FASEB J. Cell Migration Consortium
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ahmed, A.
Right arrow Articles by Jiang, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ahmed, A.
Right arrow Articles by Jiang, J.
(The FASEB Journal. 1998;12:831-843.)
© 1998 FASEB


RESEARCH COMMUNICATION

Localization, quantification, and activation of platelet-activating factor receptor in human endometrium during the menstrual cycle: PAF stimulates NO, VEGF, and FAKpp125

Asif Ahmeda,1, Sharon Dearna, Munjiba Shamsa, Xiao F. Lia, Rajbant K. Sanghaa, Marek Rola-pleszczynskib, and Jianqiao Jianga

a Reproductive Physiopathology Group, Departments of Obstetrics and Gynaecology, Birmingham Women's Hospital, University of Birmingham, Edgbaston, Birmingham, B15 2TG, U.K.
b Immunology Division, Faculty of Medicine, Université de Sherbrooke, Québec, Canada


   ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Implantation is characterized by an inflammatory-like response with expansion of extracellular fluid volume, increased vascular permeability, and vasodilatation. These effects are believed to be mediated at the paracrine level by prostaglandin E2 and platelet-activating factor (PAF), but the cellular mechanism (or mechanisms) remains largely unknown. We demonstrate that PAF receptor (PAF-R) immunoreactivity and mRNA are detected in proliferative and secretory endometrial glands, however, the responsiveness of endometrium to physiological concentrations of PAF is confined predominantly to the secretory endometrium. Semiquantitative reverse transcription-polymerase chain reaction revealed that PAF-R transcript levels were highest in the mid-late proliferative and late secretory phases of the cycle. Interaction of PAF with its receptor resulted in the rapid release of nitric oxide (NO), increased expression of vascular endothelial growth factor (VEGF), and activation of FAKpp125, a focal adhesion kinase, demonstrating that the PAF-R is functionally active. Inhibition of NO synthesis by NG-monomethyl-L-arginine produced dose-dependent attenuation of PAF-evoked NO release, indicating NOS activation; the dependency of PAF-evoked NO release on PKC and extracellular Ca2+ was confirmed by PKC inhibitor Ro 31–8220 and by the removal of extracellular Ca2+. PAF up-regulated VEGF gene expression in a concentration- and time-dependent fashion in human endometrial epithelial cell lysates. Transcription of VEGF was rapidly followed by secretion of the protein. These data support our premise that this autocoid acts as an angiogenic mediator in the regeneration of the endometrium after menses and as a vasodilator to promote blastocyst attachment during the implantation process.—Ahmed, A., Dearn, S., Shams, M., Li, X. F., Sangha, R. K., Rola-Pleszczynski, M., Jiang, J. Localization, quantification, and activation of platelet-activating factor receptor in human endometrium during the menstrual cycle: PAF stimulates NO, VEGF, and FAKpp125. FASEB J. 12, 831–843 (1998)


Key Words: PAF receptor • uterus • nitric oxide • menstruation • implantation


   INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
SUCCESSFUL MAMMALIAN pregnancy requires the preparation of a receptive endometrium into which the embryo attaches and invades. Implantation is characterized by an inflammatory-type response with expansion of extracellular fluid volume, increased vascular permeability, and vasodilatation (1). Platelet-activating factor (PAF)2 is a potent inflammatory lipid mediator that increases vascular permeability and vasodilatation, processes that accompany human implantation (2). PAF is produced by endometrial stromal cells, where its levels are hormonally regulated (3). In vitro PAF acts on glandular epithelium to release prostaglandins (4), and PAF antagonists inhibit implantation (5).

Actions of PAF are mediated by a specific PAF receptor (PAF-R). Molecular cloning of the PAF-R from a human leukocyte cDNA library has identified a seven-transmembrane spanning, G-protein-linked receptor superfamily that encodes a 342 amino acid protein with a calculated molecular mass of approximately 39 kDa (6). The human PAF-R gene contains no introns in its coding region and maps to chromosome 1 (7, 8). Although autoradiographic studies show binding of [3H]PAF to rabbit endometrial epithelium and to the embryonic disc of day 6 rabbit blastocysts (9), and reverse transcription-polymerase chain reaction (RT-PCR) demonstrated PAF-R mRNA in proliferative and secretory endometrium (10), the exact location of the receptors in human endometrium remains to be determined. This is especially important since the responsiveness of the endometrium to PAF appears to be confined to the secretory phase of the menstrual cycle, as demonstrated by PAF-stimulated prostaglandin E2 (PGE2) release (4), PAF-mediated activation of phospholipase C (11), and phospholipase D (12) activity in human secretory endometrium. Moreover, there is potentiation of PAF-evoked phospholipase D activity by 17ß-estradiol in the human endometrial cell line (13).

We provide the first evidence of PAF-R localization in uterine tissue and quantitative changes in mRNA encoding the PAF-R throughout the menstrual cycle, indicating sex steroid regulation of PAF-R in vivo. We also demonstrate that PAF may modulate neovascularization through the expression of vascular endothelial growth factor (VEGF) in human endometrium and that the potent vasodilatory properties of PAF may relate to its ability to stimulate the release of nitric oxide (NO), the formation of which is achieved by the conversation of L-arginine to L-citrulline by NO synthase (NOS) in the presence of molecular oxygen (14).


   MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Patient selection
Normal endometrial tissues were obtained from fertile subjects undergoing sterilization or from couples complaining of infertility with solely tubal damage and/or male infertility. All female subjects had regular menstrual bleeding with a menstrual cycle of 30±5 days for the previous 3 months. Women who had received any form of exogenous hormones, had used an intrauterine device in the previous 3 months, or exhibited demonstrable uterine pathology were excluded from the study. Endometrial biopsies were collected by routine dilatation and curettage. Sections from each endometrial specimens were dated from the last menstrual period and were used in the study only if there was corroboration by independent histological dating based on the criteria of Fox and Buckley (15). Ethical committee approval was obtained from the South Birmingham Ethical Committee.

Tissue collection
Endometrial tissue was rinsed in ice-cold phosphate-buffered saline (PBS) on ice to remove excess blood. Tissue was either immediately immersed in 4% formaldehyde and processed for paraffin wax embedding, rapidly frozen in liquid N2 for RNA and protein extraction, or rapidly frozen over dry ice, wrapped in Parafilm to prevent dehydration, and stored at -80°C until sectioned for in situ hybridization studies. For functional studies, endometrium was collected in sterile Hanks' balanced salt solution (HBSS, Gibco Ltd., Uxbridge, U.K.) and transported on ice to the laboratory.

Tissue explant procedure and cell line conditions
Endometrial biopsies (1 mm3 size) were placed on square sterile capillary matting in a multiwell incubating plate as previously described (11). Tissue was preincubated in Dulbecco's modified Eagle's medium (DMEM, Gibco Ltd., Uxbridge, U.K.) supplemented with Hepes buffer (20 mM; Gibco Ltd., Uxbridge, U.K.), L-glutamine (10 mM; Gibco Ltd., Uxbridge, U.K.), glucose (250 mM; Sigma Chemical Co. Ltd., Poole, Dorset, U.K.), and 0.1% bovine serum albumin (BSA, Sigma Chemical Co. Ltd., Poole, Dorset, U.K.) for 1 h at 37°C in 95% O2 and 5% CO2 at 95% humidity prior to agonist stimulation.

