receptor autoradiography
Male C3H/HeN mice free running in constant dark were killed at CT 10, and brains were dissected and processed for receptor autoradiography as described (26, 27). Coronal brain sections (20 µm) were cut on a Reichert-Jung cryostat (Leica, Deerfield, Ill.) and thaw mounted onto gelatin-coated slides. Rostrocaudal brain sections containing the SCN were successively placed on a series of six slides so that sequential sections through the whole SCN could be analyzed. Slides were stored at >80°C until processing. Slide-mounted sections were air dried for 15 min and then incubated with 2-[125I]iodomelatonin (280 pM) in Tris-Ca buffer [Tris-HCl, 50 mM; CaCl2, 4 mM (pH 7.4)] for 1 h at 25°C. Sections from each mouse brain were incubated with 2-[125I]iodomelatonin either without (total binding) or in the presence of the following agents: melatonin (1 µM), luzindole (100 nM and 10 µM), and 4P-ADOT (1 nM and 100 nM). Slides were rinsed twice for 15 min in ice-cold Tris-Ca buffer, followed by a rapid rinse in ice-cold distilled water to remove buffer salts.
Autoradiographic experiments were also run using Tris-HCl buffer (50 mM) with 0.1% bovine serum albumin (pH 7.4) and shorter washes. Slide-mounted sections were air dried for 15 min and preincubated in the presence of vehicle (total binding) or melatonin (0.1 µM) or 4P-ADOT (1 and 100 nM) for 1 h. Sections were subsequently incubated for an additional hour with 2-[125I]iodomelatonin (260 pM), vehicle, and drugs, as appropriate. Sections were rinsed either twice for 5 min or twice for 1 min in Tris-HCl buffer, followed by a rapid rinse in ice-cold distilled water.
Labeled sections were apposed to Kodak SB X-ray film for 7 days. Films were developed with Kodak D19 developer. Optical densities of autoradiograms were measured with a computer-based image analysis system (Bioquant System IV, R & M Biometrics, Nashville, Tenn.), using 14C standards calibrated for use with 125I as described previously (26, 28).
In situ hybridization
Digoxigenin-labeled antisense and sense oligonucleotide probes were used to selectively hybridize with the mt1 or MT2 melatonin receptor mRNAs. The specificity of the oligonucleotide sequences was assessed by using alignment comparisons against the GenBank database (29). The oligonucleotide designed to hybridize with the mt1 mRNA (TGAGGAGCACGTAGCAGAGGGAGTTCTTGC, 30 mer) corresponded to bases 431–460 of the mouse mt1 melatonin receptor sequence (GenBank access number: U52222). The oligonucleotides designed to hybridize with the MT2 mRNA (CGGGTCATATTCTAGAGACCCCACAAAGAAA, 31 mer) corresponded to bases (111–141) of the mouse MT2 melatonin receptor partial sequence (GenBank Access number: U57554). These oligonucleotides showed little homology with other known sequences stored in the GenBank database. Antisense and sense oligonucleotide probes were synthesized at the Northwestern University Biotechnology Facility (Chicago, Ill.). Probes were tailed with digoxigenin (DIG) -tagged dATP using the DIG/GeniusTM 6 oligonucleotide tailing kit (Boehringer-Mannheim, Indianapolis, Ind.) according to the manufacturer's instructions. Briefly, each oligonucleotide probe was incubated with DIG-dATP in a 1:5 ratio in the presence of terminal transferase for 1 h at 37°C. Labeled oligonucleotides were purified by ethanol precipitation.