A spontaneously transformed human endometrial epithelial cell line (HES) generated by repeated passaging of cells obtained by routine dilatation and curettage was kindly provided by Dr. D. A. Kniss, Department of Obstetrics and Gynecology, Ohio State University, Columbus, Ohio. HES cells were maintained in 25 cm2 flasks in medium 199 (M199; Gibco Ltd., Uxbridge, U.K.) containing 10% (v/v) fetal calf serum (FCS; Gibco Ltd., Uxbridge, U.K.), 1% L-glutamine (Gibco Ltd., Uxbridge, U.K.), and 1% antibiotic mixture (10,000 U penicillin and 10 µg streptomycin; Gibco Ltd., Uxbridge, U.K.) at 37°C in 95% O2 and 5% CO2 at 95% humidity. Prior to agonist stimulation, growth medium was removed and subconfluent (85%) monolayers were serum starved for 24 h in serum-free M199 supplemented with 0.2% BSA.

Immunocytochemistry
Serial 4 µm sections of formalin-fixed, paraffin-embedded tissue were used for immunohistochemistry as previously described in detail (16). Briefly, sections were deparaffinized, hydrated, and endogenous peroxidase activity was quenched by the addition of 0.3% (v/v) of hydrogen peroxide for 10 min. Nonspecific protein binding sites were blocked with 10% normal goat serum in PBS for 30 min at room temperature in a humidified chamber. Sections were incubated with rabbit polyclonal anti-PAF-R antibody reported by Müller et al. (17) at 1:200 dilution in 10% goat serum and 0.3% Triton X-100 for 60 min at room temperature. Subsequently, the sections were incubated with a goat anti-rabbit IgG biotinylated secondary antibody and the localization of PAF-R was detected using a streptavidin-biotyn immunoperoxidase kit for rabbit IgG (DAKO Ltd. Bucks, U.K.). Diaminobenzidine was used as the chromogen. The immunostained sections were conterstained with Mayer's hematoxylin. Specificity of the immunoreactions was determined by comparing the reactivity of the antibodies with that of 10% goat serum in PBS in the absence of the primary antibody. Hematoxylin and eosin sections were dated, based on the criteria of Fox and Buckley (15).

The specificity of the anti-PAF-R antibody was confirmed by the fact that PAF-R transfected CHO cells showed labeling whereas untransfected cells did not. Western blots with anti-PAF-R do not work reliably; the receptor is probably too hydrophobic to migrate adequately on gels.

Preparation of PAF-R probe
Total RNA from endometrium was prepared using RNAzol and quantified spectrophotometrically at 260 nm. Ethidium bromide staining confirmed integrity and the quality of the RNA was confirmed on 1% agarose-formaldehyde gel electrophoresis. cDNA was synthesized from total RNA using the Superscript Preamplification System (GibcoBRL Life Technologies, Paisley, Scotland). RT-PCR was performed as described previously (10) and the RT-PCR product of 1.3 Kb was subcloned into the BamHI and HindIII sites of pBluescript KS. Sequencing analysis was performed on the PCR fragment to confirm that it encoded the human PAF-R.

In situ hybridization
Frozen tissues was surrounded in embedding medium (Tissue-Teck O. C. T. Compound; Agag Scientific, Stanstead, Essex, U.K.) before 10 µm sections were cut and thaw mounted onto poly-L-lysine-coated glass slides for in situ hybridization studies. Sections were stored (for less than 2 wk) and dessicated at -80°C until use. For transcription of the antisense or sense RNA probes, the plasmid-containing RT-PCR product was linearized with HindIII or BamHI and the transcripts were generated by [3535S]UTP (1500 Ci mmol/l, Dupont NEN, Boston, Mass.) incorporation using the T7 or T3 RNA polymerases, respectively. The probes thus generated were single-stranded RNA probes and had a specific activity of 1 x 107 dpm/µg plasmid template. In situ hybridization was performed as previously described (18). Pretreated sections were hybridized with either sense or antisense probes in hybridization buffer at a final concentration of 1 x 106 dpm/ml. Hybridization was carried out at 50°C for 16 h. Two adjacent endometrial sections from each sample were hybridized with either sense or antisense probe during the same experiment. After serial washing, the slides were dipped in photographic emulsion and stored in a lightproof box at 4°C for 5 wk. The sections were then developed and counterstained in Mayer's hematoxylin.

Semiquantitative RT-PCR for PAF-R
cDNA was synthesized from total RNA. For initial amplification by PCR, 2 µl of six RT products from throughout the menstrual cycle were amplified with 2.5 units of Taq DNA polymerase and 20 µM of each mouse ß-actin primer (5' ß-actin: 5' GTTACCAACTGGGACGACA 3'; 3' ß-actin: 5' TGGCCATCTCCTGCTCGAA 3') in 100 µl of reaction mix containing 500 mM KCl, 200 mM Tris-HCl, and 2 mM MgCl2 as follows: 94°C, 30s; 50°C, 40s; 72°C, 60s. Reactions were temporarily halted after 20–30 cycles by cooling to 4°C and 10 µl of PCR product was removed from each tube. Reactions were then restarted by heating to 94°C and amplification was allowed to proceed for three additional cycles before removal of a another 10 µl of product. This was continued until each PCR reaction had been sampled six times. All products (10 µl; six per initial RT product) were then analyzed by 2% agarose gel electrophoresis. Dilutions of RT products were made where necessary and the amplification procedure was repeated until all samples were standardized for ß-actin content. After standardization, 2 µl of appropriately diluted RT products were amplified with five units of Taq DNA polymerase and 10 µM of each human PAF-R primer (5' PAF-R: 5' TCTTCTGCAACCTGGTCATCA 3' [608 bp to 628 bp]; 3'PAF-R: 5' GATCTGGTTGAATGGCACAAC 3' [985 bp to 1005 bp]) in 100 µl of reaction mix containing 500 mM KCl, 200 mM Tris-HCl, and 1.5 mM MgCl2, as follows: 95°C, 30 s; 60°C, 50 s; 72°C, 60 s. Sampling was initiated two cycles after the initial sampling cycle for ß-actin and reactions were temporarily halted every four cycles for sampling purposes. All products were then analyzed by 2% agarose gel electrophoresis to obtain the PAF-R mRNA profile throughout the menstrual cycle. The entire procedure was repeated three more times.

RNAse protection assay
A shorter PAF-R cDNA template of 420 base pairs was obtained by restriction digestion of the original plasmid containing the insert with Blp1. The transcript was generated using T7 polymerase, which hybridizes with human total RNA to yield a 420 base pair protected fragment of human PAF-R mRNA. The pTRI-ß-actin control template (Ambion, Whitney, Oxon) contained a 247 base pair fragment of human cytoplasmic actin (ß-actin) gene. The TRIPLE-script vector was transcribed to a 298 base antisense RNA probe using T3 polymerase, which generated a 247 base pair protected fragment of human ß-actin mRNA. This was used as a constitutively expressed gene product to control for possible differences in RNA amounts between samples in order to allow accurate quantitation of PAF-R mRNA abundance between RNA samples.