Male C3H/HeN mice free running in constant dark were killed at CT 10. Serial coronal mouse brain sections (30 µm) were cut on a Reichert-Jung cryostat (Leica) and thaw-mounted onto silane-coated slides. Sections were processed for nonradioactive in situ hybridization following a method previously reported, with slight modifications (30). Sections were fixed in 4% paraformaldehyde in PBS (pH 7.4), rinsed twice in PBS, acetylated (10 min), dehydrated, delipidated, and air dried. Sections were then hybridized in the presence of 10–30 ng digoxigenin-labeled antisense or sense oligonucleotide probes selective for mt1 or MT2 receptor mRNAs. The hybridization solution contained 50% deionized formamide, 4x SSC, 10% dextran sulfate, 500 µg/ml sonicated and denatured salmon sperm DNA, 250 µg/ml yeast tRNA, 100 mM dithiothreitol, and 0.02% each of Ficoll, polyvinylpyrrolidone, and bovine serum albumin. Hybridization was carried out in a humid chamber overnight at 37°C. Nonspecific hybridization of the probes was minimized by washing the sections in 1x SSC at 50°C (4x15 min), followed by four washes at room temperature (4x15 min). The hybridization signal was detected using alkaline phosphatase conjugated anti-digoxigenin IgG (Boehringer-Mannheim), followed by the chromagen BCIP/NBT (Vector Lab, Burlingame, Calif.) in the presence of levamisole (1 mM).
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
Figure 1
shows competition of luzindole, 4P-ADOT, and 4P-PDOT for 2-[125I]iodomelatonin binding to the h mt1 and h MT2 melatonin receptors stably expressed in CHO-K1 cells. Luzindole (Ki=7.3±2.0 nM, n=4), 4P-ADOT (Ki=0.4±0.02 nM, n=3), and 4P-PDOT (Ki=0.41±0.04 nM, n=3) showed high affinity for competition with 2-[125I]iodomelatonin binding to the h MT2 melatonin receptor. The Ki affinity ratios for luzindole, 4P-ADOT, and 4P-PDOT showed that the compounds had 25-, 951-, and 1581-fold higher affinity for the h MT2 than the h mt1 melatonin receptor subtype ( Fig. 1).
|
The relative density of the mt1 and MT2 melatonin receptor subtypes in the C3H/HeN mouse SCN was assessed by competition of melatonin receptor antagonists for 2-[125I]iodomelatonin (280 pM) binding at a saturating concentration using quantitative receptor autoradiography (26, 27). Figure 2A
shows high-affinity 2-[125I]iodomelatonin binding (total binding: 25.1±2.2 fmol/mg protein, n=3) in the SCN. Melatonin (1 µM) or luzindole (10 µM), at concentrations that competed for both the mt1 and MT2 receptor (
Fig. 1A), defined 86 and 70% specific 2-[125I]iodomelatonin binding to the SCN, respectively ( Fig. 2B, D; Fig. 3).
Concentrations of luzindole (100 nM) or 4P-ADOT (1 and 100 nM), which competed primarily for 2-[125I]iodomelatonin to the MT2 receptor ( Fig. 1A, B), did not reduce total binding in adjacent sections ( Fig. 2C, E, F; Fig. 3). To decrease dissociation of 2-[125I]iodomelatonin binding from a lower affinity melatonin receptor site (e.g., MT2, see KD values in legend of Fig. 1), washing times were reduced to either 2 or 10 min (32). Although under these experimental conditions the background in the autoradiograms was high, the specific binding defined by melatonin (0.1 µM) after 10 min (94%) and 2 min (84%) washes was essentially identical (data not shown) to that defined when using longer washes ( Fig. 3). Similarly, 4P-ADOT (1 nM and 100 nM) did not compete for 2-[125I]iodomelatonin binding to the C3H/HeN mouse SCN (data not shown).
|
|
We next asked whether the mRNA for the molecularly defined melatonin receptor subtypes mt1 and MT2 could be detected in the SCN of the C3H/HeN mouse by using in situ hybridization with digoxigenin-labeled antisense oligonucleotide probes. Selective antisense oligonucleotide probes for the mt1 ( Fig. 4A)
and MT2 ( Fig. 4C) melatonin receptor subtypes showed robust hybridization in the SCN, whereas hybridization of corresponding sense oligonucleotide probes to either receptor was negligible ( Fig. 4B, D). In SCN sections obtained within the intermediate level of the SCN, mt1 mRNA was evenly distributed, with sparse expression in the medial crescent ( Fig. 4A). In contrast, the level of MT2 mRNA expression in the SCN was higher in the medial crescent ( Fig. 4C).
|
In C3H/HeN mice, as in humans, melatonin administration for three consecutive days phase-advances circadian activity rhythms when given at the end of the subjective day (CT 10) (6, 12, 21). Figure 5
shows representative actograms of circadian rhythms of wheel running activity obtained in C3H/HeN mice kept in constant dark. Treatment with vehicle, followed by saline administration for three consecutive days at CT 10, did not affect the rhythm of wheel running activity ( Fig. 5) (12). Melatonin administration at CT 10 induced advances in the phase of the circadian activity rhythms in a dose-dependent manner (0.3 to 30 µg/mouse) ( Fig. 5A and 6A). The dose of melatonin inducing a half-maximal phase advance (EC50) was 0.72 µg/mouse with a maximal advance of 0.98 ± 0.08 h (n=15) at 9 µg/mouse and a slope of 0.53 ± 0.02 ( Fig. 6A).
|
|
To determine the involvement of mt1 or MT2 melatonin receptor subtypes on melatonin-induced phase advances, we assessed the ability of luzindole (showing 20 fold higher affinity for the MT2 receptor) to block phase advances of circadian activity rhythms in C3H/HeN mice (12). Luzindole (300 µg/mouse, s.c.) did not affect the phase of the clock when administered alone at CT 10 to C3H/HeN mice free running in constant dark. However, luzindole competitively antagonized the phase advance induced by 0.9 and 3 µg/mouse of melatonin ( Fig. 6B). The two 4-phenyl amidotetraline antagonists, 4P-ADOT and 4P-PDOT, with 951- and 1580-fold higher affinity for the MT2 melatonin receptor subtype, did not affect the phase of circadian activity rhythms when administered at 90 µg/mouse in combination with saline at CT 10 ( Fig. 5B and Fig. 6B). These subtype-selective MT2 melatonin receptor antagonists shifted the dose-response curve to the right as they significantly reduced the phase-shifting effect of 0.9 and 3 µg melatonin ( Fig. 6B). The selective MT2 melatonin receptor antagonist 4P-PDOT also antagonized the phase shifts induced by 9 µg melatonin (P<0.05, Fig. 6B). We observed a statistically significant reduction in melatonin (0.3 µg/mouse) -induced phase advances at CT 10 with a lower dose of 4P-ADOT (30 µg/mouse) (data not shown).
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
To identify physiological responses mediated through activation of melatonin receptor subtypes, it is necessary to use subtype-selective and specific antagonists. The synthetic melatonin receptor antagonists used here—luzindole, 4P-ADOT, and 4P-PDOT—show specificity for melatonin receptors as they did not compete for binding of 49 radioligands to receptors, channels, transporters, and second messengers (see Methods). These analogs, however, competed for 2-[125I]iodomelatonin binding to rabbit retina membranes and antagonized melatonin-mediated inhibition of dopamine release from this tissue (4, 9, 31). Luzindole, 4P-ADOT, and 4P-PDOT are high-affinity melatonin receptor antagonists (KB: 20, 1.6, and 0.3 nM, respectively), as they blocked the melatonin presynaptic heteroreceptor mediating inhibition of dopamine release in rabbit retina (4, 9, 14). The affinity of these antagonists for the presynaptic melatonin heteroreceptor is almost identical to their affinity to compete for 2-[125I]iodomelatonin binding to the recombinant h MT2 melatonin receptor expressed in either COS-7 (9) or CHO cells ( Fig. 1). These results led to the conclusion that the presynaptic melatonin heteroreceptor of rabbit retina is the MT2 melatonin receptor subtype (9).
The selectivity and specificity of melatonin receptor antagonists on the mt1 and MT2 melatonin receptors appears to be conserved across species. The affinity of luzindole for the human MT2 melatonin receptor is 25-fold higher than the affinity for the mt1 receptor subtype, as determined by competition for 2-[125I]iodomelatonin binding to human mt1 or MT2 receptors expressed either in HEK293 kidney (33), COS-7 (9), or CHO cells ( Fig. 1). The nonselective melatonin receptor antagonist luzindole competes for 2-[125I]iodomelatonin binding to the recombinant h mt1 melatonin receptor expressed in CHO cells, with an affinity (Ki=179 nM) almost identical to the dissociation constant (KB) determined in functional studies. Luzindole antagonizes both the melatonin-induced inhibition of forskolin-stimulated cAMP formation in CHO cells expressing the mt1 human melatonin receptor (KB=126 nM; unpublished results) and the melatonin-induced potentiation of norepinephrine-mediated vasoconstriction in rat caudal artery (KB=300 nM; ref 34). Taken together, these studies strongly suggest that these selective and specific melatonin receptor antagonists can be used to elucidate the melatonin receptor subtype that mediates the phase shifting effects of melatonin in the mouse.