RNAse protection assay was carried out on an endometrial sample throughout the cycle as described previously (19). Antisense RNA was transcribed from each plasmid using {alpha}[32P]-CTP (Dupont NEN) to specific activities of 0.4–1.2 x 109 cpm/µg. Briefly, sample RNA (20 µg) was mixed with {alpha}[32P]-labeled riboprobe (0.5–1.0 x 105 cpm), denatured at 85 ± 5°C for 5 min, and incubated overnight at 45°C. Nonhybridized RNA was removed by the addition of RNAse digestion; thereafter, RNAses were inactivated, and RNA was extracted and precipitated. RNA pellets were resuspended in loading buffer; samples were denatured and electrophoresed on 4% polyacrylamide/8 mol/l urea gels. The gels were washed in buffer containing 10% methanol and 10% acetic acid before transfer to Whatman 3 mm paper. The gels were covered with saran wrap and dried under vacuum on a gel drier (BioRad Gel Dryer 583; BioRad Laboratories, Inc. Hertfordshire, U.K.) at 80°C for 30–60 min. Autoradiography was performed using X-ray film (Kodak Biomax MR) with intensifying screens at -70°C for 2 to 6 days. Quantitation of autoradiographic signals was performed by densitometric analysis, using densitometry computer software (Gelbase). Transcripts detected were assigned relative densitometric units and the ratio of PAF-R/actin was calculated for each sample. Negative controls included 20 µg of yeast tRNA in two reaction tubes. Control reaction 1 included radiolabeled probes in the absence of RNAse treatment, which should yield the full-length probes. Control reaction 2 was treated in the same manner as the RNA samples, thereby testing for nonspecific hybridization of radiolabeled probes.

The VEGF antisense control template was formulated from a 600 base pair cDNA (EcoR1) and cloned into pBluescript SK+. Transcripts were generated using T3 polymerase, which hybridizes with human total RNA to yield a 570 base pair protected fragment of human VEGF mRNA. ß-Actin was used as a constitutively expressed gene product for comparison of VEGF mRNA abundance between RNA samples. Ribonuclease protection analyses were performed as described above.

Measurement of NO release by chemiluminesence
For concentration dependence experiments, increasing concentrations of PAF-acether (De-hydro-PAF [C18]; Sigma Chemical Co. Ltd., Poole, Dorset, U.K.) in serum-free M199 buffer containing 0.2% BSA were added to endometrial tissue explants from both proliferative and secretory phases of the menstrual cycle. For experiments with PAF or vechicle in the presence of the PAF-R antagonist, WEB 2170 (20), or the NO synthesis inhibitor NG-monomethyl-L-arginine (L-NMMA), tissues were pretreated with the antagonists for 1 h and then stimulated in a final volume of 1.0 ml at 37°C for a another 2 h. A similar procedure was adopted for experiments with low Ca2+ (150 nM) HBSS and protein kinase C inhibitor Ro 31–8220. Reactions were terminated by removal of the supernatant, which was subsequently stored at -80°C for NO analysis. Levels of NO were measured in the gas phase using a Sievers NOA 270B chemiluminescence analyzer as described previously (21). The total amount of NO present in conditioned media was expressed as picomoles of NO/mg protein. Protein was extracted from endometrial tissue explants in PBS with 5 M sodium hydroxide and 0.1% sodium dodecyl sulfate (SDS) at 85°C for 1 h.

Western blot analysis
After exposure of cells to either PAF (0.1 nM–1 µM) or vehicle, the conditioned medium was removed and stored at -70°C. The cells were washed with ice-cold PBS and transferred to prefrozen Eppendorfs. After centrifugation (13,000 rpm, 4°C, 10 min), the supernatant was discarded and the pellet was frozen in liquid nitrogen for 5 min.

Samples were then allowed to thaw on ice in 100 µl ice-cold high salt buffer (KCl 0.4 M, Hepes pH 7.4 20 mM, DTT 1 mM, glycerol 20%, bacitracin 0.5 mg/ml, PMSF 40 µg/ml, pepstatin 5 µg/ml, leupeptin 5 µg/ml) prior to protein estimation. Protein extraction from the medium was performed by ethanol precipitation. Media was mixed with three volumes (15 ml) of ice-cold ethanol and stored at -70°C for 24 h. After centrifugation (6000 rpm, 4°C, 10 min), the supernatant was discarded and pellets were resuspended in PBS. Protein concentration was determined using the Bio-Rad protein assay (Bio-Rad Laboratories Inc., Herts, U.K.), with BSA as standard.

The nonradioactive enhanced chemuluminascence Western blotting system (Amersham, Bucks, U.K.) was used to detect VEGF in cell lysates and conditioned medium as described previously (19). Briefly, 50 µg total protein was separated by electrophoresis on a polyacrylamide gel consisting of a stacking gel overlaying the separating gel. The samples were loaded in a final volume of 25 µl with sample buffer containing 0.002% bromophenol blue and electrophoresed at 50 V for approximately 2 h. A kaleidoscope protein marker (Bio-Rad Laboratories, Richmond, Calif.) was run alongside the samples. This protein marker is a protein standard calibrated molecular weight and prestained, which allows accurate molecular weight determination of unknown protein. After electrophoresis, the protein was transferred onto a nitrocellulose membrane in a cooling system (10°C) overnight at 36 V. The filter was blocked to reduce nonspecific binding of the antibody using Tris-buffered saline-Tween (TBS-T) containing 10% Marvel and 2.5% BSA for 4 h. After washing in TBS-T, the membrane was incubated overnight at 4°C with the VEGF antibody. The primary rabbit polyclonal anti-VEGF antibody raised against a 20 amino acid peptide corresponding to residues 1 to 20, mapping at the amino terminus of human VEGF, was used at a dilution of 1:1000. The filter was washed and incubated with the secondary anti-rabbit antibody for 1.5 h at room temperature. After a final wash in TBS-T, the filter was incubated for 1 min at room temperature in detection reagent, immediately wrapped in saran wrap, and exposed for periods of 30 s, 1 min, 5 min, and 10 min to X-ray film.

Tyrosine phosphorylation
Confluent monolayers of endometrial glandual epithelial cells in 25 cm2 flasks were incubated with either PAF (1 µM), VEGF (1 ng/ml), or vehicle in a final volume of 5 ml of serum-free M199 supplemented with 0.2% BSA. Reactions were terminated at the appropriate time (1, 5, 15, or 30 min after stimulation) by rapid aspiration and the cells were washed twice with ice-cold PBS. Modified radioimmunoprecipitation assay buffer (0.5 ml; RIPA: 50 mM Tris-HCL, pH 7.4, 1% NP-40, 0.25% sodium deoxycholate, 150 mM NaCl, 1 mM EGTA, 1 mM PMSF, 1 µg/ml aprotinin, leupeptin, and pepstatin, 1 mM activated Na3VO4, and 1 mM NaF) was added and the flasks were rocked on an orbital shaker at 4°C for 15 min. Cell lysates were collected and centrifuged (13,000 rpm, 4°C, 10 min). Total protein (25 µg) was electrophoresed in a 10% SDS-polyacrylamide minigel at 50 V and proteins were electroblotted onto nitrocellulose for 3 h at 50 V. Blots were blocked for 2 h at room temperature in TBS-T containing 1% rabbit serum. After washing, the membranes were incubated overnight at 4°C with an anti-pTyr mAb (PY20: Affiniti, Exeter, U.K.) diluted 1:2000. Blots were washed and incubated with a secondary peroxidase-labeled anti-mouse antibody diluted 1:3000 for 1 h at room temperature. After a final wash in TBS-T, blots were incubated for 1 min at room temperature in detection reagent, immediately wrapped in saran wrap, and exposed to X-ray film.

Statistical analysis
Statistical analysis was performed using Student's paired t test.


   RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Localization of PAF receptor protein
PAF-R-like immunoreactivity was detected in endometrium throughout the menstrual cycle in all tissues examined and showed marked differences in the pattern of staining between different phases of the menstrual cycle. PAF-R-like-immunoreactivity was detected in glandular epithelial cells throughout the menstrual cycle. Stromal cells, however, stained strongly in the early proliferative and the late secretory endometrium, whereas in the mid-late proliferative and the mid-secretory endometrium they appeared relatively negative to the PAF-R antibody. During the early proliferative phase (EP, n=4), intense cytoplasmic immunostaining was seen in the glandular epithelium and stroma ( Fig. 1A). In mid-proliferative endometrium (MP, n=6), however, staining was confined largely to endometrial glands with relatively no staining of stromal cells ( Fig. 1B). The endometrial blood vessels also showed little or no staining in the MP phase ( Fig. 1B). During the late proliferative phase (LP, n=4), the intensity of PAF-R immunostaining varied from light to moderate in the endometrial glands whereas the endometrial stroma appeared negative ( Fig. 1C). In mid-secretory (MS, n=5) endometrium, strong to moderate staining was observed in the endometrial glands and light staining was also detected in the cytoplasm of vascular endothelial cells in endometrial blood vessels. Negligible immunostaining was seen in the endometrial stromal cells ( Fig. 1D). In the late secretory (LS, n=6) endometrium, strong to moderate staining was seen in the glandular epithelium whereas discrete cells within the stroma showed weak staining ( Fig. 1E). No immunostaining was observed in secretory endometrium ( Fig. 1F) when using nonimmune serum instead of the primary antibody.



View larger version (206K):
[in this window]
[in a new window]
 
Figure 1. Immunohistochemical localization of PAF-R in human endometrium during the menstrual cycle. Strong PAF-R immunoreactivity was seen in endometrial glandular (G) epithelial cells in early (A), mid- (B), and late (C) proliferative endometrium whereas no staining (arrows) was seen in the endometrial blood vessels (Bv) in these sections. In mid-secretory (D), staining was strong in glands and blood vessels, whereas glandular immunostaining was moderate to strong in late secretory (E) endometrium. Endometrial stroma showed strong PAF-R immunoreactivity in early proliferative (A) and thereafter was weak to nonexistent throughout the cycle. Plate F is stained with nonimmune control serum. x280.

Localization of PAF-R mRNA
In situ hybridization using 35S-labeled antisense riboprobe demonstrated cyclic changes in the expression of PAF-R mRNA in endometrial tissue during the menstrual cycle, with the highest level in the LS (n=4) phase of the cycle. Comparison of the hybridization signal obtained with sections of EP (n=3) endometrium with either control sense ( Fig. 2A, B) or the antisense ( Fig. 2C, D) probe demonstrated no expression of PAF-R mRNA in the early proliferative endometrium. In contrast, the level of hybridization signal was high in the late proliferative (n=4) endometrium and localized over the glands ( Fig. 2E, F). Similarly, PAF-R mRNA expression was high in the early secretory (n=3) endometrium, but was uniformly distributed over the glandular epithelium and stroma ( Fig. 3C, D). In the late secretory endometrium, the hybridization signal persisted over the glands and stromal cells and increased in intensity ( Fig. 3E, F). The degree of hybridization was consistently lower in the stroma compared with the glands throughout the menstrual cycle. A strong hybridization signal was seen around the blood vessels. The specificity of the signal was confirmed by the use of a sense probe ( Fig. 3A, B).



View larger version (189K):
[in this window]
[in a new window]
 
Figure 2. In situ localization of PAF-R mRNA expression in proliferative endometrium. Bright-field (A, C, E) and dark-field (B, D, F) photomicrographs of sections of endometrium after in situ hybridization with 35S-labeled sense (A, B) and antisense (CF) PAF-R RNA probe. Early proliferative phase (AD) and late proliferative phase endometrium (E, F). Endometrial glands (G). Blood vessels (Bv). Bar = 50 µm.



View larger version (193K):
[in this window]
[in a new window]
 
Figure 3. In situ localization of PAF-R mRNA expression in secretory endometrium. Bright-field (A, C, E) and dark-field (B, D, F) photomicrographs of sections of endometrium after in situ hybridization with 35S-labeled sense (A, B) and antisense (C–F) PAF-R RNA probe. Early secretory phase (A–D) and late secretory phase endometrium (E, F). Endometrial glands (G). Blood vessels (Bv). Bar = 50 µm.

Semiquantitation of PAF-R mRNA throughout the menstrual cycle
To quantify changes in PAF-R gene expression in endometrium throughout the menstrual cycle, variations in transcript levels were determined using a semiquantitative RT-PCR by normalization of the amount of PCR product for the PAF-R against that for ß-actin. The overall trend in PAF-R mRNA expression throughout the menstrual cycle, despite considerable patient variation, showed that the transcript levels were highest in endometrium from the mid- to late proliferative and in the late secretory phases of the menstrual cycle. Amplification of cDNA with primers specific for mouse ß-actin produced a single band of the predicted size (460 bp). Figure 4A shows amplification of appropriately diluted RT products from throughout the menstrual cycle standardized for ß-actin and on which amplification was subsequently performed, using primers specific for the PAF-R. Subsequent amplification of cDNA appropriately diluted with primers specific for the PAF-R similarly produced a single band of the predicted size (397 bp). Figure 4B demonstrates the cyclic changes in PAF-R mRNA expression in endometrial samples standardized for ß-actin, showing transcript levels increasing from the early to mid-proliferative, persisting in late proliferative endometrium, only to decrease in early secretory and then to increase progressively in the mid- and late secretory endometrium.



View larger version (42K):
[in this window]
[in a new window]
 
Figure 4. Semiquantitative RT-PCR for the PAF-R throughout the menstrual cycle. Samples of total RNA from early, mid-, late proliferative (EP, MP, LP) and early, mid-, late secretory (ES, MS, LS) phase endometrium were subjected to RT-PCR using primers specific for ß-actin and the PAF-R. A) PCR amplification of appropriately diluted RT products (EP: 1 in 500, MP: neat, LP: neat, ES: 1 in 5000, MS: 1 in 5000, LS: 1 in 2000) standardized for ß-actin (cycles 30, 33, 36, 39, 42, 45). A single band of 460 bp can be seen. B) Subsequent PCR amplification on ß-actin matched samples for the PAF-R (cycles 32, 36, 40, 44, 48, 52). A single band of 397 bp can be seen.

Quantitation of PAF-R mRNA throughout the menstrual cycle
Finally, levels of PAF-R mRNA were determined throughout the normal menstrual cycle using RNAse protection assay. Autoradiographic signals were apparent in all phases of the cycle; however, variation in signal intensity was observed between different phases ( Fig. 5A). Quantitation of autoradiographic signals by densitometric analysis showed relatively low abundance of PAF-R mRNA throughout the cycle in EP, MP, and LP phases of the cycle, as shown in Fig. 5B. The expression of PAF-R remained low in the ES and MS phases, giving densitometric PAF-R/ß-actin ratios similar to those found for proliferative phase endometrium. In the LS phase, the abundance of PAF-R mRNA increased dramatically by sixfold relative to all other cycle phases.