The selective MT2 melatonin receptor antagonist 4P-ADOT did not compete for 2-[125I]iodomelatonin binding to frozen sections of the C3H/HeN mouse SCN when using either short or long washes. The specific binding defined by 0.1 µM melatonin was identical when using long or short washes, which exclude binding of the radioligand to a lower affinity melatonin receptor (32). These findings suggest that either the density of the MT2 melatonin receptor protein in the C3H/HeN mouse SCN is below the limits of detection or that 2-[125I]iodomelatonin is not able to recognize the native MT2 melatonin receptor protein in frozen brain sections. Undetectable levels of 2-[125I]iodomelatonin binding were also reported in the SCN of mt1 knockout C57BL/6 mice (11). The lack of specific 2-[125I]iodomelatonin binding to MT2 native receptors in the SCN could be attributed to 1) the low level of MT2 native melatonin receptor protein in the SCN, 2) the inability of this agonist radioligand to promote the coupling of G-proteins with the high-affinity state of the MT2 melatonin receptor, and/or 3) the lack of optimal experimental conditions to promote specific labeling of the MT2 native receptor protein. In support of these suggestions, we have demonstrated that the pharmacological profile of 2-[125I]iodomelatonin binding to the C3H/HeN mouse SCN corresponds closely (unpublished results) to that shown for the recombinant h mt1 receptor (9). Taken together with the lack of 2-[125I]iodomelatonin specific binding in the SCN of the C57BL/6 mt1 knockout mouse (11), we conclude that in the mammalian SCN, 2-[125I]iodomelatonin labels almost exclusively the mt1 melatonin receptor.
The mRNA for both the mt1 and MT2 molecularly defined melatonin receptor subtypes could be detected in the SCN of the C3H/HeN mouse by using digoxigenin-labeled antisense oligonucleotide probes. Expression of mt1 mRNA by in situ hybridization using riboprobes was previously demonstrated in the C3H/HeN mouse (26) and rat (18) SCN. However, this paper is the first report demonstrating expression of MT2 mRNA in mammals when using in situ hybridization histochemistry. In the human retina and brain (as in the SCN) of the C57BL/6 mouse, the presence of MT2 melatonin receptor mRNA expression has previously been observed by reverse transcription-polymerase chain reaction (11, 19). The mt1 melatonin receptor mRNA expresses in the mouse SCN after a circadian rhythm with high levels at night (26, 35). Preliminary experiments suggest that in C3H/HeN mouse SCN, the expression of MT2 mRNA is low in the middle of the light period and higher during the dark period of a 12/12 light/dark cycle (unpublished results). These results raise the possibility that the inability to detect the MT2 receptor subtype by receptor autoradiography in the SCN of the mt1 knockout mice is due to expression of this protein at times other that those selected in this and other studies (11). Together, the results suggest that the expression of the MT2 melatonin receptor mRNA is more widespread than previously thought. Indeed, we have demonstrated expression of both mt1 and MT2 mRNA in the human cerebellum and in rat caudal artery and superior cervical ganglia (unpublished results).
In this study, melatonin administration for three consecutive days phase-advanced circadian activity rhythms in a dose-dependent manner. We originally demonstrated that in the C3H/HeN mouse, as in humans, melatonin administration for three consecutive days phase-shifts circadian activity rhythms, inducing either advances when given at the end of the subjective day (CT 10) or delays when given at the end of the subjective night (CT 22-CT 2) (6, 12, 21). We have extended these observations and demonstrated that low doses of melatonin (0.9 to 9 µg/mouse s.c.) are able to affect the phase of the clock. The half-maximal dose of melatonin to phase-advance circadian activity rhythms in the mouse was similar in magnitude to that necessary to induce entrainment in rats in vivo (36). Similarly, in in vitro rodent SCN slices (11, 13, 15) melatonin advances circadian rhythms of electrical activity when applied at CT 10 with a potency (IC50=9 pM) almost identical to that required for inhibition of calcium-dependent release of dopamine from rabbit retina (37). These responses are blocked by luzindole, indicating activation of a melatonin receptor by melatonin (14, 15). These results suggest that melatonin at both physiological and pharmacological doses acts within the circadian timing system to phase-shift the master biological clock.
Evidence suggests that the melatonin receptor (or receptors) mediating phase shifts of circadian activity rhythms is likely to be localized within the mammalian SCN. The phase advance of circadian rhythms of electrical activity elicited by melatonin in the rat SCN slice is blocked by luzindole (15). In addition, melatonin inhibits metabolic activity in the rat SCN (38) and is unable to phase-shift circadian rhythms in SCN lesioned rats (2). It follows that melatonin receptors in retina are unlikely to contribute to the phase shifting effects of the hormone since, in enucleated C3H/HeN, the phase advances of circadian activity rhythms mediated by melatonin (30 µg/mouse) were similar in magnitude to those observed in control animals (data not shown). Similarly, in blind humans, melatonin entrains free-running rhythms (39). Our data strongly suggest that, in the C3H/HeN mouse, activation of a melatonin receptor within the circadian timing system, possibly the SCN, mediates phase advances in circadian activity rhythms.
Specific and MT2 subtype-selective antagonists for melatonin receptors blocked the melatonin-mediated phase advances of circadian activity rhythms in the C3H/HeN mouse. The MT2 subtype-selective antagonists 4P-ADOT and 4P-PDOT were able to antagonize the phase shift in circadian activity rhythms elicited by melatonin at both 0.9 and 3 µg/mouse. Both antagonists (90 µg/mouse) were effective at doses lower than that of luzindole (300 µg/mouse), reflecting the higher affinity of the 4-phenyl 2-amidotetralines for the MT2 receptor (9). These results suggest that activation of a G-protein-coupled melatonin receptor within the circadian timing system with pharmacological similarities to the h MT2 and the presynaptic melatonin heteroceptor mediating inhibition of dopamine release in retina (9) phase-shifts circadian activity rhythms in the C3H/HeN mouse.
The MT2 melatonin receptor appears to be emerging as the subtype involved in mediating important physiological functions by melatonin in the visual, vascular, and circadian systems ( Table 1).
Pharmacological studies using subtype-selective antagonists have demonstrated that the melatonin receptor involved in mediating inhibition of dopamine release from rabbit retina is the MT2 subtype (9). The dual effect of melatonin on phenylephrine-mediated vasoconstriction in rat caudal artery appears to be mediated by activation of two distinct receptor subtypes: vasoconstriction by an mt1-like subtype and vasodilation by the MT2 subtype (40) ( Table 1). In the mammalian SCN, activation of G-protein-coupled receptor subtypes by melatonin appears to mediate two distinct functional responses: acute inhibition of neuronal firing through the mt1 subtype and time-dependent phase shifts of circadian rhythms through the MT2 subtype (10, 11; present data) ( Table 1). Melatonin-mediated activation of the mt1 subtype in the SCN and/or other limbic system areas may mediate somnogenic effects (11, 41), whereas activation of the MT2 subtype may be involved in the regulation of circadian rhythms. It thus follows that MT2-selective melatonin receptor agonists and/or antagonists may be used to treat disorders involving alterations in the phase of the circadian clock as observed in depression (8), blindness (39), delayed sleep phase syndrome (7), or after a rapid change in the light dark/cycle such as jet travel and shift work (7). We conclude that the use of specific and subtype-selective mt1 and MT2 melatonin receptor antagonists will elucidate the functional role of melatonin in mammals and may prompt the development of subtype-selective analogs for treatment of insomnia and of circadian sleep and mood disorders.
|
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
2 Abbreviations: SCN, suprachiasmatic nucleus; MLT, melatonin; 4P-ADOT, 4-phenyl 2-acetamidotetraline; 4P-PDOT, 4-phenyl 2-propionamidotetraline; h, human; DIG, digoxigenin; PBS, phosphate-buffered saline; CT 10, circadian time 10.