View larger version (35K):
[in this window]
[in a new window]
 
Figure 5. Quantitation of PAF-R mRNA in normal cyclic endometrium. A) Identification of mRNA for PAF-R by RNAse protection assay using total RNA isolated from human endometrium at various stages of the menstrual cycle. The abundance of mRNA for actin is also shown for each sample for comparison of RNA amount loaded onto each lane. Lanes 1 and 2 show control incubation of PAF-R and actin riboprobes with 20 µg yeast tRNA without or with RNAse treatment, respectively. Lanes 3–8 represent samples of 20 µg total endometrial RNA throughout the menstrual cycle. Lane 3, EP; lane 4, MP; lane 5, LP; lane 6, ES; lane 7, MS; and lane 8, LS. B) Graphical representation of PAF-R:actin mRNA throughout the menstrual cycle from the above experiment. Autoradiographic signals for PAF-R and actin are expressed as relative densitometric units. Data represent three sets of experiments.

Effect of PAF on NO release
Addtion of PAF to endometrial explants resulted in the rapid generation of NO consistent with activation of a constitutive isoform of NOS, with values exceeding basal release by 47.7±9.7% within 2 h of stimulation. No demonstrable difference was observed in the basal values of NO released by proliferative and secretory endometrium. The concentration of PAF required to evoke maximal NO release, however, appears to be governed by the phase of the menstrual cycle. Maximal NO release from proliferative (n=6) endometrial explants was observed ( Fig. 6A) after the addition of 1 µM PAF, whereas maximal PAF-mediated NO release from secretory (n=6) endometrial explants required only 0.1 nM of PAF ( Fig. 6B).



View larger version (17K):
[in this window]
[in a new window]
 
Figure 6. Dose dependency of PAF-mediated NO release from explants of proliferative (A) and secretory (B) phase endometrium. After equilibration, explants were stimulated for 2 h with PAF (0.1 nM–1 µM). Media was removed and NO levels were determined using a Sievers NOA 270B chemiluminescent analyzer. Results are expressed as mean±SEM of a typical experiment (duplicate determinations per experiment; six similar experiments).

At a range of PAF concentration (1 µM–1 pM) there was significant inhibition in total NO release in the presence of WEB2170 (10 µM), indicating that the response is mediated by the PAF-R. PAF-mediated NO release was attenuated by L-NMMA in a dose-dependent fashion, indicating NOS activation, with half-maximal inhibition (IC50) at approximately 5 µM ( Fig. 7). To identify the regulatory mechanisms involved in PAF-stimulated NO release, the roles of external calcium and protein kinase C (PKC) were determined by conducting experiments in the presence of both low calcium buffer and Ro 31–8220, a PKC inhibitor. Stimulation of endometrial explants with either 0.1 nM or 1 µM PAF in the presence of external calcium evoked a significant increase in total NO, with values typically 61.1±16.0% above basal (n=4, P<0.0001). When stimulations were conducted in the presence of low calcium buffer (150 nM), however, PAF-mediated NO release was totally abolished, suggesting total dependency on extracellular calcium (n=4, P<0.0001; Fig. 8). Moreover, the response was attenuated by pretreatment with, and stimulation in the presence of, 1 and 5 µM Ro 31–8220, inhibiting PAF-mediated (0.1 nM or 1 µM) NO release by 54.5±2.3% (n=3, P<0.001) and 82.5±8.0% (n=3, P<0.0001), respectively ( Fig. 8).



View larger version (15K):
[in this window]
[in a new window]
 
Figure 7. Effect of inhibition of NO synthesis by L-NMMA on PAF-mediated NO release. Explants of human endometrium were stimulated for 2 h with either 0.1 nM PAF (secretory phase endometrium) or 1 µM PAF (proliferative phase endometrium) in the presence of increasing concentrations of L-NMMA. Reactions were terminated by aspiration of the conditioned media and NO levels were determined using a Sievers NOA 270B chemiluminescent analyzer. The results are expressed as means±SEM of a typical experiment performed on secretory phase endometrium (duplicate determinations per experiment; six similar experiments). Basal NO release was 19,687.5 pmol/well and PAF-mediated NO release 25,983.1 pmol/well.



View larger version (14K):
[in this window]
[in a new window]
 
Figure 8. Effect of low external calcium and inhibition of protein kinase C on platelet-activating factor (PAF) mediated NO release from explants of human endometrium. After equilibration, explants were pretreated at 37°C with low calcium buffer or Ro 31–8220 (1 and 5 µM) for 1 h. Explants were then stimulated with either 0.1 nM PAF (secretory phase endometrium) or 1 µM PAF (proliferative phase endometrium) in the presence of 150 nM external calcium, 1 µM Ro 31–8220, 5 µM Ro 31–8220, or vehicle alone (control). The results are expressed as means ± SEM of a typical experiment performed on secretory phase endometrium (duplicate determinations per experiment; four similar experiments). Statistical analysis was performed using Student's unpaired t test. *P < 0.01; **P < 0.001; ***P < 0.0001, when compared with PAF-stimulated NO release.

Effect of PAF on VEGF expression
To further define the role of PAF, we examined the effect of this phospholipid on VEGF mRNA and protein in the endometrial glandual epithelial cell line. After stimulation with PAF (1 µM PAF) or vehicle, the reactions were terminated at the appropriate time (1, 2, 4, 8, 12, 24, or 48 h) by removal of the conditioned medium from confluent cell monolayers, and total RNA or protein was extracted. Stimulation with PAF resulted in at least a twofold increase in VEGF mRNA at 24 h compared to control ( Fig. 9). Prior to 24 h, mRNA levels were consistently lower in all samples; however, at 48 h VEGF mRNA was increased in both control and PAF-stimulated cells. PAF similarly evoked a dose-dependent up-regulation of VEGF protein in cell lysates after 24 h. The rabbit polyclonal anti-VEGF antibody raised against a 20 amino acid synthetic peptide, corresponding to the first 20 residues at the amino terminus of human VEGF, recognized one major band at 46 kDa ( Fig. 10). This effect of PAF on VEGF protein expression was inhibited, in a dose-dependent manner, by the specific PAF-R antagonist WEB 2170 (0.1 µM–10 µM; data not shown). No VEGF was detected in the conditioned media of either control or PAF-stimulated samples by Western blotting.



View larger version (35K):
[in this window]
[in a new window]
 
Figure 9. Effect of PAF on VEGF mRNA expression in human endometrial epithelial cells. Cells were stimulated for varying times in the presence and absence of 1 µM PAF. Identification of VEGF mRNA was by RNAse protection assay. The abundance of mRNA for ß-actin is also shown for each sample for comparison of VEGF mRNA abundance between RNA samples. Lanes C1 and C2 show control incubation of VEGF and actin probes in the absence and presence of RNAse treatment, respectively. Lanes 1 to 14 represent control and PAF-stimulated cells, respectively, at 1 h (1+2), 2 h (3+4), 4 h (5+6), 8 h (7+8), 12 h (9+10), 24 h (11+12), and 48 h (13+14). Transcripts detected were assigned relative densitometric units and the ratio of VEGF/actin RNA was calculated for each sample.



View larger version (15K):
[in this window]
[in a new window]
 
Figure 10. Effect of PAF on VEGF protein expression in human endometrial epithelial cells. After serum starvation, confluent monolayers were stimulated with PAF (0.1 nM–1 µM) for 24 h. Protein was then extracted from cells using high-salt buffer prior to protein estimation; Western blot analysis was performed to detect VEGF in endometrial epithelial cell lysates.