3 Here we use the official nomenclature and classification for melatonin receptors recently approved by the Nomenclature Committee of the International Union of Pharmacology (16, 17). The denomination ‘mt1’ corresponds to that of the recombinant melatonin receptor subtype previously known as Mel1a, which does not show well-defined functional characteristics (18). The mt2 recombinant receptor, previously known as Mel1b (19), is referred to here as ‘MT2’ because it has a defined function and was pharmacologically characterized in a native tissue (9). The prefix ‘h’ is used to refer to human receptors.
Received for publication February 18, 1998. Accepted for publication April 6, 1998.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
This article has been cited by other articles:
|
|
 |
|
  S. Yasuo, T. Yoshimura, S. Ebihara, and H.-W. Korf Melatonin Transmits Photoperiodic Signals through the MT1 Melatonin Receptor J. Neurosci., March 4, 2009; 29(9): 2885 - 2889. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. G. Richter, C. Torres-Farfan, J. Garcia-Sesnich, L. Abarzua-Catalan, M. G. Henriquez, M. Alvarez-Felmer, F. Gaete, G. E. Rehren, and M. Seron-Ferre Rhythmic Expression of Functional MT1 Melatonin Receptors in the Rat Adrenal Gland Endocrinology, March 1, 2008; 149(3): 995 - 1003. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. E. Mistlberger and D. J. Skene Nonphotic Entrainment in Humans? J Biol Rhythms, August 1, 2005; 20(4): 339 - 352. [Abstract] [PDF]
|
|
|
|
|
|
K. Hirai, M. Kita, H. Ohta, H. Nishikawa, Y. Fujiwara, S. Ohkawa, and M. Miyamoto Ramelteon (TAK-375) Accelerates Reentrainment of Circadian Rhythm after a Phase Advance of the Light-Dark Cycle in Rats J Biol Rhythms, February 1, 2005; 20(1): 27 - 37. [Abstract] [PDF]
|
|
|
|
 |
|
 S. M. W Rajaratnam, B. Middleton, B. M Stone, J. Arendt, and D.-J. Dijk Melatonin advances the circadian timing of EEG sleep and directly facilitates sleep without altering its duration in extended sleep opportunities in humans J. Physiol., November 15, 2004; 561(1): 339 - 351. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. J. GERDIN, M. I. MASANA, M. A. RIVERA-BERMUDEZ, R. L. HUDSON, D. J. EARNEST, M. U. GILLETTE, and M. L. DUBOCOVICH Melatonin desensitizes endogenous MT2 melatonin receptors in the rat suprachiasmatic nucleus: relevance for defining the periods of sensitivity of the mammalian circadian clock to melatonin FASEB J, November 1, 2004; 18(14): 1646 - 1656. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Torres-Farfan, H. G. Richter, A. M. Germain, G. J. Valenzuela, C. Campino, P. Rojas-Garcia, M. L. Forcelledo, F. Torrealba, and M. Seron-Ferre Maternal melatonin selectively inhibits cortisol production in the primate fetal adrenal gland J. Physiol., February 1, 2004; 554(3): 841 - 856. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. J. Gerdin, M. I. Masana, D. Ren, R. J. Miller, and M. L. Dubocovich Short-Term Exposure to Melatonin Differentially Affects the Functional Sensitivity and Trafficking of the hMT1 and hMT2 Melatonin Receptors J. Pharmacol. Exp. Ther., March 1, 2003; 304(3): 931 - 939. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Mutoh, S. Shibata, H.-W. Korf, and H. Okamura Melatonin modulates the light-induced sympathoexcitation and vagal suppression with participation of the suprachiasmatic nucleus in mice J. Physiol., February 15, 2003; 547(1): 317 - 332. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 X. Jin, C. von Gall, R. L. Pieschl, V. K. Gribkoff, J. H. Stehle, S. M. Reppert, and D. R. Weaver Targeted Disruption of the Mouse Mel1b Melatonin Receptor Mol. Cell. Biol., February 1, 2003; 23(3): 1054 - 1060. [Abstract] [Full Text]