Effect of PAF and VEGF on protein tyrosine phosphorylation
In unstimulated human endometrial epithelial cells, a number of tyrosine phosphorylated proteins were observed ( Fig. 11). PAF (1 µM) stimulated a time-dependent increase in the tyrosine phosphorylation of two major proteins of approximately 125 and 42–44 kDa ( Fig. 11A). The phosphorylation state of pp125 was similarly increased by VEGF (1 ng/ml), but the response was more rapid than that observed with PAF; a significant increase in the phosphorylation state of this protein was apparent within 1 min rather than after 5 min of stimulation (Fig 11B). Reprobing of the anti-phosphotyrosine blot with anti-focal adhesion kinase anti-FLKpp125 antibody confirmed the identity of this band (data not shown).



View larger version (85K):
[in this window]
[in a new window]
 
Figure 11. Agonist-evoked protein tyrosine phosphorylation in human endometrial epithelial cells. Cells were stimulated in a time-dependent fashion with 1 µM PAF for 1, 5, 15, and 30 min (A), with 1 ng/ml VEGF for 1, 5, 15, and 30 min (B), or vehicle. Cell lysates were assayed for phosphotyrosine content by SDS-polyacrylamide gel electrophoresis. The identity of the 125 kDa band was confirmed by reprobing the anti-phosphotyrosine blot with anti-focal adhesion kinase. This is a typical representation of three separate experiments.


   DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
The major findings of this study are the cellular localization of mRNA encoding PAF-R and its translated protein in human endometrium, and the cyclic changes in PAF-R mRNA levels throughout the menstrual cycle. Moreover, it shows that PAF may mediate endometrial function by NO and VEGF release and that the ability of endometrium to respond to physiological concentrations of PAF varies markedly during the menstrual cycle. This does not correlate with the cellular localization of PAF-R mRNA or its translated product, supporting our original proposition that ovarian steroids prime the PAF-R for PAF signal in human uteri (13). Indeed, recent studies by Sato and colleagues (22) showing the up-regulation by estradiol of PAF-evoked intracellular Ca2+ in cultured endometrial cells confirm our earlier findings.

Cyclic changes in the expression of PAF-R mRNA demonstrated when using semiquantitative RT-PCR reflect similar changes observed both in the pattern of immunostaining and the intensity of hybridization signal between different phases of the menstrual cycle. This demonstrates that expression of the PAF-R is modulated by sex steroids in vivo. The discrepancy between no hybridization signal in contrast to PAF-R-like immunoreactivity in the early proliferative endometrium most likely reflects increased turnover of steady-state PAF-R mRNA in this phase of the cycle. An increase in PAF-R mRNA expression from the early proliferative to the late proliferative endometrium suggests that the receptor mRNA may be up-regulated by estrogen. Indeed, positive transcriptional regulation of human PAF-R transcript 2 (tissue type) by estrogen has been demonstrated in JR-st cells, a human stomach cancer cell line that expresses both functional endogenous PAF-R transcripts (23), and, more recently, in endometrial cells in culture (22). Furthermore, PAF-R mRNA expression in the late proliferative endometrium was confined to individual endometrial glands, suggesting that the PAF-R gene is likely to be transcriptionally activated in these cells.

PAF production has been shown to be regulated by ovarian steroids in endometrium (3). Moreover, the observation that PAF-R mRNA expression is high in the secretory phase of the cycle suggests that progesterone does not antagonize PAF-R mRNA expression stimulated by estrogen, but most likely enhances preferential expression in the glands and endothelial cells of the blood vessels. PAF is known to stimulate synthesis of PGE2 by enriched glandular fractions of human secretory endometrium (4). Functional PAF-R are confined to the glandular epithelium, as demonstrated by us (for review, see ref 2) and confirmed by Sato and co-workers (22). A similar pattern of sex steroid regulation of expression was reported for VEGF (24, 25) and bradykinin (26) in endometrium. Moreover, PAF-evoked phospholipase D activity (13) and intracellular Ca2+ (22) was up-regulated by 17ß-estradiol. These results strongly suggest that PAF is involved in the physiological process of reproduction and in the preparation of a receptive endometrium for implantation.

PAF is a potent vasodilator, a response dependent on intact endothelium-derived NO synthesis (27, 28). PAF was reported to stimulate NO release in a human endometrial epithelial cell line, HEC-1B, suggesting that NO might augment the vasodilatory effects of PAF (2). The current study demonstrates not only the production of NO in human endometrium, but also shows that the vasodilatory action of PAF is via NO release. Implantation is characterized by vasodilation (1). PAF-evoked NO generation in human endometrial explants was rapid and calcium dependent, consistent with the activation of a constitutive NOS (14). PAF-evoked NO was blocked by PAF-R antagonist WEB2170, indicating a receptor-mediated response. The maximal endometrial NO release was governed not only by the concentration of PAF, but also by the phase of the menstrual cycle. At 1.0 µM, PAF evoked maximal NO release in the proliferative endometrium, whereas only 0.1 nM PAF was required to generate maximal NO release in the secretory endometrium. The different responses exhibited by the proliferative and secretory endometrium may reflect cyclic variation in PAF-R density and/or the activity of PAF acetylhydrolase, the enzyme responsible for degradation of PAF during the menstrual cycle. It is equally possible, however, that estrogen primes the uterus to become more responsive to PAF. Estradiol-17ß up-regulates PAF-evoked phospholipase D activity (13) and PAF-induced intracellular Ca2+ release (22). The observation that PAF-mediated NO release is attenuated by Ro 31–8220 suggests that PKC may be an important point of modulation in the release of NO from endometrial explants. Ro 31–8220 inhibits members of the conventional PKC family (PKC isoenzymes PKCs-{alpha}, -ß, and -{gamma}) that are Ca2+ and phospholipid dependent (29). Use of Ro 31–8220 suggests a role for a member of the conventional PKC family in regulating PAF-mediated NO release. Indeed, PAF stimulates NO release from HEC-1B cells via PKC{alpha} (30).

Increased formation of NO could lead to increased endometrial bleeding (31). PAF-R is localized around the endometrial blood vessels during the secretory phase of the menstrual cycle. Since PAF-R expression increases dramatically duning the late secretory endometrium and PAF stimulates NO release, it is possible that one physiological function of PAF may be to promote menstruation. After menstruation, repair of the endometrium involves profound angiogenesis. During the secretory phase of the menstrual cycle, the spiral artery development occurs under the influence of progesterone, a process during which spiral arterioles develop from straight arteries in the myometrium and basal endometrium into the thickened superficial zone of the secretory endometrium (32). Thus, the increase in PAF-R gene expression and protein observed in the late proliferative and late secretory endometrium suggests that PAF may modulate cell growth and neovascularization. Recent studies have confirmed that PAFs possess angiogenic activity (33). PAF stimulates directional migration of endothelial cells in vitro, consistent with the morphologic alterations and redistribution of cytoskeleton seen in previous studies (34, 35), by acting on specific PAF-Rs without affecting cell proliferation (33). Furthermore, PAF has been implicated as a mediator of the angiogenesis induced by tumor necrosis factor (36) and to cooperate with other angiogenic molecules and chemokines, including VEGF, acidic and basic FGF, and hepatocyte growth factor (HGF), in inducing vascular development in Kaposi's sarcoma (37). The fact that PAF can stimulate VEGF mRNA and protein in endometrium supports our notion that PAF may modulate endometrial remodeling after menses, probably by up-regulating VEGF expression. Increases in both VEGF gene expression (38) and protein production (25) have been demonstrated in the late proliferative and late secretory phases of the menstrual cycle.

PAF and VEGF both stimulate the tyrosine phosphorylation of a number of proteins, including focal adhesion kinase, which raises the possibility that PAF directly or via VEGF may regulate endometrial cell motility and adhesion by activating this pathway. PAF antagonists have previously been shown to inhibit trophoblast outgrowth in vitro (5), suggesting that PAF may be involved not only in the activation of blastocyst attachment, but also in the differentiation of the trophectoderm into invasive trophoblast. Together, these results suggests that functional PAF receptors may play a role in the regulation of growth and division in endometrial cell by coupling to a tyrosine kinase pathway. In summary, the cyclic changes in PAF-R-like immunoreactivity and PAF-R mRNA expression in human endometrium, together with the observed stimulatory effects of PAF on NO release, VEGF mRNA, and protein expression, suggest roles for PAF in the control of the uterine vascular bed as well as in regeneration of the endometrium in preparation for implantation after endometrial shedding.


   ACKNOWLEDGMENTS
 
This work was funded by Medical Research Council grant #G94–15051.


   FOOTNOTES
 
1 Correspondence: Department of Obstetrics and Gynaecology, Birmingham Women's Hospital, University of Birmingham, Edgbaston, Birmingham, B15 2TG U.K. E-mail: A.S.Ahmed{at}bham.ac.uk

Received for publication June 23, 1997. Accepted for publication January 20, 1998.


   REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 

  1. McRae, A. C., and Heap, R. B. (1988) Uterine vascular permeability, blood flow and extra cellular fluid space during implantation in rats. J. Reprod. Fertil. 82, 617–625[Abstract]
  2. Ahmed, A., and Dearn, S. (1997) The role of platelet-activating factor and its receptor in endometrial receptivity. Adv. Exp. Med. Biol. 416, 277–290
  3. Alecozay, A. A., Harper, M. J. K., Schenken, R. S., and Hanahan, D. J. (1991) Paracrine interaction between platelet-activating factor and prostaglandins in hormonally-treated human luteal phase endometrium in vitro. J. Reprod. Fertil. 91, 301–312[Abstract]
  4. Smith, S. K., and Kelly, R. W. (1988) Effect of platelet-activating factor on the release of PGF2{alpha} and PGE2 by separated cells of human endometrium. J. Reprod. Fertil. 82, 271–276[Abstract]
  5. Spinks, N. R., Ryan, J. P., and O'Neill, C. (1990) Antagonists of embryo-derived platelet-activating factor act by inhibiting the ability of the mouse embryo to implant. J. Reprod. Fertil. 88, 241–248[Abstract]
  6. Nakamura, M., Honda, Z., Izumi, T., Sakanaka, C., Mutoh, H., Minami, M., Bito, H., Seyama, Y., Matsumoto, T., Noma, M., and Shimizu, T. (1991) Molecular cloning and expression of platelet-activating factor receptor from human leukocytes. J. Biol. Chem. 266, 20400–20405[Abstract/Free Full Text]
  7. Seyfried, C. E., Schweickart, V. L., Godiska, V. L. R., and Gray, P. W. (1992) The human platelet-activating factor receptor gene (PTAFR) contains no introns and maps to chrosome 1. Genomics 13, 832–834[Medline]
  8. Mutoh, H., Bito, H., Minami, M., Nakamura, M., Honda, A., Izumi, T., Nakata, R., Kurachi, Y., Terano, A., and Shimizu, T. (1993) Two different promoters direct expression of two distinct forms of mRNA of human receptor from human leukocytes. FEBS Lett. 322, 129–134[Medline]
  9. Kudolo, G. B., Kasamo, M., and Harper, M. J. K. (1991) Autoradiographic localisation of platelet-activating factor (PAF) binding sites in the rabbit endometrium during the peri-implantation period. Cell Tissue Res. 265, 231–241[Medline]
  10. Ahmed, A., Sage, S. O., Plevin, R., Shoaibi, M. A., Sharkey, A. M., and Smith, S. K. (1994) Functional platelet-activating factor receptors linked to inositol lipid hydrolysis, calcium mobilisation and tyrosine kinase activity in the human endometrial HEC-1B cell line. J. Reprod. Fertil. 101, 459–466[Abstract]
  11. Ahmed, A., and Smith, S. K. (1992) Platelet activating factor stimulates phospholipase C activity in human endometrium. J. Cell. Physiol. 152, 207–214[Medline]
  12. Ahmed, A., Ferriani, R. A., Plevin, R., and Smith, S. K. (1992) Platelet-activating factor mediates phosphatidylcholine hydrolysis by phospholipase D in human endometrium. Biol. Reprod. 47, 59–65[Abstract]
  13. Ahmed, A., Plevin, R., and Smith, S. K. (1995) Oestradiol-17ß modulates PAF-evoked phospholipase D activity but not inositol lipid hydrolysis in human endometrial cell line, HEC-1B. Cell. Signal. 7, 1–7[Medline]
  14. Lowenstein, C. J., Dinerman, J. L., and Snyder, S. H. (1994) Nitric oxide: a physiologic messenger. Ann. Int. Med.. 120, 227–233[Abstract/Free Full Text]
  15. Fox, H., and Buckley, C. H. (1983) Endometrium. In Atlas of Gynaecological Pathology (Gresham, G. A., ed) pp. 61–63, MTP Press Ltd., London
  16. Ahmed, A., Li, X. F., Shams, M., Gregory, J., Rollason, T., Barnes, N. M., and Newton, J. R. (1995) Localization of the angiotensin II and its receptor subtype expression in human endometrium and identification of a novel high-affinity angiotensin II binding site. J. Clin. Invest. 96, 848–857
  17. Müller, E., Dagenais, P., Alami, N., and Rola-Pleszczynski, M. (1993) Identification and functional characterization of platelet-activating factor receptors in human leukocyte populations using polyclonal anti-peptide antibody. Proc. Natl. Acad. Sci. USA 90, 5818–5822[Abstract/Free Full Text]
  18. Shams, M., and Ahmed, A. (1994) Localisation of mRNA for basic fibroblast growth factor in human placenta. Growth Factors 11, 105–111[Medline]
  19. Sangha, R. K., Li, X.-F., Shams, M., and Ahmed, A. (1997) FGF Receptor-1 (flg) is a critical component for endometrial remodelling: Localisation and expression of FGF-2 and FGF-R1 in human endometrium during the menstrual cycle and decreased FGF-R1 expression in menorrhagia. Lab. Invest. 77, 389–402[Medline]
  20. Heuer, H. O., Casals-Stenzel, J., Muacevic, G., and Weber, K. H. (1990) Pharmacologic activity of bepafant (WEB 2170), a new and selective hetrazepinoic antagonist of platelet-activating factor. J. Pharmacol. Exp. Ther. 255, 962[Abstract/Free Full Text]
  21. Ahmed, A., Dunk, C., Kniss, D., and Wilkes, M. (1997) Role of VEGF receptor (Flt-1) in mediating calcium-dependent nitric oxide release and limiting DNA synthesis in human trophoblast cells. Lab. Invest. 76, 779–791[Medline]
  22. Sato, S., Kume, K., Takan, T., Mutoh, H., Taketani, Y., and Shimizu, T. (1997) Up-regulation of the intracellulkar Ca2+ signaling and mRNA expression of platelet-activating factor receptor by estradiol in human uterine endometrial cells. Adv. Exp. Med. Biol. 416, 95–100
  23. Mutoh, H., Kume, K., Sato, S., Kato, S., and Shimizu, T. (1994) Positive and negative regulations of human platelet-activating factor receptor transcript 2 (tissue-type) by estrogen and TGF-beta 1. Biochem. Biophys. Res. Commun. 205, 1130–1136[Medline]
  24. Charnock-Jones, D. S., Sharkey, A., Rajput-Williams, L., Burch, D., Schofield, J. P., Fountain, S. A., Boocock, C. A., and Smith, S. K. (1993) Identification and localisation of alternately spliced mRNAs for vascular endothelial growth factor in human uterus and estrogen regulation in endometrial carcinoma cell lines. Biol. Reprod. 48, 1120–1128[Abstract]
  25. Li, X. F., Gregory, J., and Ahmed, A. (1994) Immunolocalisation of vascular endothelial growth factor in human endometrium. Growth Factors 11, 277–282[Medline]
  26. Shams, M., Sisi, aP., and Ahmed, A. (1996) Localisation of bradykinin type II receptor mRMA in human endometrium. Mol. Human Reprod. 2, 35–39[Abstract/Free Full Text]
  27. Kamata, K., Mori, T., Shigenobu, K., and Kasuya, Y. (1989) Endothelium-dependent vasodilator effects of platelet-activating factor on rat resistance vessels. Br. J. Pharmacol. 98, 360–364
  28. Juncos, L. A., Ren, Y., Arima, S., and Ito, S. (1993) Vasodilator and constrictor actions of platelet-activating factor in the isolated microperfused afferent arteriole of the rabbit kidney. Role of endothelium-derived relaxing factor/NO and cyclooxygenase products. J. Clin. Invest. 91, 1374–1379
  29. Wilkinson S. E., Parker, P. J., and Nixon, J. S. (1993) Isoenzyme specificity of bisindolylmaleimides, selective inhibitors of protein kinase C. Biochem J. 294, 335–337
  30. Dearn, S., and Ahmed, A. (1998) Activation of platelet-activating factor receptor stimulates nitric oxide release in human endometrial epithelial cell line (HEC-1B) via protein kinase C alpha. Lab. Invest. In press
  31. Chaudhuri, G., and Nathan, L. (1992) Nitric oxide and endometrial blood flow. In Steroid Hormones and Uterine Bleeding (Alexander, N. J., and d'Arcangues, C., eds) pp. 241–244, AAAS Publication, Washington, D.C.
  32. Guyton, A. C. (1981) Textbook of Medical Physiology, pp. 1005–1020, W. B. Saunders, Philadelphia
  33. Camussi, C., Montrucchio, G., Lupia, E., De Martino, A., Perona, L., Arese, M., Vercellone, A., Toniolo, A., and Bussolino, F. (1995) Platelet-activating factor directly stimulates in vitro migration of endothelial cells and promotes in vivo angiogenesis by a heparin-dependent mechanism. J. Immunol. 154, 6492–501[Abstract]
  34. Bussolino, F., Camussi, G., Aglietta, M., Braquet, M., Bosia, P., Pescarmona, G., Sanavio, F., D'Urso, M., and Marchisio, M. (1987) Human endothelial cells are targets for platelet-activating factor. I. Platelet-activating factor induces changes in cytoskeletal structure and promotes albumin diffusion across endothelial monolayer. J. Immunol. 139, 2439–2446[Abstract]
  35. Camussi, G., Turello, E., Bussolino, F., and Baglioni, C. (1991) Tumour necrosis factor alters cytoskeletal organization and barrier function of endothelial cells. Int. Arch. Allergy Appl. Immunol. 96, 84
  36. Montrucchio, G., Lupia, E., Battaglia, E., Passerini, G., Bussolino, F., Emanuelli, G., and Camussi, G. (1994) Tumour necrosis factor alpha-induced angiogenesis depends on in situ platelet-activating factor biosynthesis. J. Exp. Med. 180, 377–382[Abstract/Free Full Text]
  37. Bussolino, F., Arese, M., Montrucchio, G., Primo, L., Benelli, R., Sanavio, F., Aglietta, M., Ghigo, D., Rola-Pleszczynski, M., Bosia, A., Albini, A., and Camussi, G. (1995) Platelet-activating factor produces in vitro by Kaposi's sarcoma cells induces and sustains in vivo angiogenesis. J. Clin. Invest. 96, 940–952
  38. Shweiki, D., Itan, A., Soffer, D., and Keshet, E. (1992) Vascular endothelial growth factor induced by hypoxia may mediate hypoxias-initiated angiogenesis. Nature (London) 359, 843–845[Medline]