|
|
|
|
 |
|
 C. Torres-Farfan, H. G. Richter, P. Rojas-Garcia, M. Vergara, M. L. Forcelledo, L. E. Valladares, F. Torrealba, G. J. Valenzuela, and M. Seron-Ferre mt1 Melatonin Receptor in the Primate Adrenal Gland: Inhibition of Adrenocorticotropin-Stimulated Cortisol Production by Melatonin J. Clin. Endocrinol. Metab., January 1, 2003; 88(1): 450 - 458. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. I. Masana, S. Doolen, C. Ersahin, W. M. Al-Ghoul, S. P. Duckles, M. L. Dubocovich, and D. N. Krause MT2 Melatonin Receptors Are Present and Functional in Rat Caudal Artery J. Pharmacol. Exp. Ther., September 1, 2002; 302(3): 1295 - 1302. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. A. Ayoub, C. Couturier, E. Lucas-Meunier, S. Angers, P. Fossier, M. Bouvier, and R. Jockers Monitoring of Ligand-independent Dimerization and Ligand-induced Conformational Changes of Melatonin Receptors in Living Cells by Bioluminescence Resonance Energy Transfer J. Biol. Chem., June 7, 2002; 277(24): 21522 - 21528. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. I. Masana and M. L. Dubocovich Melatonin Receptor Signaling: Finding the Path Through the Dark Sci. Signal., November 6, 2001; 2001(107): pe39 - pe39. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Brydon, L. Petit, P. Delagrange, A. D. Strosberg, and R. Jockers Functional Expression of MT2 (Mel1b) Melatonin Receptors in Human PAZ6 Adipocytes Endocrinology, October 1, 2001; 142(10): 4264 - 4271. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. S. Nelson, M. Ikeda, H. S. Gompf, M. L. Robinson, N. K. Fuchs, T. Yoshioka, K. A. Neve, and C. N. Allen Regulation of Melatonin 1a Receptor Signaling and Trafficking by Asparagine-124 Mol. Endocrinol., August 1, 2001; 15(8): 1306 - 1317. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. L. Drazen, D. Bilu, S. D. Bilbo, and R. J. Nelson Melatonin enhancement of splenocyte proliferation is attenuated by luzindole, a melatonin receptor antagonist Am J Physiol Regulatory Integrative Comp Physiol, May 1, 2001; 280(5): R1476 - R1482. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. E. Hunt, W. M. Al-Ghoul, M. U. Gillette, and M. L. Dubocovich Activation of MT2 melatonin receptors in rat suprachiasmatic nucleus phase advances the circadian clock Am J Physiol Cell Physiol, January 1, 2001; 280(1): C110 - C118. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X.-M. Li, X.-H. Liu, E. Filipski, G. Metzger, P. Delagrange, J.-P. Jeanniot, and F. Levi Relationship of atypical melatonin rhythm with two circadian clock outputs in B6D2F1 mice Am J Physiol Regulatory Integrative Comp Physiol, April 1, 2000; 278(4): R924 - R930. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Benloucif, M. I. Masana, K. Yun, and M. L. Dubocovich Interactions between Light and Melatonin on the Circadian Clock of Mice J Biol Rhythms, August 1, 1999; 14(4): 281 - 289. [Abstract] [PDF]
|
|
|
|
 |
|
 S. Doolen, D. N. Krause, and S. P. Duckles Estradiol modulates vascular response to melatonin in rat caudal artery Am J Physiol Heart Circ Physiol, April 1, 1999; 276(4): H1281 - H1288. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
) and 10 min later with saline or melatonin (0.9–30 µg/mouse) (•), as indicated in the abscissa. The dose-response curve was fitted using the Graph-Pad PRISMTM program. The ED50 for melatonin was 0.72 µg/mouse. B) The ordinate represents the phase advance (h) of circadian activity rhythms at CT 10. C3H/HeN mice were treated with: vehicle (
), luzindole (300 µg/mouse) (
), 4P-ADOT (90 µg/mouse) (