This article has been cited by other articles:


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
N. F. Voelkel, R. W. Vandivier, and R. M. Tuder
Vascular endothelial growth factor in the lung
Am J Physiol Lung Cell Mol Physiol, February 1, 2006; 290(2): L209 - L221.
[Abstract] [Full Text] [PDF]


Home page
Hum Reprod UpdateHome page
C. O'Neill
The role of paf in embryo physiology
Hum. Reprod. Update, May 1, 2005; 11(3): 215 - 228.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
O. Chami, G. Evans, and C. O'Neill
Components of a platelet-activating factor-signaling loop are assembled in the ovine endometrium late in the estrous cycle
Am J Physiol Endocrinol Metab, August 1, 2004; 287(2): E233 - E240.
[Abstract] [Full Text] [PDF]


Home page
Anesth. Analg.Home page
M. Ogata, K. Nandate, T. Kawasaki, C. Kawasaki, M. Ozaki, and A. Shigematsu
A Platelet Activating Factor Receptor Antagonist Inhibits Cytokine Production in Human Whole Blood by Bacterial Toxins and Live Bacteria
Anesth. Analg., June 1, 2004; 98(6): 1767 - 1772.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
M. Maccarrone, M. DeFelici, F.G. Klinger, N. Battista, F. Fezza, E. Dainese, G. Siracusa, and A. Finazzi-Agro
Mouse blastocysts release a lipid which activates anandamide hydrolase in intact uterus
Mol. Hum. Reprod., April 1, 2004; 10(4): 215 - 221.
[Abstract] [Full Text] [PDF]


Home page
Reproductive SciencesHome page
C. Y. Cheung
Vascular Endothelial Growth Factor Activation of Intramembranous Absorption: A Critical Pathway for Amniotic Fluid Volume Regulation
Reproductive Sciences, February 1, 2004; 11(2): 63 - 74.
[Abstract] [PDF]


Home page
Mol Hum ReprodHome page
T. Sugano, H. Narahara, K. Nasu, K. Arima, K. Fujisawa, and I. Miyakawa
Effects of platelet-activating factor on cytokine production by human uterine cervical fibroblasts
Mol. Hum. Reprod., May 1, 2001; 7(5): 475 - 481.
[Abstract] [Full Text] [PDF]


Home page
Br. J. Ophthalmol.Home page
D. KENT, S. A VINORES, and P. A CAMPOCHIARO
Macular oedema: the role of soluble mediators
Br. J. Ophthalmol., May 1, 2000; 84(5): 542 - 545.
[Full Text]


Home page
Biol. Reprod.Home page
T. Sugano, K. Nasu, H. Narahara, Y. Kawano, Y. Nishida, and I. Miyakawa
Platelet-Activating Factor Induces an Imbalance Between MatrixMetalloproteinase-1 and Tissue Inhibitor of Metalloproteinases-1 Expressionin Human Uterine Cervical Fibroblasts
Biol Reprod, March 1, 2000; 62(3): 540 - 546.
[Abstract] [Full Text]